ID: 1103465301

View in Genome Browser
Species Human (GRCh38)
Location 12:121137765-121137787
Sequence GGACTGGTGTGGACCACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103465296_1103465301 19 Left 1103465296 12:121137723-121137745 CCATGGGGCATAGGAATTGGGGA 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1103465301 12:121137765-121137787 GGACTGGTGTGGACCACAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 194
1103465294_1103465301 20 Left 1103465294 12:121137722-121137744 CCCATGGGGCATAGGAATTGGGG 0: 1
1: 0
2: 0
3: 13
4: 127
Right 1103465301 12:121137765-121137787 GGACTGGTGTGGACCACAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103465301 Original CRISPR GGACTGGTGTGGACCACAGG TGG Intronic
900330169 1:2130286-2130308 GGACTGGCATGGACCCCATGGGG + Intronic
900487279 1:2929162-2929184 GGCCTGGGGTGGCCCACAGCTGG + Intergenic
900556095 1:3281316-3281338 AGCCTGGTCTGGAGCACAGGTGG - Intronic
901158179 1:7154699-7154721 GGGCTGGTGTGGGGGACAGGAGG - Intronic
901847590 1:11993644-11993666 AGAATGGTGTGAACCCCAGGGGG + Intronic
904250906 1:29223652-29223674 AGACTGGGGAGGACCACAGGAGG - Intronic
905432492 1:37934721-37934743 GGTGTGGTGTGGACCCCAGAAGG + Intronic
906164458 1:43675595-43675617 GGACTGGAGAGGGCCTCAGGTGG + Intronic
907524801 1:55047894-55047916 GCACTGATGTGGAGTACAGGGGG - Intronic
907690789 1:56663388-56663410 GGACTGGTGAAGAGCAAAGGTGG - Intronic
908439819 1:64142423-64142445 GCACAGGTGTGGACTACCGGGGG + Exonic
908532796 1:65049629-65049651 GCACTGCTGTGGTCCACAGATGG + Intergenic
913088238 1:115458603-115458625 GCACTGATCTGGACCAAAGGTGG + Intergenic
915509205 1:156377413-156377435 GGACCAGTGTGGACCACTGCAGG - Exonic
915569037 1:156734003-156734025 GGGCTGGTTTGGACCACCTGTGG - Exonic
921046451 1:211481230-211481252 GCACCGGTGTGGACTACAGCTGG - Exonic
921560162 1:216647981-216648003 GGACTGCTGTGGTCAACACGGGG + Intronic
924616220 1:245614034-245614056 GGACTCGTGTGGCCCAGATGTGG + Intronic
1063588921 10:7377784-7377806 GAACTGGGCTGCACCACAGGAGG - Intronic
1064503016 10:15995136-15995158 GGACTGGTGTGGAACACTGTTGG - Intergenic
1064886141 10:20114576-20114598 GCACAGGTGTGGACCACAAAGGG + Intronic
1067429115 10:46231266-46231288 GGGCTGGAGTGGCCCACAGAAGG + Intergenic
1069550126 10:69358359-69358381 GCACTGGGGTGGGCCTCAGGGGG - Intronic
1069895643 10:71678669-71678691 GGAGTGGTGGGGACCACTGGAGG + Intronic
1071040870 10:81308047-81308069 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1072802848 10:98405276-98405298 GCCCTGGTGGGGACCACAGCGGG + Intronic
1075431343 10:122384517-122384539 AGAATGGTGTGAACCCCAGGGGG + Intronic
1076384592 10:130047225-130047247 AGCCTGGTGTGGACCCCATGGGG + Intergenic
1077439431 11:2561111-2561133 AGAATGGTGTGAACCCCAGGGGG + Intronic
1083344337 11:61979012-61979034 GGACTGTTGGGGCCCAGAGGAGG - Intergenic
1083854452 11:65385882-65385904 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1084526714 11:69702640-69702662 GGACAGGTGAGGCCCGCAGGAGG + Intronic
1084661053 11:70546648-70546670 GGGCTGGTGTAGACCCCTGGTGG + Intronic
1086819026 11:91412079-91412101 GGAATGGCGTGAACCCCAGGGGG - Intergenic
1086950970 11:92890108-92890130 GCTGTGCTGTGGACCACAGGAGG - Intronic
1089273127 11:117315422-117315444 GGGCTGGTGGGGACAGCAGGAGG - Intronic
1092597471 12:10023133-10023155 GAACTGGTAGGTACCACAGGTGG + Intergenic
1092657459 12:10702044-10702066 CGGCTGGTTTGGACCACTGGTGG + Exonic
1092728591 12:11507939-11507961 GGAAGGGTGTGGACATCAGGAGG - Intergenic
1092839979 12:12531033-12531055 GGGCTGGTGTGGACTAAAGGAGG - Intronic
1098901996 12:76120027-76120049 GGACCAGTGAGGACCACAGTGGG - Intergenic
1100321201 12:93494651-93494673 GGACAGGTCTTGACCACAGATGG + Intronic
1102060433 12:109926917-109926939 GGGCTTTTATGGACCACAGGGGG - Intronic
1102077169 12:110068830-110068852 GTACTGGTGTGGACCATAGGTGG - Intronic
1103312772 12:120025137-120025159 AGAATGGTGTGAACCCCAGGGGG - Intronic
1103465301 12:121137765-121137787 GGACTGGTGTGGACCACAGGTGG + Intronic
1103709512 12:122901305-122901327 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1104958944 12:132479084-132479106 AGGCCGGAGTGGACCACAGGAGG + Intergenic
1106144073 13:27036269-27036291 GGACGCGTGTGGATCACAGAAGG - Intergenic
1107028887 13:35830941-35830963 GGGCTGGTGTAGAGCACAGGAGG + Intronic
1107895302 13:44956052-44956074 AGAATGGTGTGAACCCCAGGGGG + Intronic
1108086138 13:46795879-46795901 GGAGTAGTTGGGACCACAGGTGG + Intronic
1113683229 13:112259707-112259729 AGATTAGTGTGGAGCACAGGAGG - Intergenic
1115105477 14:29756671-29756693 AGTCTGCTGTGGAGCACAGGTGG - Intronic
1117553489 14:56859997-56860019 GGATTTGTGGGGAGCACAGGAGG - Intergenic
1121635268 14:95449882-95449904 GGGCTGGGGTGGGCCACTGGCGG - Intronic
1122960355 14:105091351-105091373 GGGCCAGTGGGGACCACAGGAGG - Intergenic
1123090084 14:105738568-105738590 GGACTGGTGGGGACAGCATGGGG + Intergenic
1123090246 14:105739147-105739169 GGACTGGTGGGGACAGCATGGGG + Intergenic
1123095927 14:105767030-105767052 GGACTGGTGGGGACAGCATGGGG + Intergenic
1123830288 15:24129033-24129055 AGAATGGTGTGAACCCCAGGGGG + Intergenic
1125685870 15:41562948-41562970 GGACTGCTGTGAACCAAAGGTGG - Intronic
1128237562 15:66078462-66078484 GGTCTGCGGTGGCCCACAGGTGG + Intronic
1129605519 15:77023130-77023152 GAACCGGGGTGGCCCACAGGTGG + Intronic
1130048669 15:80465413-80465435 AGAGGGGTGTGGACCTCAGGAGG + Intronic
1132066279 15:98733514-98733536 GGCCTCGTCTGGACCACATGGGG - Intronic
1132771742 16:1567406-1567428 GGACTGGTGGGGACAGCAGAGGG - Intronic
1132885465 16:2180279-2180301 GGAGTGGGGTGGCCCTCAGGAGG + Exonic
1133884838 16:9816923-9816945 GGACTCCTGTGAACCAAAGGTGG - Intronic
1136641370 16:31568534-31568556 CGGCTGGTTTGGACCACTGGAGG + Intergenic
1141078620 16:81031612-81031634 GGAGAGGTGTGGAACACAAGGGG - Intronic
1141980542 16:87547458-87547480 GGGCAGGTGGGGACCACAGCAGG + Intergenic
1142356627 16:89604506-89604528 GGACTGGAGGGGAGCACTGGGGG + Intergenic
1142375235 16:89703155-89703177 GGACTGGTGTGGACCCATGGTGG - Intergenic
1143561288 17:7696784-7696806 GCACTGGTGTGGAGTCCAGGAGG + Intronic
1143624941 17:8104280-8104302 GGACTGGGGCTCACCACAGGGGG + Intronic
1144656438 17:17040214-17040236 GGACTGGAGGGGTCCACAGTAGG - Intergenic
1146132239 17:30288490-30288512 GGACAGGTGTGCACCACGCGTGG + Intronic
1146251771 17:31352324-31352346 GGACTGGTCTGGCCGACAGTTGG - Exonic
1146430948 17:32794205-32794227 GAACTAGTTAGGACCACAGGTGG + Intronic
1146940434 17:36840347-36840369 GGAGTGGGGTGGAACACTGGTGG - Intergenic
1147882177 17:43661149-43661171 GGCCTGGTGGACACCACAGGAGG - Exonic
1151523209 17:74645898-74645920 AGAATGGTGTGAACCCCAGGGGG + Intergenic
1153615429 18:6929472-6929494 GGCCTGGTGTAGACCCCGGGAGG - Intergenic
1153697793 18:7662042-7662064 TGAATAGTGGGGACCACAGGCGG + Intronic
1156354837 18:36332039-36332061 GGACTGGTGAGGAGGAGAGGAGG - Intronic
1156436650 18:37137857-37137879 GGACAGGTTTGGACCTCAGGAGG - Intronic
1160210428 18:76873879-76873901 GGACAGGAGAGGACGACAGGGGG - Intronic
1165867222 19:38946230-38946252 AGGCTGGGGTGGTCCACAGGGGG - Intronic
1165936719 19:39393734-39393756 GCACAGGTCTGGCCCACAGGAGG - Intronic
925241610 2:2335810-2335832 GGACTGGGCCGCACCACAGGAGG + Intergenic
926399339 2:12480509-12480531 GGACTGGTGTTGACCCTAGAGGG + Intergenic
926695960 2:15770386-15770408 GGACTGCTGGGGTCCAGAGGTGG - Intergenic
926925176 2:17980226-17980248 GGACAGGGGTGGGCCACAGCTGG - Intronic
930020043 2:46996187-46996209 GGACTGGACTGGTCCAAAGGGGG + Intronic
930163671 2:48182933-48182955 AGACTGTTGTGGACCATAGGTGG - Intergenic
930240532 2:48931721-48931743 AGAATGGCGTGAACCACAGGGGG - Intergenic
930667749 2:54115995-54116017 GGACTGCTGAGGACCAGAAGTGG + Intronic
933881302 2:86672739-86672761 GGAATGGTGTGGATTCCAGGTGG + Intronic
936407022 2:112214033-112214055 AGAATGGTGTGAACCCCAGGGGG - Exonic
937046190 2:118853319-118853341 GGACAGGTGGGGACCAGGGGTGG - Intergenic
938413699 2:131086974-131086996 AGAATGGTGTGAACCCCAGGGGG + Intronic
939950295 2:148463883-148463905 GGACTGGTGAGCACCAGAGAAGG - Exonic
940846025 2:158643176-158643198 AGATTGGTGAGGAACACAGGTGG + Intronic
940907389 2:159181383-159181405 AGAATGGTGTGAACCCCAGGGGG - Intronic
943456972 2:188120423-188120445 GGAATGGCGTGAACCCCAGGGGG - Intergenic
944916306 2:204364290-204364312 GGACTGTTGTTGATCACAGCTGG - Intergenic
1168894036 20:1311622-1311644 GGACTAGTGATGGCCACAGGTGG + Intronic
1169161489 20:3382894-3382916 AGACTGATGAGGACCACAAGTGG - Intronic
1169404615 20:5313474-5313496 TGACTGGTGAGGAGCACAGAAGG + Intronic
1170345292 20:15379492-15379514 GGACAGCTGTGGACCACCTGTGG - Intronic
1173897164 20:46559872-46559894 GGACTTGAGTGGGCCACTGGAGG + Exonic
1174572723 20:51513830-51513852 GGAATGGAGTGGCCCGCAGGAGG + Intronic
1174795296 20:53517264-53517286 GGACTGGACTGGACAGCAGGAGG + Intergenic
1175251055 20:57610465-57610487 GGGATGGTGTGGGCCACTGGTGG - Intronic
1175419384 20:58821854-58821876 GGGCTGTTGTGGGCCTCAGGCGG - Intergenic
1175986354 20:62765881-62765903 GGACTGGTAGGGACCACTGATGG + Intergenic
1176096950 20:63348733-63348755 GGACGGGTGGGGCACACAGGTGG - Intronic
1176804124 21:13463720-13463742 GAACTGGTGTGGATCCCAGGGGG + Intergenic
1180940206 22:19655853-19655875 GGACTGGTGTGTACACCTGGGGG - Intergenic
1180949138 22:19713443-19713465 GGACGGGTGGGGAGCAGAGGCGG + Intergenic
1181711402 22:24694179-24694201 GGACTGGTGTGTACCCCTGGGGG + Intergenic
1182455628 22:30448402-30448424 GGACTGCCCTGGACCCCAGGAGG - Intronic
950054376 3:10012857-10012879 GGACAGGTGGGAACCCCAGGAGG - Intergenic
950305563 3:11913304-11913326 GGACAGGTGGGAACCCCAGGAGG - Intergenic
950414293 3:12859862-12859884 GGATAGGTGGGGACCTCAGGAGG - Intronic
950414574 3:12861605-12861627 GGACAGGTGGGGACCCCAGGAGG - Intronic
950477678 3:13224218-13224240 TGATTGGTCTGGACCACAGAGGG - Intergenic
950728919 3:14939307-14939329 GGTGAGGTGTGGGCCACAGGAGG - Intergenic
952474345 3:33691135-33691157 GGACTGGTTTGGACTATCGGAGG + Intronic
953482109 3:43260607-43260629 GTGCTGGTCTAGACCACAGGAGG - Intergenic
954602201 3:51878408-51878430 GATCAGGTGAGGACCACAGGTGG - Intergenic
954608106 3:51929258-51929280 GATCAGGTGAGGACCACAGGTGG - Intergenic
954677655 3:52324600-52324622 GGACTGGTGTGGACAGCGGCAGG - Intronic
954743673 3:52774462-52774484 TGACTGGAGTGGACAACAGGGGG + Intergenic
961114388 3:124316276-124316298 GGACTGCTGGGGAGCAAAGGTGG - Intronic
964352154 3:155814057-155814079 AGAATGGCGTGAACCACAGGGGG - Intergenic
965550186 3:169956538-169956560 GGACTAGTGTGGTCCTCATGAGG - Intergenic
966003050 3:174973714-174973736 GTACAGGTCTGTACCACAGGAGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
968669366 4:1840576-1840598 AGAATGGTGTGGACCCCGGGGGG + Intronic
969690679 4:8702480-8702502 GGACAGGTGGGGACCCCAGGAGG + Intergenic
971315797 4:25566965-25566987 GGAATGGCGTGAACCCCAGGGGG - Intergenic
971445816 4:26747079-26747101 GGACTGTTGGTGACCACAGTTGG + Intronic
973346320 4:49060065-49060087 GGACTGGTCTGGAGCTCGGGTGG + Intronic
974675542 4:65083593-65083615 GAAATGGAGTAGACCACAGGAGG - Intergenic
981881439 4:149617559-149617581 GTACTGGAGTGGACACCAGGTGG - Intergenic
985997106 5:3603005-3603027 GGAGTGGAGTGGACCGCGGGCGG + Intergenic
987547634 5:19333395-19333417 GGAGTGGTGGGGTGCACAGGGGG + Intergenic
989667633 5:43874613-43874635 GGATGGGTGGGGACCAGAGGCGG + Intergenic
993062053 5:83050329-83050351 TGGTTAGTGTGGACCACAGGAGG + Intergenic
993224823 5:85155057-85155079 GAACTGGCATGGACCGCAGGTGG + Intergenic
994727806 5:103456789-103456811 AGATTGGTGTTGACTACAGGAGG - Intergenic
996857097 5:128020484-128020506 GGGCTGCTCTGGACCACAGGAGG - Intergenic
998162812 5:139822949-139822971 GGACTCAGGTGGATCACAGGTGG - Intronic
998219329 5:140263697-140263719 TGTCTGGTGAGGACCTCAGGAGG + Intronic
998296183 5:140971105-140971127 GGATTGGGGTGGGCTACAGGTGG + Intronic
1001068261 5:168558247-168558269 AGAATGGTGTGAACCCCAGGGGG - Intronic
1004669196 6:17779827-17779849 AGAATGGTGTGAACCCCAGGGGG - Intronic
1006184410 6:32172622-32172644 GGAGTGGTTAGGAACACAGGCGG - Intronic
1006597517 6:35204150-35204172 AGAATGGTGTGAACCCCAGGAGG - Intergenic
1008739851 6:54593884-54593906 AGAATGGTGTGAACCTCAGGAGG - Intergenic
1010243765 6:73643247-73643269 GGAATGGTGTGAACCCCAAGGGG - Intronic
1012433189 6:99187715-99187737 CGAAGGATGTGGACCACAGGAGG - Intergenic
1012647225 6:101700839-101700861 GGACTGGTATAGAGCCCAGGGGG + Intronic
1016330460 6:142947349-142947371 GGACTGGTGTGCACCCTCGGGGG + Intergenic
1021710246 7:23409171-23409193 GAACTGGGCTGTACCACAGGAGG - Intronic
1031812832 7:126393284-126393306 GGAATGGTGTGGCCATCAGGAGG - Intergenic
1032225773 7:130030755-130030777 AGAATGGTGTGAACCCCAGGAGG - Intronic
1039286620 8:36048658-36048680 ACAAAGGTGTGGACCACAGGGGG + Intergenic
1040481928 8:47834330-47834352 GGACTGGTGTGGTCGACCAGCGG + Exonic
1043223308 8:77693608-77693630 GGACAGGTATGGACCAGTGGAGG - Intergenic
1043338425 8:79206773-79206795 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1043501644 8:80863980-80864002 GGTCTAGTGTGGAAGACAGGAGG - Intronic
1047951105 8:129935545-129935567 GAACTGGACTGCACCACAGGAGG - Intronic
1049269577 8:141687161-141687183 GGACTGGGGCTGCCCACAGGAGG - Intergenic
1049571554 8:143372373-143372395 GGGCTGGAGAGGCCCACAGGTGG - Intronic
1050962477 9:11752770-11752792 GGTCTGGGGAAGACCACAGGTGG - Intergenic
1052832716 9:33229021-33229043 AGTCGAGTGTGGACCACAGGTGG - Intronic
1053002458 9:34584828-34584850 GGAAAGGTCTGGACCAGAGGAGG - Intronic
1055057666 9:72038682-72038704 GCACTGTTGAGGACCACAGCTGG - Intergenic
1058066530 9:100554606-100554628 GGGCTGGTGTGGAGGACAGTGGG + Intronic
1060153076 9:121300880-121300902 GGGCTCCTGTGGATCACAGGAGG + Intronic
1060543678 9:124448319-124448341 GGACTGGTTTGGGCCACGGCTGG - Intergenic
1061854436 9:133433771-133433793 GTCCTGGTGTGAACCACAGATGG - Intronic
1061999149 9:134207367-134207389 GGACAGGTGAGGAGGACAGGTGG - Intergenic
1061999167 9:134207417-134207439 GGACAGGTGGGGAGGACAGGTGG - Intergenic
1061999210 9:134207543-134207565 GGACAGGTGAGGAGGACAGGTGG - Intergenic
1061999228 9:134207593-134207615 GGACAGGTGGGGAGGACAGGTGG - Intergenic
1061999234 9:134207606-134207628 GGACCGGTGGGGAGGACAGGTGG - Intergenic
1061999272 9:134207719-134207741 GGACAGGTGAGGAGGACAGGTGG - Intergenic
1061999288 9:134207769-134207791 GGACAGGTGGGGAGGACAGGTGG - Intergenic
1061999293 9:134207782-134207804 GGACAGGTGGGGAGGACAGGTGG - Intergenic
1061999299 9:134207795-134207817 GGACCGGTGGGGAGGACAGGTGG - Intergenic
1061999324 9:134207871-134207893 GGACAGGTGGGGAGGACAGGTGG - Intergenic
1187425708 X:19175740-19175762 GGGCTGGTGTGGTCCCCTGGAGG + Intergenic
1191179235 X:57541357-57541379 GGGCTGGAGTGAACCATAGGTGG + Intergenic
1193721419 X:84991512-84991534 GGCCAGCTGTGGGCCACAGGAGG + Intergenic
1193940780 X:87679060-87679082 GGACTGGAGTTGCACACAGGTGG + Intergenic
1196952005 X:120932782-120932804 GGACTTGTGTGGACCTAAAGGGG - Intergenic
1196952689 X:120937643-120937665 GGACTTGTGTGGACCTAAAGGGG - Intergenic
1196953374 X:120942504-120942526 GGACTTGTGTGGACCTAAAGGGG - Intergenic
1196954059 X:120947364-120947386 GGACTTGTGTGGACCTAAAGGGG - Intronic
1196954744 X:120952225-120952247 GGACTTGTGTGGACCTAAAGGGG - Intronic
1196956114 X:120961968-120961990 GGACTTGTGTGGACCTAAAGGGG - Intergenic
1196956796 X:120966829-120966851 GGACTTGTGTGGACCTAAAGGGG - Intergenic
1196957478 X:120971689-120971711 GGACTTGTGTGGACCTAAAGGGG - Intergenic
1196958160 X:120976549-120976571 GGACTTGTGTGGACCTAAAGGGG - Intergenic
1196958842 X:120981409-120981431 GGACTTGTGTGGACCTAAAGGGG - Intergenic
1196959523 X:120986269-120986291 GGACTTGTGTGGACCTAAAGGGG - Intergenic
1199678174 X:150205344-150205366 GGCCTGGTGGGGCCCCCAGGTGG - Intergenic