ID: 1103466003

View in Genome Browser
Species Human (GRCh38)
Location 12:121142388-121142410
Sequence TAGCAGGCTTGGAGATGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103466003_1103466008 27 Left 1103466003 12:121142388-121142410 CCTCTCCATCTCCAAGCCTGCTA 0: 1
1: 0
2: 4
3: 38
4: 305
Right 1103466008 12:121142438-121142460 AAATCTCTGACTTCTCTCCCGGG 0: 1
1: 0
2: 0
3: 25
4: 266
1103466003_1103466007 26 Left 1103466003 12:121142388-121142410 CCTCTCCATCTCCAAGCCTGCTA 0: 1
1: 0
2: 4
3: 38
4: 305
Right 1103466007 12:121142437-121142459 CAAATCTCTGACTTCTCTCCCGG 0: 1
1: 0
2: 0
3: 22
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103466003 Original CRISPR TAGCAGGCTTGGAGATGGAG AGG (reversed) Intronic
900188410 1:1343396-1343418 GAGCTGGCTGGGAGGTGGAGCGG - Intronic
900460186 1:2798942-2798964 TGGCAGGCTTGGAGGCTGAGAGG - Intronic
900617187 1:3570782-3570804 TACCAGGCTGGGCGGTGGAGGGG - Intronic
900997393 1:6129967-6129989 AAGCAGGCTTGGAGAGGGCAGGG - Intronic
901140433 1:7025725-7025747 TACCAGCTTTGGGGATGGAGTGG + Intronic
901197483 1:7448217-7448239 CAGCAGGCATGGACATGGAGTGG + Intronic
901361922 1:8708664-8708686 CAGCAGGCAAAGAGATGGAGAGG - Intronic
902626952 1:17682403-17682425 TGGCAGGCTTGGAGGTGGTGGGG - Intronic
902903153 1:19534126-19534148 AAGTGGCCTTGGAGATGGAGAGG + Intergenic
903478788 1:23638246-23638268 CAGTAGGCTGGGAGAAGGAGGGG + Intronic
903623606 1:24715460-24715482 TAGCAGGCATGGAGAGGAGGGGG - Intergenic
904852680 1:33470846-33470868 TAGGAGGGTTTGAGATGGGGAGG - Intergenic
907436953 1:54456096-54456118 GACCAGGCTTGGGGCTGGAGGGG + Intergenic
907609471 1:55853902-55853924 TAGCATTCTTGGAGTTGTAGAGG + Intergenic
908973472 1:69866410-69866432 CAGCAGGCTTGGTGATGAAAGGG + Intronic
909583907 1:77267679-77267701 TAGCAGTCAGGGAGATGAAGAGG + Intergenic
910070005 1:83201472-83201494 TTGCAGGCTTGAAGACGGAGAGG - Intergenic
910568037 1:88667388-88667410 TAGCATGCTAGGAGAAGCAGAGG + Intergenic
910771036 1:90832933-90832955 TAGCAGATTTACAGATGGAGAGG - Intergenic
911012806 1:93299570-93299592 TTGCTTGCTTGAAGATGGAGGGG - Intergenic
911761234 1:101619691-101619713 TAGGAGTATTGGAAATGGAGGGG + Intergenic
913515692 1:119603707-119603729 TACGAGGCTTGGAGGTGGAGTGG + Intergenic
916349803 1:163836422-163836444 CACCAGGCTTGGAGGTGGGGAGG - Intergenic
916489755 1:165291357-165291379 TACCTGGCTTAGAGATGAAGAGG + Intronic
916745973 1:167685156-167685178 TAGCAGGAAAGGAAATGGAGTGG + Intronic
917728290 1:177848586-177848608 TAGCAGGTTCTGAGAGGGAGAGG - Intergenic
918173052 1:182016480-182016502 TATCACCCTTGGAGAGGGAGTGG - Intergenic
918691292 1:187483365-187483387 CAGCAGCAGTGGAGATGGAGGGG - Intergenic
919787688 1:201270221-201270243 CAGCAAGCGTGGAGATGGGGTGG + Intergenic
919856789 1:201711578-201711600 CAGAAGGCTTGCGGATGGAGGGG + Intronic
920227101 1:204446924-204446946 TCACAGGATTGGAGAAGGAGGGG - Intronic
920664673 1:207954255-207954277 CTGCTGGCTTGAAGATGGAGGGG - Intergenic
920914512 1:210249288-210249310 TAGCAGGCTTGCTGATGGGTAGG + Intergenic
921663367 1:217835702-217835724 TACCAGGCTAGGAGCAGGAGAGG + Intronic
922503289 1:226111858-226111880 TGCCAGGCTTGGTGATGCAGTGG + Intergenic
923160924 1:231313901-231313923 AAGCAGGCTTGGCCATGGAACGG + Intergenic
1064313508 10:14233748-14233770 TGGGAGGCTGGGAGAAGGAGCGG + Intronic
1064418378 10:15169074-15169096 GAGCAGGGTTGGAGCTGGCGGGG - Intergenic
1065549008 10:26851766-26851788 TAGCAGGTTTGGAGATGCAGTGG + Intronic
1065621190 10:27583751-27583773 TTGCTGGCTTGAAGTTGGAGCGG + Intergenic
1067103619 10:43350721-43350743 TAGCAGCCATGGAGAGGGTGGGG - Intergenic
1067530208 10:47065523-47065545 TAGCAGGCATGGAGAGGAGGGGG + Intergenic
1067714376 10:48678030-48678052 CAGCAGGCTTGGAAAGGGAAGGG - Intergenic
1069589725 10:69634335-69634357 TGGCAGGCTCTCAGATGGAGGGG - Intergenic
1070805578 10:79268838-79268860 AGGCAGGTTTGGAGATGGAGAGG + Intronic
1070826934 10:79396529-79396551 TCGCAGGCTTTGAGTTGGAGAGG + Intronic
1071858101 10:89645632-89645654 TGGCAGACTTGGGGAGGGAGGGG + Intergenic
1072279815 10:93855538-93855560 TCTCAGGCTGGGGGATGGAGCGG + Intergenic
1073629559 10:105134928-105134950 TCACAGGCTTGCAGCTGGAGGGG - Intronic
1075083805 10:119400818-119400840 CAGCAGCCTTGGGGATGGGGAGG + Intronic
1075727265 10:124616940-124616962 TAGCAGGGTGGGGGGTGGAGGGG + Intronic
1075906312 10:126084763-126084785 TCGCAGGCTTGGGGATGGGGAGG - Intronic
1076405818 10:130212042-130212064 CAGCAGCCTTGGAGGAGGAGCGG - Intergenic
1076619779 10:131779787-131779809 TGACAGTCGTGGAGATGGAGAGG - Intergenic
1077400006 11:2350317-2350339 TTACAGGCTTGTAGATGGAAGGG + Intergenic
1078210134 11:9264273-9264295 TAGCAGCATTGTAGTTGGAGAGG - Intronic
1078610185 11:12813095-12813117 CAGCCGGCTTGGAGCTGGAAGGG + Intronic
1078763598 11:14272396-14272418 TGGTAGGATTTGAGATGGAGAGG - Intergenic
1079780819 11:24601139-24601161 TTGCTGACTTGAAGATGGAGGGG + Intronic
1081703727 11:45168271-45168293 GAGAAGGCTTGTAGATGGAGGGG - Intronic
1082215394 11:49561570-49561592 TAGCAGGCTTTGTGTTCGAGGGG - Intergenic
1082789971 11:57340402-57340424 TGTCAGGCTAGGAGATGGATGGG - Intronic
1083309274 11:61776182-61776204 AAGCTGGCTTGGGAATGGAGGGG + Intronic
1083759570 11:64808186-64808208 TCACAGGCTTGGAAAGGGAGTGG - Intronic
1083837282 11:65279269-65279291 GGGCAGACTTGGAGATGGGGTGG + Intronic
1085312062 11:75522667-75522689 TAGCAGTCTTGGATATGGGGGGG - Intronic
1086634179 11:89062908-89062930 TAGCAGGCTTTGTGTTCGAGGGG + Intronic
1087889588 11:103521897-103521919 TAGCAAGGTTTGAGGTGGAGAGG - Intergenic
1088582233 11:111327590-111327612 CAGCAGGGTTGGGGATGGTGGGG - Intergenic
1088633826 11:111799985-111800007 TAGAAGGCTTCCAGAAGGAGGGG - Intronic
1089254008 11:117184276-117184298 TGGCAGGCTTCTAGATGGGGAGG + Intronic
1089850026 11:121487797-121487819 AAGGAGGCCTGGAGATGGACCGG - Intronic
1090604261 11:128405258-128405280 TAGGATGCTTGGAAATGCAGAGG + Intergenic
1091617674 12:2061908-2061930 TTGCAGGTTTGGAGATAGAGGGG + Intronic
1091839041 12:3605984-3606006 TAGAAGGATTGGCGCTGGAGAGG - Intergenic
1092095168 12:5836102-5836124 TAGCAGAGGTGGAGACGGAGAGG - Intronic
1092856173 12:12675658-12675680 TTGCAGGCTCTGAGATGCAGGGG + Intronic
1094390323 12:29942101-29942123 TTGCTGGCTTGAAGATAGAGGGG - Intergenic
1095526105 12:43127572-43127594 AAGCAGGTGTGGAGTTGGAGGGG - Intergenic
1095596571 12:43965895-43965917 TAGCAGGTGGAGAGATGGAGTGG - Intronic
1096881989 12:54680742-54680764 AAGCAGGGCTGGAGCTGGAGAGG - Intergenic
1096914196 12:55014012-55014034 TTGCAGGCTTTCAGATGGAAAGG + Intergenic
1097298189 12:57989758-57989780 TAACAGGCAGGAAGATGGAGAGG + Intergenic
1098274437 12:68799139-68799161 TTGCTGGCTTGAAGATGGAGGGG + Intergenic
1101035399 12:100701171-100701193 CAGGAGGTTAGGAGATGGAGTGG - Intergenic
1101581772 12:106048297-106048319 TTGCTGGCTTGAAGATGGAGGGG - Intergenic
1101757543 12:107632909-107632931 TTGCTGGCTTGAAGATGGAGGGG - Intronic
1101992785 12:109501030-109501052 TAGCTGGCTTGCAGGTGGTGGGG - Intronic
1102186995 12:110956900-110956922 TAGCAGGCTGGGCCATGGGGAGG + Intergenic
1103466003 12:121142388-121142410 TAGCAGGCTTGGAGATGGAGAGG - Intronic
1103619394 12:122177270-122177292 TTGCTGGCTTGAAGATGGTGGGG + Intronic
1103870329 12:124086607-124086629 TTGCTGGCTTGAAGATAGAGGGG + Intronic
1104067066 12:125314903-125314925 TGGGAGACTTGGAGCTGGAGAGG + Intronic
1105283223 13:18982069-18982091 TATCAGGATTGGAGAGGCAGGGG - Intergenic
1106539604 13:30678179-30678201 TAGCAGGGGTGGGGGTGGAGGGG + Intergenic
1107339738 13:39393514-39393536 GAACAGGCTGGGAGATGGGGAGG + Intronic
1108709639 13:53020065-53020087 TAACAGCCAAGGAGATGGAGAGG - Intergenic
1109871756 13:68342208-68342230 TTACAGGCTTATAGATGGAGGGG - Intergenic
1110535520 13:76646725-76646747 TTGTTGGCTTGAAGATGGAGAGG - Intergenic
1111207082 13:85025163-85025185 TATCAGGCCTGGAAATGAAGAGG - Intergenic
1113365096 13:109668728-109668750 AAGCAGGGATGGAGAAGGAGGGG - Intergenic
1113643783 13:111977381-111977403 CAGCAGACTTGGAGAAGGAAAGG - Intergenic
1114624108 14:24117399-24117421 TGCCAGGCTGGGAGGTGGAGAGG - Intronic
1115159139 14:30373507-30373529 TTGGAGGCTGGGAGATGGAATGG - Intergenic
1115629623 14:35231055-35231077 TAGGTGGCTGGGGGATGGAGTGG + Intronic
1116112556 14:40605544-40605566 TAGGAGGCTGGGACAGGGAGTGG + Intergenic
1117000421 14:51365922-51365944 CACCGGGCTTGGAGATGGGGCGG - Intergenic
1118711737 14:68525171-68525193 TATCAGCTTTGGAGATGGAAGGG + Intronic
1119155163 14:72403454-72403476 TAGGAGGGGAGGAGATGGAGAGG + Intronic
1120173478 14:81270012-81270034 TAGTGAGCTTGGAAATGGAGGGG - Intronic
1120771449 14:88384841-88384863 TGTCAGGATTGGAGGTGGAGTGG + Intergenic
1121307672 14:92917251-92917273 CAGCAGGCTGGAAGAAGGAGTGG - Intergenic
1121598540 14:95185393-95185415 TGGAAGGCTGGGAGCTGGAGTGG - Exonic
1121723763 14:96131080-96131102 TGGCAGACTTGGCGATGGATTGG + Intergenic
1122085602 14:99300206-99300228 TTACAGGCTTGAAGATGTAGAGG + Intergenic
1124928273 15:34093675-34093697 TTGTAAGCTTGGAAATGGAGGGG - Intronic
1126112038 15:45181068-45181090 CTGCAGGCTTGGTGAGGGAGAGG - Intronic
1126694254 15:51312889-51312911 AAGCAGACTTGGGGATGGATGGG + Intronic
1127692623 15:61412836-61412858 TTCCAGGAATGGAGATGGAGAGG + Intergenic
1127718628 15:61677145-61677167 CTGCTGGCTTGAAGATGGAGGGG + Intergenic
1128145833 15:65332059-65332081 CAGCTGGCCTGGAGATGGACTGG + Exonic
1128457949 15:67843339-67843361 GGGCAGGCTTGGAGTTGCAGTGG + Intergenic
1128828397 15:70743151-70743173 TTGCTGGCTTGAAGATGGACGGG - Intronic
1128951696 15:71891062-71891084 TACCAGGGTTGGGGATGGGGTGG - Intronic
1129112694 15:73347009-73347031 CAGCAGGATTGGAAATGAAGAGG - Intronic
1130703668 15:86211553-86211575 TAGCAGCCTTGCAGGAGGAGGGG - Intronic
1131225787 15:90623610-90623632 GAGCAGGCCTGGAGGTGGAGAGG - Intronic
1134353912 16:13463305-13463327 TAGCAGGTGTGGAGAGAGAGAGG + Intergenic
1138399288 16:56732348-56732370 TTGCAGGCATGGGGATGCAGTGG + Intronic
1139307453 16:65999293-65999315 TAGCAGCAGTGGAGATGGAGTGG + Intergenic
1139409725 16:66750056-66750078 TAGAGGCATTGGAGATGGAGAGG - Intronic
1139559176 16:67730772-67730794 CAGCAGGCTTGGAGAGGGGTAGG + Intronic
1140658341 16:77163355-77163377 TTGCTGGCTTGAAGGTGGAGGGG + Intergenic
1140809235 16:78561196-78561218 TTGCTGGCTTTGAGATGCAGGGG - Intronic
1141257303 16:82414782-82414804 TTGCTGGCTTGAAGATGGAGGGG - Intergenic
1141519976 16:84572062-84572084 TGGAAGGCGTGGAGGTGGAGAGG - Intronic
1142851393 17:2706506-2706528 CTGCAGGCTTGGAGAGGGTGGGG - Intronic
1143822546 17:9576539-9576561 TAGCATTCTTGGAAATGAAGGGG - Intronic
1144787602 17:17840531-17840553 TAAGAGGCTTGGAGAGGAAGCGG - Intergenic
1144820608 17:18070946-18070968 GAGAAGGCATGAAGATGGAGGGG - Intergenic
1145017020 17:19405949-19405971 TTCCAGGCTGGGAGTTGGAGTGG - Intergenic
1148435819 17:47684194-47684216 TGGAAGGCTTGGACATGGAAGGG - Exonic
1148780577 17:50119068-50119090 TAGAGGGCTTGCAGTTGGAGTGG + Intronic
1149110388 17:53020764-53020786 TAGCAGGTTTGAAGATGAATAGG + Intergenic
1149189531 17:54042813-54042835 TAGCTGTCTTGGAGGTGGAGAGG - Intergenic
1149538284 17:57449285-57449307 TGACAGGGTTGGAGAAGGAGTGG - Intronic
1152714049 17:81889857-81889879 AGGCAGGCTGGGAGTTGGAGAGG + Intronic
1153384875 18:4480861-4480883 TAGCAGGATTGGAGATGGTGAGG + Intergenic
1153458727 18:5310017-5310039 TAGCAGGCCTGGAGAACTAGAGG - Intergenic
1153825923 18:8874964-8874986 TTGCTGGCTTGAAGATGGAGGGG - Intergenic
1155053149 18:22165411-22165433 TAACAGGCTTGGAGAGAGAGCGG + Intergenic
1155491438 18:26405322-26405344 TGAGAGGTTTGGAGATGGAGGGG + Intergenic
1156075793 18:33277685-33277707 TTGCTGACTTGAAGATGGAGGGG - Intronic
1158364694 18:56720196-56720218 TAGCACTTTGGGAGATGGAGGGG + Intronic
1159642953 18:70885376-70885398 TTGCTGGCTTGTAGATGGAAAGG + Intergenic
1160206225 18:76835882-76835904 TAGCAGGCTAATGGATGGAGAGG - Intronic
1160784776 19:894779-894801 TAGCAGGGTTGGGGAGGGAGGGG + Intergenic
1162843538 19:13373608-13373630 CAGAAGGGTTGGAGAAGGAGAGG - Intronic
1163238062 19:16041005-16041027 TAGCACGCTGGGAGACTGAGGGG + Intergenic
1163243878 19:16080449-16080471 AATCAGGCTTTGGGATGGAGAGG + Intronic
1163322447 19:16582638-16582660 TAGCAGGCCTGGAGTCAGAGCGG - Intronic
1164574760 19:29399350-29399372 TGTCAGGCTTGGAGATCGATAGG - Intergenic
927342443 2:21997696-21997718 TAACAGGCTTTGAGAGGAAGAGG + Intergenic
927369062 2:22333450-22333472 TATAGGGTTTGGAGATGGAGAGG - Intergenic
927696079 2:25240655-25240677 GAGCAGGGTTGACGATGGAGAGG + Exonic
929555342 2:42922302-42922324 GAAGAGGCTGGGAGATGGAGTGG - Intergenic
929888352 2:45898679-45898701 TACCAGTGTGGGAGATGGAGAGG + Intronic
929902452 2:46017145-46017167 AAAGAGGCATGGAGATGGAGAGG - Intronic
931846119 2:66205739-66205761 TTTCAGGTTTGGGGATGGAGGGG + Intergenic
932165211 2:69499132-69499154 GGGCAGGCCTGGAGATGAAGAGG - Intronic
932564921 2:72900261-72900283 AAGCAGGAGAGGAGATGGAGGGG - Intergenic
933644248 2:84797881-84797903 CAGAAGGCCTGGAGATGTAGGGG - Intronic
936792439 2:116165416-116165438 TGACAGGCTTAGAGGTGGAGGGG + Intergenic
937884298 2:126889558-126889580 TGGCAGGGTTGGAAATGGACAGG - Intergenic
937954918 2:127416773-127416795 TAGGAGGGGTGGAGGTGGAGAGG - Intergenic
938727998 2:134123566-134123588 TAGGAGGCATGGAGGAGGAGTGG + Intronic
939202658 2:139058017-139058039 ATGTAGGCTTGGAGAAGGAGAGG + Intergenic
939558167 2:143702000-143702022 CAGCTGCCTTGGAGCTGGAGTGG - Intronic
940519294 2:154722919-154722941 TTTCATGCTTGAAGATGGAGGGG + Intronic
941852394 2:170196851-170196873 CACCAGGCTAGGAGAAGGAGAGG + Intronic
943937855 2:193946406-193946428 TAGCAGTCTTGGTGGTGGTGGGG + Intergenic
944474594 2:200090761-200090783 CAGCTGGCTTGGATTTGGAGGGG - Intergenic
944568038 2:201011403-201011425 TTGAAGGCTTGGATAAGGAGGGG + Exonic
946371960 2:219286376-219286398 TGGCAGGGTTGTAGATGAAGGGG + Exonic
946698228 2:222383620-222383642 TTGCTGGCTTGGAGATGAAGGGG - Intergenic
947007197 2:225525905-225525927 TTGCTGGCTTGAAGATAGAGGGG + Intronic
947118903 2:226797601-226797623 AAGCCGGCATGGGGATGGAGCGG + Exonic
947341268 2:229142388-229142410 TAGTAGACTTTGAGAAGGAGAGG - Intronic
947403907 2:229755214-229755236 GAGCAAGGCTGGAGATGGAGTGG + Intergenic
947457316 2:230266784-230266806 TTGCTGGCTTCAAGATGGAGGGG - Intronic
947744053 2:232498481-232498503 TAGGAAGCTTGGTGATGCAGGGG - Intergenic
947766029 2:232638051-232638073 TAACAGGCTTGGAAATGGAGAGG - Intronic
948512501 2:238478251-238478273 TCACAGGCCTGAAGATGGAGAGG - Intergenic
948526628 2:238574753-238574775 GATCAGGCTTGGAGATGGCGGGG - Intergenic
948895706 2:240925941-240925963 TAGCAGGCAGGGACATGGTGAGG + Intronic
1169778518 20:9283116-9283138 TACCATGCCTGGAGAAGGAGTGG + Intronic
1170155188 20:13262795-13262817 GAGCTGGCTTTGAGGTGGAGGGG - Intronic
1170498811 20:16953561-16953583 AAGCAGGATTGGTGATGTAGTGG - Intergenic
1171266614 20:23776440-23776462 GAGCAGACTGGGGGATGGAGGGG - Intergenic
1171276163 20:23858076-23858098 GAGCAGACTGGGGGATGGAGGGG - Intergenic
1171430221 20:25078518-25078540 TTTCAGGGTTTGAGATGGAGAGG + Intronic
1172222634 20:33284309-33284331 TAGGAGGCCTGAAGGTGGAGGGG - Intronic
1172649074 20:36490448-36490470 TTGCTGGCTGGGAGAGGGAGTGG + Intronic
1173949459 20:46978800-46978822 TATAAGGCCTGGAGATGGATTGG + Intronic
1175702580 20:61150979-61151001 TTCCAGGCTTGCAGCTGGAGAGG - Intergenic
1175917301 20:62432524-62432546 GAGCTGGCTGGGAGAGGGAGGGG - Intergenic
1176427374 21:6557159-6557181 TAGCCGGCTTTGAGATGTGGTGG + Intergenic
1178940428 21:36900900-36900922 GAGCAGGTTTGGAGAGGAAGAGG + Intronic
1179008514 21:37534916-37534938 TAGCTCGCCTTGAGATGGAGGGG + Intergenic
1179313020 21:40213647-40213669 AACCTGGCTTGGAGATGGAGTGG + Intronic
1179578505 21:42322692-42322714 CAGCAGGCCAGGAGAGGGAGAGG - Intergenic
1179702865 21:43165476-43165498 TAGCCGGCTTTGAGATGTGGTGG + Intergenic
1179897762 21:44372153-44372175 TAACAGGTTTGTAGTTGGAGGGG - Intronic
1181897712 22:26125522-26125544 CAGCAGGCTTGGAGTTGCGGGGG - Intergenic
1182074086 22:27483172-27483194 CTCCTGGCTTGGAGATGGAGAGG + Intergenic
1183212344 22:36458648-36458670 TAGCAAGTTTGGAGCAGGAGAGG - Intergenic
1183221203 22:36514584-36514606 TTGCTATCTTGGAGATGGAGGGG + Intronic
1183347943 22:37318301-37318323 TGCCAGGCTTCAAGATGGAGGGG - Intergenic
949418786 3:3842259-3842281 AACCAGACTTGGAGATGGGGAGG + Intronic
949567149 3:5255448-5255470 TTTCTGGCTTGAAGATGGAGGGG - Intergenic
950079183 3:10209077-10209099 TAACAGGCTGGGAGATGAGGAGG - Intronic
951843797 3:27063708-27063730 TAGCAGGATTTGCTATGGAGTGG - Intergenic
952515789 3:34103864-34103886 CAGTAGGCTGGGGGATGGAGTGG + Intergenic
952709094 3:36411406-36411428 GAGCAGACTAGGAGAGGGAGAGG - Intronic
953707918 3:45245165-45245187 TAGCAGGTTTGGAGCTTGGGAGG + Intergenic
953768801 3:45763472-45763494 GAGGAGGCTTGAATATGGAGTGG + Intronic
954413293 3:50380656-50380678 TAGGAGGCTTGGAAATGGGGAGG + Intronic
954814510 3:53270141-53270163 TAGAAGGCCTGGGGCTGGAGAGG + Intergenic
956389233 3:68753743-68753765 TTGCTGGCTTGAAGATGGAGGGG + Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
958127335 3:89373839-89373861 TATAAGGCTTTGAGATGTAGAGG + Intronic
960812258 3:121636340-121636362 AAGAAGGCTGGGAGAGGGAGGGG - Intronic
961065218 3:123869586-123869608 TTGCAGACTGGGATATGGAGAGG - Intronic
961942172 3:130649463-130649485 TGGCAGCCGTGGTGATGGAGTGG - Exonic
962001755 3:131305396-131305418 TAGCAGGCATGGTGAGGGTGGGG + Intronic
962330070 3:134470632-134470654 TAACCTGCTTGGAGATGGACTGG + Intergenic
963501228 3:146129833-146129855 TAGCTTGCTGGGAGATGGAGAGG - Intronic
964423418 3:156528732-156528754 CAAGATGCTTGGAGATGGAGAGG + Intronic
964737516 3:159931816-159931838 AAGCAGAATTGGAGAGGGAGGGG - Intergenic
964746335 3:160016157-160016179 TACCAGGCCTGGCCATGGAGAGG - Intronic
964913271 3:161808404-161808426 AAGCAGGCTGGGAAATGCAGAGG - Intergenic
965499456 3:169440531-169440553 TAGAAGGGTTGGGGATGGGGTGG + Intronic
965881782 3:173396187-173396209 TATGAAGCTTGGAAATGGAGAGG - Intergenic
967464822 3:189792341-189792363 TCTCAGACTTGGAGATAGAGAGG + Intronic
967804411 3:193702362-193702384 TTGCAGGCTTGTAGGGGGAGAGG + Intergenic
970522347 4:16898663-16898685 TAGCAGGAGAGGAGAGGGAGAGG + Exonic
971536936 4:27764658-27764680 TTGCTGGTTTGAAGATGGAGAGG + Intergenic
972313591 4:37903993-37904015 CATCAGGCTTGGAGATTCAGAGG + Intronic
973238135 4:47928222-47928244 TAGGATGCTTTGAGATGGGGAGG + Intronic
975635139 4:76440881-76440903 AAGCAGTTTTGGAGAAGGAGAGG - Intronic
977909049 4:102510993-102511015 AAGCAGGATTGGAGATGAGGAGG + Intronic
978440662 4:108730111-108730133 CAGAAGGCTTGGAGCAGGAGGGG + Intergenic
978890615 4:113822081-113822103 TGGCAGGTTTGGACATGCAGGGG + Intergenic
980070480 4:128238195-128238217 TAGAAGGCTTTGAGAAGGGGGGG - Intergenic
980695186 4:136345539-136345561 TTGCCGGCTTAAAGATGGAGGGG + Intergenic
986000501 5:3627370-3627392 TTGCAGCCTTCGAGAGGGAGGGG - Intergenic
986180278 5:5386565-5386587 TTGCTGGTTTGAAGATGGAGGGG + Intergenic
986693277 5:10331372-10331394 CCGCAGCCTTGGAGATGGTGAGG - Intergenic
987235664 5:15938971-15938993 TAACTGGCTTGGAGATGCAGAGG - Exonic
987318295 5:16744631-16744653 AAGCAGGCTTGCAGAGGGAGCGG + Intronic
987931304 5:24402367-24402389 TAGCAGGTTTACAGATGGAGGGG - Intergenic
988013013 5:25515163-25515185 TTGCTGGCTTGAAGATGGAAGGG - Intergenic
989708684 5:44370184-44370206 AAACAGGCTTGGAGAAGGAGAGG - Intronic
990167462 5:53010517-53010539 TCACAGGCTTAGAGATGGAGAGG + Intronic
990749729 5:59001255-59001277 GCACAGGCTTTGAGATGGAGAGG - Intronic
990944239 5:61233263-61233285 CAGCAGGCCTGGTGATGGCGGGG + Intergenic
991556677 5:67902509-67902531 TGCAAGGCTTGGAGAGGGAGAGG + Intergenic
994719149 5:103360846-103360868 AAGAAGGCTTGGAAATGTAGAGG + Intergenic
996852381 5:127967068-127967090 CAACAGGCTTGGGGAAGGAGAGG + Intergenic
997331742 5:133068358-133068380 TAAGAGGCTGGGAGATGGATAGG + Intronic
997749070 5:136327361-136327383 CACTAGGCTTGGAGATGGGGTGG - Intronic
998699713 5:144684135-144684157 CAGCAGGCTGGGAGGAGGAGAGG - Intergenic
1001132538 5:169076428-169076450 AAGGAGGCAGGGAGATGGAGAGG - Intronic
1001237455 5:170042270-170042292 TGGAAGGAATGGAGATGGAGAGG - Intronic
1003825800 6:9950154-9950176 TTGCTGGCTTGAAGATGGAATGG - Intronic
1004040063 6:11966597-11966619 TTGCTGGTTTAGAGATGGAGGGG + Intergenic
1004742233 6:18473125-18473147 TTGCAAGCTTGAAGATGGAGGGG - Intergenic
1007959554 6:45946634-45946656 ACTCAGGCTGGGAGATGGAGTGG - Intronic
1008507785 6:52247431-52247453 AAGCAGACTTGGAGAATGAGGGG + Intergenic
1011019598 6:82797398-82797420 TTGCTGGCTTGAAGATGAAGGGG - Intergenic
1014559785 6:122875743-122875765 TCCCTGGCTTGAAGATGGAGGGG - Intergenic
1015604092 6:134937862-134937884 TCCCAGGCTTCGAGGTGGAGGGG - Intronic
1017174562 6:151491132-151491154 TTTCAGGCTGGGAGTTGGAGGGG - Intergenic
1018172134 6:161151816-161151838 CAGCAGCCTGGGAGGTGGAGCGG + Intronic
1019323416 7:425884-425906 GAGCAGGCTTGGGGGGGGAGTGG - Intergenic
1019441274 7:1048508-1048530 CAGCAGGCCTGGAGACAGAGGGG - Intronic
1019830526 7:3323608-3323630 TTGCTGGTTTGAAGATGGAGTGG - Intronic
1020461280 7:8433009-8433031 GGGCAGGCTTGGAGATGCAATGG + Intergenic
1021925843 7:25532885-25532907 TGTCAGGGTAGGAGATGGAGTGG - Intergenic
1022627823 7:32056178-32056200 TGGCAGGGTGGGAGATGGAGAGG + Intronic
1022953850 7:35363705-35363727 TGGAAGGGTGGGAGATGGAGTGG - Intergenic
1023221476 7:37923371-37923393 TGGCAGGCGTGGTGAGGGAGAGG + Intronic
1023752557 7:43386108-43386130 TTGCAGGCTGGAAGATGGAGGGG - Intronic
1023907350 7:44531997-44532019 GAGCAGGGTTGGAGGTGGGGAGG - Intronic
1024028130 7:45431648-45431670 TACCACGCTTGGGGATGGTGGGG + Intergenic
1027287778 7:76666631-76666653 TTGCAGGCTTGAAGACGGAGAGG - Intergenic
1029432513 7:100540001-100540023 AAGCCGGCCTGGAGATGGACGGG + Intronic
1029608615 7:101614778-101614800 CAGCAGGGGTGGAGGTGGAGAGG - Intronic
1029655897 7:101924233-101924255 TAGCAGGATGGGTGAGGGAGTGG + Intronic
1029787667 7:102808865-102808887 CTGCTGGCTTGAAGATGGAGGGG - Intronic
1033220761 7:139524968-139524990 TAGCAGGCGTGGAGACAGAGGGG + Intronic
1035817588 8:2557768-2557790 TTGCTGGCTTGAAGAAGGAGGGG - Intergenic
1036097648 8:5741477-5741499 GCTCAGGCTTGGAGAGGGAGGGG + Intergenic
1037429932 8:18800371-18800393 CTGCAGCCTTGGACATGGAGGGG + Intronic
1037715561 8:21394593-21394615 TAGCAGGCTGGAAGAGGGACAGG - Intergenic
1037878387 8:22560683-22560705 TAGGGGGATTGGAGATGGTGTGG + Intronic
1040433532 8:47367181-47367203 TTGCTGGCTTGGAGATGGAGAGG + Intronic
1041590571 8:59577065-59577087 TTGCTGGCTTGAAGATGGAAGGG + Intergenic
1041719486 8:60963375-60963397 TAGCAAGCTTGGAGCAGCAGTGG + Intergenic
1042185107 8:66128755-66128777 TACCAGGCTTTAAGGTGGAGGGG - Intronic
1043737377 8:83765539-83765561 TAGCAGGGTGGGTGAGGGAGCGG + Intergenic
1043861000 8:85317001-85317023 TAGTAGACTTGGAGATGATGAGG + Intergenic
1044950693 8:97432964-97432986 TAGAAGCCATGGAGATGGTGAGG + Intergenic
1047891598 8:129317712-129317734 TAGCTTGCTTGAAGATGGAAGGG + Intergenic
1048142046 8:131804139-131804161 GGGCAGGGTTGGAGGTGGAGGGG + Intergenic
1050095633 9:2062729-2062751 TAGAATGCTGGGAGAAGGAGGGG + Intronic
1051907504 9:22113283-22113305 TTGCTGGCCTGAAGATGGAGGGG - Intergenic
1053216260 9:36273058-36273080 AAGCAGGTTTGGAGATGGGCTGG + Intronic
1055646177 9:78363591-78363613 TTGCTGGCTTAGAGATGAAGGGG - Intergenic
1056657265 9:88519750-88519772 CATCAGGCTGGGAGGTGGAGAGG + Intergenic
1056764202 9:89434882-89434904 TAGAAGGCTGGGAGGTGCAGTGG - Intronic
1059589751 9:115645893-115645915 TTGCTGGCTTTGGGATGGAGGGG + Intergenic
1059811978 9:117865356-117865378 TAGCAGGTTTGGAGAGAGAAAGG + Intergenic
1060042612 9:120312354-120312376 CTACAGGCTTGCAGATGGAGGGG + Intergenic
1060353551 9:122881662-122881684 TTGCAGGGGTGGGGATGGAGAGG + Intronic
1060453211 9:123763347-123763369 TGACAGGCTTGCAGATGGACTGG + Intronic
1060669416 9:125456308-125456330 TTGTAGTCTTGGTGATGGAGGGG - Intronic
1060836973 9:126763407-126763429 AGGCAGGCTTGGAGAAAGAGAGG - Intergenic
1186224723 X:7386519-7386541 AAGCAGCGTTTGAGATGGAGTGG - Intergenic
1186819591 X:13273410-13273432 TATCAGGCTTGAACATGCAGAGG - Intergenic
1187111653 X:16307860-16307882 TTCCTGGCTTGAAGATGGAGGGG + Intergenic
1188108878 X:26173984-26174006 TAGGAGCCTTGGTGATGTAGTGG - Intergenic
1188576337 X:31655340-31655362 TTGCAGGCTCAGAGATGGAAGGG + Intronic
1189288318 X:39867539-39867561 TAGCAAGTTTGGAGGGGGAGGGG - Intergenic
1189530088 X:41871153-41871175 TTGCTGGCTTGAAGATGGAAAGG - Intronic
1189729642 X:44005481-44005503 CAGCTGACTTTGAGATGGAGAGG - Intergenic
1189968980 X:46398965-46398987 TAGCTGGCTTGAAGATGAAGGGG - Intergenic
1191955604 X:66639563-66639585 TAGCAGGCTTGGAGTTTGACAGG + Intergenic
1192259551 X:69496404-69496426 AAGCAGTCTGGGAGAAGGAGAGG + Intergenic
1195493797 X:105506079-105506101 TAGCAGACTTGGCAATGGATTGG + Intronic
1196185992 X:112745529-112745551 TTGCTGGCTTGAAGATGGAAAGG + Intergenic
1196997963 X:121404901-121404923 TGACAGGGTTGGGGATGGAGGGG - Intergenic
1197151849 X:123228786-123228808 TAGTAGGGTTGGAGAAGGTGGGG + Intronic
1199982335 X:152927952-152927974 CAGCAGGCTTGGCCATGGTGTGG - Intronic
1200243866 X:154512499-154512521 CTGCAGGCTCTGAGATGGAGAGG - Intronic
1200338184 X:155374382-155374404 CAGCAGTCTTGGAGCTGGCGAGG - Intergenic
1200348285 X:155466310-155466332 CAGCAGTCTTGGAGCTGGCGAGG + Intergenic
1201593611 Y:15641672-15641694 TTGCTTGTTTGGAGATGGAGTGG - Intergenic