ID: 1103459978

View in Genome Browser
Species Human (GRCh38)
Location 12:121096053-121096075
Sequence GACTCCCCAGGCTCTTGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103459978_1103459986 5 Left 1103459978 12:121096053-121096075 CCCACGCAAGAGCCTGGGGAGTC No data
Right 1103459986 12:121096081-121096103 GAAAGACCCGCACGCGGGGCGGG No data
1103459978_1103459983 1 Left 1103459978 12:121096053-121096075 CCCACGCAAGAGCCTGGGGAGTC No data
Right 1103459983 12:121096077-121096099 ACCAGAAAGACCCGCACGCGGGG No data
1103459978_1103459982 0 Left 1103459978 12:121096053-121096075 CCCACGCAAGAGCCTGGGGAGTC No data
Right 1103459982 12:121096076-121096098 AACCAGAAAGACCCGCACGCGGG No data
1103459978_1103459990 20 Left 1103459978 12:121096053-121096075 CCCACGCAAGAGCCTGGGGAGTC No data
Right 1103459990 12:121096096-121096118 GGGGCGGGCCCAGCGACCTCGGG No data
1103459978_1103459985 4 Left 1103459978 12:121096053-121096075 CCCACGCAAGAGCCTGGGGAGTC No data
Right 1103459985 12:121096080-121096102 AGAAAGACCCGCACGCGGGGCGG No data
1103459978_1103459981 -1 Left 1103459978 12:121096053-121096075 CCCACGCAAGAGCCTGGGGAGTC No data
Right 1103459981 12:121096075-121096097 CAACCAGAAAGACCCGCACGCGG No data
1103459978_1103459989 19 Left 1103459978 12:121096053-121096075 CCCACGCAAGAGCCTGGGGAGTC No data
Right 1103459989 12:121096095-121096117 CGGGGCGGGCCCAGCGACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103459978 Original CRISPR GACTCCCCAGGCTCTTGCGT GGG (reversed) Intergenic
No off target data available for this crispr