ID: 1103476699

View in Genome Browser
Species Human (GRCh38)
Location 12:121223940-121223962
Sequence TGCGAGTGAAGCTGGCACGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103476699_1103476704 -2 Left 1103476699 12:121223940-121223962 CCGCCGTGCCAGCTTCACTCGCA 0: 1
1: 0
2: 2
3: 6
4: 100
Right 1103476704 12:121223961-121223983 CAGGACCCACAGCATAGCCCGGG 0: 1
1: 0
2: 2
3: 33
4: 272
1103476699_1103476705 1 Left 1103476699 12:121223940-121223962 CCGCCGTGCCAGCTTCACTCGCA 0: 1
1: 0
2: 2
3: 6
4: 100
Right 1103476705 12:121223964-121223986 GACCCACAGCATAGCCCGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 98
1103476699_1103476703 -3 Left 1103476699 12:121223940-121223962 CCGCCGTGCCAGCTTCACTCGCA 0: 1
1: 0
2: 2
3: 6
4: 100
Right 1103476703 12:121223960-121223982 GCAGGACCCACAGCATAGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103476699 Original CRISPR TGCGAGTGAAGCTGGCACGG CGG (reversed) Intronic
900750698 1:4395238-4395260 TGGGAGTGGAGCTGCCATGGTGG + Intergenic
901881345 1:12195643-12195665 TGCGAGGGAAGCTGGGAAAGAGG + Intronic
904294827 1:29513426-29513448 TGTGTGTGAGGCTGGCATGGTGG - Intergenic
906523309 1:46479702-46479724 GGCCAGTGTAGCTGACACGGGGG + Intergenic
909673632 1:78214811-78214833 TTCCAGTGAAGGTGGCAGGGGGG - Intergenic
910288100 1:85576755-85576777 TGCGTGGGAGGCTGGCGCGGAGG - Intronic
913186849 1:116376268-116376290 TTCCAGTGAAGGTGGCAGGGGGG + Intronic
913328976 1:117651621-117651643 TGAGAGAGAAGTTGGCATGGTGG + Intergenic
1066362810 10:34747670-34747692 TGTGAGGGAACCTGGCATGGTGG - Intronic
1066747602 10:38616364-38616386 TGGGGTTGAAGCTGCCACGGGGG - Intergenic
1067284051 10:44894632-44894654 TGGGAGAGCAGCTGGCATGGGGG + Intergenic
1069144875 10:64878442-64878464 TGCCAGAGAAGCTGACATGGAGG - Intergenic
1071848852 10:89547999-89548021 TGAGAGAGAAGCTGGCAAGGTGG + Intronic
1074113124 10:110436732-110436754 GGAGAGTGAACCTGGCACTGGGG + Intergenic
1074763769 10:116686113-116686135 TGAGAGTGAAGCTGGGGAGGGGG - Intronic
1075382930 10:122033501-122033523 TGCAAGTGAAGCTGGGAATGGGG + Intronic
1079392119 11:20031646-20031668 TGAGAAGGAAGCTGGCACAGTGG - Intronic
1085508290 11:77072468-77072490 TGCAAGTGAAGTTGGAATGGGGG + Intronic
1086918139 11:92554912-92554934 TGCGAGAGAAGATGCCACTGGGG + Intronic
1089713070 11:120331051-120331073 TGAGAGTGAAACTGGCAGTGAGG + Intronic
1089912309 11:122113418-122113440 TGAGACTGAAGCTGGCTCTGGGG - Intergenic
1093958173 12:25246627-25246649 TGCAAGTGAGCCGGGCACGGTGG + Intronic
1094825191 12:34264298-34264320 TGAAAGTCAAGGTGGCACGGAGG + Intergenic
1095721049 12:45401191-45401213 TGCCAGTGAAGCTGGCACAGAGG - Intronic
1095926689 12:47585798-47585820 TGAGAGTGAAGGTGGCTGGGAGG + Intergenic
1100453957 12:94733785-94733807 AGCGAGGAAAGCTGGCTCGGTGG - Intergenic
1103476699 12:121223940-121223962 TGCGAGTGAAGCTGGCACGGCGG - Intronic
1104043024 12:125142827-125142849 TTGGAGGGAAGCTGGCCCGGAGG - Exonic
1112269288 13:97953539-97953561 GGCCTGTGAAGCTGGCAGGGTGG + Intergenic
1114726423 14:24942420-24942442 TGTGGGTGAAGCTGGGAAGGAGG + Intronic
1123045101 14:105508322-105508344 TGCGTGTGAGGCTGGCATGGGGG + Intergenic
1125740599 15:41960958-41960980 TGTAAGTGAGGCTGGCGCGGTGG - Intronic
1127615850 15:60684694-60684716 TGCAAGTGAATGTGGCAGGGAGG + Intronic
1130096323 15:80858955-80858977 TAAGAGTGAAGCTTGCACAGGGG - Intronic
1130726781 15:86447408-86447430 TGAGAATGAAGCTGACACCGTGG + Intronic
1132162663 15:99557252-99557274 TGGGAGTGAAGGTGACACAGAGG + Intergenic
1136735207 16:32461222-32461244 TGGGGTTGGAGCTGGCACGGGGG + Intergenic
1138199587 16:55078840-55078862 TGAGAGTGAGGCTGGCACAGAGG - Intergenic
1142248850 16:88982022-88982044 TTCGAGGGAAGCTGGAACCGCGG - Intergenic
1142407686 16:89900186-89900208 GGCAAGAGAAACTGGCACGGTGG + Intronic
1203017872 16_KI270728v1_random:368370-368392 TGGGGTTGGAGCTGGCACGGGGG - Intergenic
1203036207 16_KI270728v1_random:641528-641550 TGGGGTTGGAGCTGGCACGGGGG - Intergenic
1147194417 17:38755996-38756018 TGCAAGTGTAGCTAGCACTGAGG + Intronic
1147741090 17:42671295-42671317 GGCGTGAGAAGCTGGCAGGGTGG + Intronic
1147930662 17:43978562-43978584 TGGGAGAGAGGCTGGCAAGGGGG - Intronic
1148690551 17:49524642-49524664 TGGCAGTCAACCTGGCACGGGGG - Intergenic
1148874310 17:50677631-50677653 TGGGAGTGAGGCTGGCTGGGAGG + Intronic
1149452276 17:56759056-56759078 TGTGAGAGCAGCTGGGACGGAGG + Intergenic
1152984397 18:308579-308601 TGCGAGTGAAGGAGGCATGGAGG + Intergenic
1154203231 18:12314562-12314584 TGCGAGGGAGGCAGGCAGGGAGG - Intronic
1155331951 18:24727772-24727794 TGCTAGTGAAGCTCCCTCGGTGG - Intergenic
1157409176 18:47449320-47449342 TGGGAGTGGAGCTGGCACTGAGG + Intergenic
1159055545 18:63459646-63459668 GGCAAGTGAAGCAGGCATGGGGG + Intergenic
1159832490 18:73294277-73294299 TGGGAGTCAAGCTGGCAGAGGGG + Intergenic
1160531257 18:79566185-79566207 TGCGACTGAAGCTGACACGGCGG + Intergenic
1161566165 19:5004091-5004113 TGGCAGTAAAGCTGGCACTGGGG + Intronic
928258059 2:29742138-29742160 TGCGAGTGAACAGGGCAGGGAGG + Intronic
930246743 2:48991318-48991340 AGGGAGTGAAACTGGCAAGGAGG + Intronic
932835308 2:75030632-75030654 TGCTAGGGAAGCTGGGATGGGGG + Intergenic
936391425 2:112078062-112078084 TTGGAGGGAAGCTGGCAAGGTGG + Intronic
944672585 2:202007405-202007427 TGCCAGGGAAACTGGCATGGTGG + Intergenic
1170974607 20:21150373-21150395 TGCTGGTGAAGGTGGCACTGTGG - Intronic
1171063319 20:21987676-21987698 TGAGAATAAAGCTGGCAGGGAGG + Intergenic
1171519658 20:25766114-25766136 TGCCTTTGAAGCTGGCAGGGAGG + Intronic
1171557262 20:26090379-26090401 TGCCTTTGAAGCTGGCAGGGAGG - Intergenic
1172031429 20:31984755-31984777 GGCGAGGGAAGCTGCCACGTAGG + Intronic
1174435406 20:50503019-50503041 CGAGAGTGAAGCTAGCACAGGGG + Intergenic
1175916093 20:62426729-62426751 TGCGTGTGCAGCTGTCCCGGGGG - Intronic
1178417187 21:32413174-32413196 TGCGAGTGAAGTGGCGACGGGGG + Intronic
1178524595 21:33316386-33316408 TAGTAGTGAAGCTGGCACAGTGG - Intergenic
1179054066 21:37915647-37915669 AGCGACTGAAACTCGCACGGGGG - Intronic
1185286122 22:50000642-50000664 TGCAAGTGGAGCTGGCCGGGTGG - Intronic
949818832 3:8092871-8092893 TGCCAGTGAAGATGGCATGTGGG - Intergenic
949953301 3:9247492-9247514 TGGGAGTGGAGCAGCCACGGGGG - Intronic
950119197 3:10470652-10470674 TGCCAGTGAACTTGGCACAGTGG - Intronic
950770584 3:15307682-15307704 GGCGAGGGCAGCTGACACGGTGG + Intronic
952416206 3:33093393-33093415 TGTGAATGAAGCTGGCCCAGAGG + Exonic
959436180 3:106317647-106317669 TTCCAGTGAAGGTGGCAGGGGGG - Intergenic
963062028 3:141233039-141233061 TGGGTGTGAAGCTGGCAGTGCGG + Intronic
965839069 3:172882337-172882359 TGGGAATGAAGCAGGCAGGGTGG + Intergenic
968939460 4:3630511-3630533 AGCTAGTGCAGCAGGCACGGTGG + Intergenic
972883519 4:43455842-43455864 TGGGAGTCAACCTGGCACTGGGG + Intergenic
979952501 4:126910812-126910834 TGGGAGGGAAGCTGGGAAGGAGG + Intergenic
982067978 4:151671545-151671567 AGCCAGAGAAGCTGGCACGTGGG + Intronic
998164831 5:139837028-139837050 TGGGAGGGAGGCTGGCACAGAGG + Intronic
1000266231 5:159640885-159640907 TGGGAGGGAGGCTGGCAGGGGGG + Intergenic
1002134799 5:177100896-177100918 TGCCAGGGACGCTGGCAGGGAGG - Intergenic
1003076965 6:2990722-2990744 TGCGAGTGAAGGAGTCACGATGG - Intronic
1016454105 6:144213815-144213837 TGAGAATAAAGCCGGCACGGGGG - Intergenic
1016845128 6:148561958-148561980 TGCAAGGGAAGCTGGCAAAGGGG - Intergenic
1018834818 6:167474792-167474814 TGCTTGTGATGCTGGCACAGAGG - Intergenic
1019365629 7:631236-631258 TTTGAATCAAGCTGGCACGGCGG - Intronic
1022302934 7:29118825-29118847 TGCCTGTGAAGCTGGCAGGTTGG - Intronic
1028732798 7:94171519-94171541 TGAGAGTTAATCTGGCAAGGTGG + Intergenic
1031317155 7:120272865-120272887 AGCGAGAGAAGCTGGGAAGGAGG - Intergenic
1033023876 7:137754203-137754225 TGGGAGTGAAGCAGCCACCGGGG - Intronic
1035284714 7:157798964-157798986 TGGTATTGAAGATGGCACGGGGG - Intronic
1044097687 8:88088336-88088358 TGGGAGGGAAGCAGGCAGGGGGG + Intronic
1045184239 8:99819953-99819975 TGCGAGTGAAGCTGTCAATCTGG + Exonic
1049122612 8:140752890-140752912 AGCCAGTGAGGCTGGCACAGAGG + Intronic
1057459263 9:95244753-95244775 TGCAAGTGAAGCTGGCTAGTGGG + Intronic
1057562403 9:96138888-96138910 TGGCAGGGAAGCTGGCACAGAGG + Intergenic
1059180049 9:112203123-112203145 TGCGATTGAACCTGTCACTGAGG + Intergenic
1060351222 9:122862375-122862397 TGTGAGAGAAGCTGCCATGGAGG - Intronic
1061647702 9:132019160-132019182 TGGGAGTGAAGCTGCCACCCAGG + Intronic
1062469424 9:136696048-136696070 CGTGCGTGCAGCTGGCACGGGGG - Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1194224845 X:91244198-91244220 TTCCAGTGAAGCTGGCAGGGGGG + Intergenic
1197476258 X:126929332-126929354 TTCCAGTGAAGGTGGCAGGGAGG + Intergenic