ID: 1103471009

View in Genome Browser
Species Human (GRCh38)
Location 12:121181071-121181093
Sequence TACTTTTAAGAGAGGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103471009_1103471013 14 Left 1103471009 12:121181071-121181093 CCAACTGCCCTCTCTTAAAAGTA 0: 1
1: 0
2: 2
3: 21
4: 195
Right 1103471013 12:121181108-121181130 TCCAAAGATTAATTTTACTTTGG 0: 1
1: 0
2: 2
3: 42
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103471009 Original CRISPR TACTTTTAAGAGAGGGCAGT TGG (reversed) Intronic
906989239 1:50720569-50720591 TACTTTGAACTGAGGGCACTTGG + Intronic
908778025 1:67660514-67660536 TAATTCTAAGAGTGGGCAGTGGG - Intergenic
910681621 1:89871446-89871468 TATTTTTAGGAGAGGGAAGGGGG - Intronic
910721492 1:90291434-90291456 TAACATTAAGAGATGGCAGTGGG - Intergenic
911553158 1:99308790-99308812 TCCTTCTCAGAGAGGGGAGTGGG + Exonic
913088516 1:115460211-115460233 TACTTTTCAGAGATGCCAGAAGG - Intergenic
914044426 1:144078630-144078652 TACCTTTAGTAAAGGGCAGTTGG - Intergenic
914133684 1:144882057-144882079 TACCTTTAGTAAAGGGCAGTTGG + Intergenic
915619218 1:157069476-157069498 TAATTTTAAGAGAGGACAGCAGG + Intergenic
915738088 1:158097168-158097190 TCCTTTTATGAGAGCTCAGTGGG + Intronic
918118538 1:181517395-181517417 TACTTTAACCAGAGGGCAGTGGG + Intronic
919075122 1:192803897-192803919 TGCTTTTAAGAGATGTCTGTAGG - Intergenic
919078834 1:192845821-192845843 TTCTTATAAGAAAAGGCAGTAGG - Intergenic
919204745 1:194407486-194407508 CACTTTTAAAAGAGGGCTGTTGG + Intergenic
920138204 1:203787892-203787914 TACATTTAAGAGAGGTCAGTAGG + Intergenic
920679992 1:208064911-208064933 TGCTTTTAAGAGAGAGCCCTGGG - Intronic
921912209 1:220561976-220561998 TCCTTTTAAGAGAGAACATTTGG + Intronic
923252934 1:232193854-232193876 TACTTTGAAGTGAGGGCACTTGG - Intergenic
924303014 1:242658931-242658953 TACCTTTAAGACAGGGAATTAGG - Intergenic
1064741250 10:18437302-18437324 TACTTCTAAGTTAGTGCAGTTGG + Intronic
1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG + Intronic
1072639461 10:97200609-97200631 TACTTTCAGGAGAGGGAAATGGG - Intronic
1073338374 10:102727478-102727500 TACTTTTTAAAGAGGGAATTGGG - Intronic
1073423687 10:103443450-103443472 TACTTGGAAGATAGGGAAGTTGG - Intronic
1073454930 10:103630730-103630752 TTTTTTTAAGAGAAGGGAGTAGG - Intronic
1074061865 10:109973929-109973951 TGCTTTTAAGAAATGGAAGTTGG + Intergenic
1078211951 11:9276938-9276960 TTCTTTGTAGAGATGGCAGTGGG - Intergenic
1078635079 11:13042032-13042054 AGCTTGTAAGAGAGGGCAGCAGG + Intergenic
1078791894 11:14551782-14551804 TACTTTAAAGAGGGGACAGTGGG + Intronic
1079793167 11:24765379-24765401 TACTTTTGAGTGAGGGAATTAGG + Intronic
1080092054 11:28360202-28360224 CACTTTTAAGAGAAGGCAAATGG - Intergenic
1080201619 11:29678060-29678082 AACTTTAAAGAGAGGTCAGTAGG + Intergenic
1080653373 11:34240179-34240201 TACACTTTAAAGAGGGCAGTGGG - Intronic
1080894777 11:36440119-36440141 TACTTTTAAGGGAGGGTATGGGG - Intronic
1083336390 11:61924132-61924154 CATTTTTTAGGGAGGGCAGTTGG + Intergenic
1086480097 11:87225840-87225862 TACTTTAAAGATAAGGCAATTGG - Intronic
1091579774 12:1777347-1777369 TACTTTTAAGTGGGGGCCTTAGG - Intronic
1092352557 12:7767536-7767558 TATTTTTAAGAGACGGCAGTGGG - Intronic
1093958424 12:25248828-25248850 TGCTTTTAAGAGATGGTAGATGG - Intronic
1094604636 12:31939834-31939856 TTCTTTGAAAAGTGGGCAGTTGG + Intergenic
1094768981 12:33632219-33632241 TACTTTTAAGTGAAGGCACAAGG - Intergenic
1095293754 12:40505481-40505503 TACGTTTGAGAGATGGCAGCAGG - Intronic
1095651482 12:44615965-44615987 GACTTTTAAGTGCGGGCAATTGG - Intronic
1096665353 12:53160578-53160600 TTCTTTTAAGAGAGGCCACTGGG + Intronic
1097167529 12:57093696-57093718 TAGTCGTCAGAGAGGGCAGTAGG + Intronic
1097602920 12:61716831-61716853 TACTTCTAAGAGGAGGCAGAAGG + Intronic
1097943728 12:65343247-65343269 AACTTAGAAGAGATGGCAGTGGG - Intronic
1098377172 12:69829285-69829307 TATTATCAAAAGAGGGCAGTGGG + Intronic
1098458721 12:70707368-70707390 TACTTTTAAAAAAAGGAAGTAGG + Intronic
1098530578 12:71537284-71537306 TATTTTGTAGAGATGGCAGTGGG - Intronic
1099259925 12:80365549-80365571 TACTTTAAAAAGATGGCATTAGG - Intronic
1101638799 12:106570207-106570229 TACTCTTAAGAAAGGACAGAAGG + Intronic
1103471009 12:121181071-121181093 TACTTTTAAGAGAGGGCAGTTGG - Intronic
1103843975 12:123888469-123888491 TCCTTATAAGAGAAGGCAGAGGG + Intronic
1103998394 12:124844556-124844578 TACGTTTAAATGAGGTCAGTGGG + Intronic
1104311600 12:127658146-127658168 TCCTTGTAAGAGTGGGCAGGAGG + Intergenic
1104506853 12:129340254-129340276 CACTTCATAGAGAGGGCAGTTGG - Intronic
1106077156 13:26470503-26470525 TACTTTTAGGGGAGGGAAGGAGG - Intergenic
1106285292 13:28313352-28313374 TGTTTTTCAGAGAGGGCGGTAGG - Intronic
1106543732 13:30713184-30713206 GACTTTGAAGAGAGGGTCGTGGG + Intergenic
1107043700 13:35974277-35974299 TACTTTAAAATGAGGTCAGTGGG + Intronic
1107065796 13:36213669-36213691 TGCTTTCAAGAGAGGCCAGCGGG + Intronic
1107122756 13:36813306-36813328 TACTTTGAAGTGAGAGCACTTGG + Intergenic
1107232594 13:38128356-38128378 TACTTCTAAGAGAGAGCATGCGG + Intergenic
1109068830 13:57736879-57736901 TCCATCTAAGAGAGGGCAGGTGG - Intergenic
1110077900 13:71273081-71273103 TACTTTAAACAGAGGACAATTGG - Intergenic
1110559021 13:76890037-76890059 TGGTTTGAAGAGAAGGCAGTAGG - Intergenic
1110589158 13:77234401-77234423 AAATTTTATTAGAGGGCAGTAGG - Intronic
1111980739 13:95012886-95012908 TACTTTTCTCAGAGGGCTGTTGG - Intergenic
1112577668 13:100650826-100650848 TGCTTATAAAATAGGGCAGTTGG - Intronic
1115902114 14:38163442-38163464 TCCTTTTAAGAGAGTTCAGGGGG - Intergenic
1116851279 14:49911866-49911888 AGCTTTTAAGAGAGAGTAGTTGG + Intergenic
1118659380 14:67990917-67990939 TTCTTTTTAGAGAGGGTAGAAGG + Intronic
1118801612 14:69194920-69194942 TTCTTTTAAGAGATGGGAGCCGG + Intronic
1118941811 14:70346031-70346053 AAGCTTTAGGAGAGGGCAGTGGG - Intronic
1120702102 14:87709393-87709415 AACTTTTAATAGAGGGAATTAGG + Intergenic
1121379358 14:93449195-93449217 TATTTTTAACAGAGGGCCCTGGG + Intronic
1121676301 14:95755976-95755998 GACTTGTAAGAGAAGGCAGTGGG - Intergenic
1122123610 14:99567522-99567544 TAATCTTAAGATAGGGCAGGAGG + Intronic
1122674758 14:103402581-103402603 TACATTAAATAGAAGGCAGTTGG + Intronic
1129076062 15:72997111-72997133 TACTTTGAACAGAGAGCACTTGG - Intergenic
1133396639 16:5452611-5452633 TACTTTTCAGAAAGGTCACTGGG - Intergenic
1133686201 16:8167709-8167731 TACTGTGAGGAGGGGGCAGTGGG + Intergenic
1134647623 16:15882851-15882873 TTCTTTTAAGAGACAGGAGTTGG + Intronic
1137960517 16:52877491-52877513 TACTTTGAAGTGAGGGCATGTGG - Intergenic
1138088292 16:54153768-54153790 GTTTTTTAAGAGATGGCAGTGGG + Intergenic
1139746202 16:69076666-69076688 TACATTTAAGAGTGGGCAAATGG - Intronic
1140317909 16:73917267-73917289 CACATTTAAAAGAAGGCAGTTGG + Intergenic
1140903713 16:79392972-79392994 TTCTTTTAAGAGAGGGCGGCAGG - Intergenic
1144219590 17:13088060-13088082 TGCCTTTGGGAGAGGGCAGTGGG + Intergenic
1144464352 17:15485091-15485113 TACTTTTAACTGAGGGCATTTGG + Intronic
1146226247 17:31068945-31068967 TCCTTATAAGAGGGGGCAGGAGG + Intergenic
1147140074 17:38455723-38455745 TTCTGGTAGGAGAGGGCAGTTGG + Intronic
1150032790 17:61757455-61757477 TCCTTTTCAGAGAGGGCTGTAGG - Intronic
1152218142 17:79046348-79046370 TGCCTTTAACAGAGGGCAGGGGG + Intronic
1155359960 18:24990058-24990080 TCCTTATAAGAGAGAGCAGAGGG - Intergenic
1156671149 18:39471298-39471320 TAATTTTAAGAAAGAGAAGTTGG - Intergenic
1157297363 18:46456103-46456125 TACCTATAAGAGAGGGGAGAGGG - Intronic
1158776759 18:60592030-60592052 TACTATTAAAAGAGGGTACTGGG - Intergenic
1202683985 1_KI270712v1_random:32040-32062 TACCTTTAGTAAAGGGCAGTTGG - Intergenic
925854617 2:8117466-8117488 TATTTTTAAGAGAAAGCAATAGG + Intergenic
929159803 2:38820199-38820221 TCCTTTTTAGACAGGCCAGTGGG + Intronic
930551396 2:52839225-52839247 TACTTTAAAGTGAGGGCTCTAGG + Intergenic
931523160 2:63121669-63121691 TACTTTAAAAAAGGGGCAGTAGG - Exonic
932304753 2:70694199-70694221 GACTTTCAAGAGATGTCAGTTGG - Intronic
935644673 2:105324555-105324577 TAATTTTAAGCGAGGACACTTGG - Intronic
936882071 2:117265686-117265708 TACTTTAAATAGAGTGCAGTTGG - Intergenic
936974883 2:118208919-118208941 TATTCATAAGAGAGAGCAGTGGG + Intergenic
939874956 2:147567301-147567323 TACTTTGGAGAGAGTGCAATTGG - Intergenic
942964762 2:181878575-181878597 TCCTTTTAAGAGAGAGAAATAGG - Intergenic
944214512 2:197240830-197240852 TACTTTTAAGAGAGGGTGTTGGG - Intronic
945224874 2:207523429-207523451 TATTTTGAAGAGAGAGCAATAGG + Intergenic
1169582529 20:7040212-7040234 GACTTTTAATGGAGGGCATTTGG - Intergenic
1170320613 20:15093721-15093743 TACTTCTAAGAGAGGGATATAGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171147072 20:22794248-22794270 TGCTTCTTAGAGAGGGCACTGGG + Intergenic
1173437666 20:43047334-43047356 TTCTTTTAAGAGGGGGAAATGGG + Intronic
1174047029 20:47740997-47741019 TACGTTGAAGAGAGGGCAACAGG - Intronic
1177755230 21:25338631-25338653 TGCATCCAAGAGAGGGCAGTGGG - Intergenic
1177912669 21:27051840-27051862 TAATTTTAAGAAAGGACAATGGG + Intergenic
1177929993 21:27269496-27269518 TACTTTAAAGATATGTCAGTAGG - Intergenic
1179784692 21:43722735-43722757 GACTTTTAAGAGAGCACACTGGG - Intronic
1182208362 22:28651720-28651742 TATGTTTAAGAGAGGTCAGGAGG - Intronic
951113050 3:18828427-18828449 TACCTATAGGAGAGGGCAGCTGG + Intergenic
951221063 3:20069426-20069448 TTCTTGTTAGAGAGGGAAGTGGG + Intronic
952249714 3:31640056-31640078 TACCTTTTGGAGAGGGAAGTGGG - Intergenic
953249739 3:41233848-41233870 TACCTTTATCAGAGGCCAGTGGG - Exonic
953454494 3:43030846-43030868 TACTTTTGAGAGAAAGCAGGGGG + Intronic
953677639 3:45015733-45015755 TACTTCTCAGTGAGGGTAGTGGG - Intronic
954057412 3:48038799-48038821 TGCTTTTAAGAGTTGGCTGTAGG + Intronic
954462718 3:50636893-50636915 TACTCTGCAGAGAGGCCAGTGGG + Intronic
955192763 3:56776882-56776904 TGATTTTAAGATAGGGCAGAAGG + Intronic
955871536 3:63443404-63443426 TTCTTTCAGGAGAGGGAAGTTGG + Intronic
956609823 3:71111297-71111319 CACGTTTAAGAGAGGGCACTTGG - Intronic
957589822 3:82181610-82181632 AACTTTTAAAAAAGGGTAGTAGG + Intergenic
963665963 3:148186578-148186600 TACTTATAATAGAGTGCAATTGG - Intergenic
964734696 3:159904654-159904676 TACTTTTAAAAAAAGGAAGTAGG - Intergenic
967491037 3:190090974-190090996 TAGTTTTGAGAGATGGCAGGCGG - Intronic
967608247 3:191473817-191473839 TTCATTTAAGAGAGTGCAGGAGG - Intergenic
970300707 4:14678903-14678925 TTCTTTAAAGAGAGGGAACTGGG - Intergenic
972842711 4:42950150-42950172 TCCCTTTAAGAGAGAGCACTGGG + Intronic
975420642 4:74159866-74159888 TATTTTTTAAAGAGGGCACTAGG + Intronic
975545893 4:75560184-75560206 GACTTTAAAGAGAGAGGAGTAGG + Intronic
980180785 4:129398140-129398162 TAATTTTAAGAGAATGCAGCAGG + Intergenic
982349387 4:154398443-154398465 TTCTTTAAAGACAGGGAAGTTGG - Intronic
984476839 4:180245998-180246020 TACTTTTAAGTGAGAACATTTGG - Intergenic
984793580 4:183636663-183636685 TTGTTTTTACAGAGGGCAGTAGG - Intergenic
984890860 4:184491530-184491552 TATTTTTGAGACAGGGCAGCCGG - Intergenic
986944395 5:12998121-12998143 AACTTTTTAGAGAGGGGACTGGG + Intergenic
986970745 5:13333202-13333224 TACTGTGAAGAGTGGGTAGTTGG - Intergenic
987129944 5:14850950-14850972 TTAGTTTAGGAGAGGGCAGTGGG + Intronic
987623475 5:20366968-20366990 CATTTTTAAGAGAAGCCAGTGGG - Intronic
987885443 5:23806497-23806519 TCCTTTTGAGAGATGGCTGTTGG + Intergenic
989517640 5:42362045-42362067 TATTTTTAATAGAGGGAACTAGG + Intergenic
990938508 5:61176466-61176488 TAATTTTAAGACAGTCCAGTTGG + Intergenic
991592350 5:68266157-68266179 TAGTATTAGGAGAGGGCAGGGGG - Intronic
994373814 5:98995804-98995826 TACTTTTAAGAGAAGACAAGAGG + Intergenic
994556562 5:101314632-101314654 TTCTTTCAAGAGAATGCAGTCGG - Intergenic
997766099 5:136505176-136505198 AACTTTTAAGAGAGGAAAGAAGG + Intergenic
998362913 5:141605940-141605962 TATTTTTAAAAGATGGGAGTTGG - Intronic
998786143 5:145711110-145711132 TACTTCTAAAAGCGGGCAGATGG - Intronic
998906333 5:146909079-146909101 TGCAGCTAAGAGAGGGCAGTGGG + Intronic
1006820701 6:36892200-36892222 TGCTTTCAAGAGAGGCCTGTCGG - Intronic
1010708901 6:79149091-79149113 CACTTTGAAGAGAGGGCCATTGG - Intergenic
1011665988 6:89634532-89634554 TACTTTTCAGAGAGAGGAGGGGG - Exonic
1011872793 6:91917750-91917772 TACTTTGAAATGAGGGCAGAGGG + Intergenic
1013797455 6:113903660-113903682 TACTGGTAAGAGAGCTCAGTTGG - Intergenic
1014189473 6:118476302-118476324 TACTTTTCATAGAAGGCATTTGG + Intronic
1015392963 6:132703131-132703153 TTCTTATAAGAGAAGGCAGTGGG - Intronic
1016271669 6:142297320-142297342 TCTTTTTAAGAGAATGCAGTAGG - Intergenic
1017237089 6:152127836-152127858 TACATTTAAGCAAGGGCAGTGGG - Intronic
1017397251 6:154016496-154016518 TACCTTTAAGTGAGGGAAGAAGG + Intronic
1018004025 6:159603574-159603596 GACTTTTAAGAGAGGTGATTAGG - Intergenic
1020799780 7:12719279-12719301 CAATTTTCAGAGAAGGCAGTTGG + Intergenic
1021171002 7:17397999-17398021 TACTTAGAAGAGAGGAAAGTGGG + Intergenic
1022176791 7:27878798-27878820 TCATTTTAAAAGAGAGCAGTAGG + Intronic
1022328688 7:29357055-29357077 TACTTTTAAGAGATGTTACTGGG - Intronic
1025153646 7:56583667-56583689 TACTTTTAAGTTTGTGCAGTGGG + Intergenic
1026480024 7:70770214-70770236 TAGTTTTAAATGAGGGCACTTGG + Intronic
1027477502 7:78651824-78651846 TACATTTCAGAGAAGGCAGGGGG - Intronic
1027568835 7:79835436-79835458 TACTTTTTTGAGAGGCCTGTAGG - Intergenic
1027919485 7:84374674-84374696 TTCTTTTAAGAGAGAAGAGTTGG + Intronic
1027947421 7:84766435-84766457 TTCTTTTAAGGGAGGTCTGTTGG + Intergenic
1027990049 7:85346827-85346849 TAGTTTTAAGACATGTCAGTGGG + Intergenic
1028900146 7:96089593-96089615 TGCTTTTAAAAGTGAGCAGTTGG + Intronic
1029012304 7:97274493-97274515 TATTTTTAGTAGAGGGCAGTGGG + Intergenic
1032613861 7:133444646-133444668 TTCTTTGAAGAGATGGCATTTGG + Intronic
1033593159 7:142831730-142831752 TACTTTTAACAGAGCACAGCAGG - Intergenic
1035079374 7:156203438-156203460 TAGTCTTAGGAGAGGGGAGTTGG + Intergenic
1036950975 8:13138986-13139008 TATTTTTAAGAGAGAGAAGCTGG + Intronic
1037225980 8:16590608-16590630 TACTTATAAGTGAGGGCATGTGG - Intergenic
1038218364 8:25584214-25584236 TGCGTTTAAGACAGGGCAGTTGG + Intergenic
1043466047 8:80507975-80507997 TAATTTTAAAAGATGGTAGTAGG + Intronic
1044982044 8:97726772-97726794 TTGTTTTAAGAGATGGCAGCTGG + Exonic
1047919838 8:129623478-129623500 TACTTGTAAGAGAGGACATACGG + Intergenic
1050241035 9:3635650-3635672 TACCTTTAAGTGAGAGCTGTTGG - Intergenic
1050438320 9:5632398-5632420 TACTTAGAATAGAGGACAGTAGG - Intronic
1050997369 9:12237291-12237313 TCTTTGTAAGAGAGGGAAGTTGG - Intergenic
1059539835 9:115118918-115118940 TTCTTTAAAGAAAGGGCTGTGGG - Intergenic
1060075301 9:120585352-120585374 TGCTCTTCAGAGAAGGCAGTGGG - Intergenic
1185939378 X:4298378-4298400 TGCTTTTAGGAGAAGGCAGCAGG - Intergenic
1186735083 X:12454308-12454330 TATTTTTAAGAGAAGGTACTTGG + Intronic
1187724330 X:22186880-22186902 TATTTTAAAGAGAGGGGAGTTGG + Intronic
1189736235 X:44072538-44072560 TCCTGTTGAGAGAGGGCTGTTGG + Intergenic
1191108670 X:56788512-56788534 TGCATGTAAGAAAGGGCAGTTGG + Intergenic
1194182727 X:90734040-90734062 TATTTTTAAGAGAGGTGAGCAGG + Intergenic
1194198100 X:90920972-90920994 AACTGTTAAGAGAGGACAATAGG + Intergenic
1194964960 X:100277775-100277797 TACTTTTAGCAGATGGAAGTGGG - Intergenic
1195659324 X:107362629-107362651 AAATTTTAAGAGAGGGAAGCGGG - Intergenic
1195760123 X:108236758-108236780 TACTCTCAAGAGAGAGGAGTTGG - Intronic
1196960768 X:120998463-120998485 TATTTTTAAAAGATGGCAGTAGG + Intergenic
1198237826 X:134752250-134752272 TTTTTTTTAGAGAGGGAAGTGGG + Intronic
1198330156 X:135615391-135615413 AACTTTTCTGAGATGGCAGTAGG - Intergenic
1198336773 X:135673609-135673631 AACTTTTCTGAGATGGCAGTGGG + Intergenic
1198362820 X:135912854-135912876 AACTTTTCTGAGATGGCAGTGGG - Exonic
1199817701 X:151413430-151413452 TACATATAAGAGAGAGCAGAGGG + Intergenic
1200529347 Y:4315995-4316017 TATTTTTAAGAGAGGTGAGCAGG + Intergenic
1200543641 Y:4491859-4491881 AACTGTTAAGAGAGGACAATAGG - Intergenic
1201712745 Y:17010337-17010359 TACTTTTAAGTGAGGACATGTGG + Intergenic