ID: 1103458999

View in Genome Browser
Species Human (GRCh38)
Location 12:121089100-121089122
Sequence ACAGGCTGAACAGTGTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103458990_1103458999 30 Left 1103458990 12:121089047-121089069 CCTCTGACTTGGGTCAGATCCTG No data
Right 1103458999 12:121089100-121089122 ACAGGCTGAACAGTGTGAGGAGG No data
1103458995_1103458999 -1 Left 1103458995 12:121089078-121089100 CCTCGTTCAGTGAGAAGGTCCAA No data
Right 1103458999 12:121089100-121089122 ACAGGCTGAACAGTGTGAGGAGG No data
1103458993_1103458999 11 Left 1103458993 12:121089066-121089088 CCTGGGAAGACGCCTCGTTCAGT No data
Right 1103458999 12:121089100-121089122 ACAGGCTGAACAGTGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103458999 Original CRISPR ACAGGCTGAACAGTGTGAGG AGG Intergenic
No off target data available for this crispr