ID: 1103462677

View in Genome Browser
Species Human (GRCh38)
Location 12:121117515-121117537
Sequence CATGGTCAGCAGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103462673_1103462677 -3 Left 1103462673 12:121117495-121117517 CCCTGATTTTCGGTAGGGAACAT No data
Right 1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG No data
1103462674_1103462677 -4 Left 1103462674 12:121117496-121117518 CCTGATTTTCGGTAGGGAACATG No data
Right 1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103462677 Original CRISPR CATGGTCAGCAGAATGAGGA TGG Intergenic
No off target data available for this crispr