ID: 1103474565

View in Genome Browser
Species Human (GRCh38)
Location 12:121209384-121209406
Sequence GGCTACTCCGCACAGCCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103474552_1103474565 25 Left 1103474552 12:121209336-121209358 CCCCCAACCACAGCTGCCCAAGT 0: 1
1: 1
2: 52
3: 1361
4: 14085
Right 1103474565 12:121209384-121209406 GGCTACTCCGCACAGCCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 107
1103474557_1103474565 18 Left 1103474557 12:121209343-121209365 CCACAGCTGCCCAAGTTTAGGAG 0: 1
1: 0
2: 0
3: 17
4: 307
Right 1103474565 12:121209384-121209406 GGCTACTCCGCACAGCCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 107
1103474558_1103474565 9 Left 1103474558 12:121209352-121209374 CCCAAGTTTAGGAGCCCGCACTC 0: 1
1: 0
2: 0
3: 4
4: 32
Right 1103474565 12:121209384-121209406 GGCTACTCCGCACAGCCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 107
1103474554_1103474565 23 Left 1103474554 12:121209338-121209360 CCCAACCACAGCTGCCCAAGTTT 0: 1
1: 0
2: 1
3: 15
4: 222
Right 1103474565 12:121209384-121209406 GGCTACTCCGCACAGCCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 107
1103474559_1103474565 8 Left 1103474559 12:121209353-121209375 CCAAGTTTAGGAGCCCGCACTCG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 1103474565 12:121209384-121209406 GGCTACTCCGCACAGCCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 107
1103474555_1103474565 22 Left 1103474555 12:121209339-121209361 CCAACCACAGCTGCCCAAGTTTA 0: 1
1: 0
2: 2
3: 22
4: 408
Right 1103474565 12:121209384-121209406 GGCTACTCCGCACAGCCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 107
1103474562_1103474565 -6 Left 1103474562 12:121209367-121209389 CCGCACTCGTGAGCGATGGCTAC 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1103474565 12:121209384-121209406 GGCTACTCCGCACAGCCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 107
1103474553_1103474565 24 Left 1103474553 12:121209337-121209359 CCCCAACCACAGCTGCCCAAGTT 0: 1
1: 0
2: 2
3: 67
4: 1473
Right 1103474565 12:121209384-121209406 GGCTACTCCGCACAGCCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 107
1103474561_1103474565 -5 Left 1103474561 12:121209366-121209388 CCCGCACTCGTGAGCGATGGCTA 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1103474565 12:121209384-121209406 GGCTACTCCGCACAGCCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103474565 Original CRISPR GGCTACTCCGCACAGCCCCG GGG Intergenic