ID: 1103459000

View in Genome Browser
Species Human (GRCh38)
Location 12:121089101-121089123
Sequence CAGGCTGAACAGTGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103458993_1103459000 12 Left 1103458993 12:121089066-121089088 CCTGGGAAGACGCCTCGTTCAGT No data
Right 1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG No data
1103458995_1103459000 0 Left 1103458995 12:121089078-121089100 CCTCGTTCAGTGAGAAGGTCCAA No data
Right 1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103459000 Original CRISPR CAGGCTGAACAGTGTGAGGA GGG Intergenic
No off target data available for this crispr