ID: 1103478177

View in Genome Browser
Species Human (GRCh38)
Location 12:121233543-121233565
Sequence AGGTGTGGGGTAGGCCTCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103478177_1103478189 14 Left 1103478177 12:121233543-121233565 CCAGTGAGGCCTACCCCACACCT 0: 1
1: 0
2: 0
3: 6
4: 154
Right 1103478189 12:121233580-121233602 CCCATCAAAGAACAGAGAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 275
1103478177_1103478194 29 Left 1103478177 12:121233543-121233565 CCAGTGAGGCCTACCCCACACCT 0: 1
1: 0
2: 0
3: 6
4: 154
Right 1103478194 12:121233595-121233617 AGAGGAGGAGGAGGGAGAAATGG 0: 1
1: 12
2: 219
3: 1639
4: 8255
1103478177_1103478193 21 Left 1103478177 12:121233543-121233565 CCAGTGAGGCCTACCCCACACCT 0: 1
1: 0
2: 0
3: 6
4: 154
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528
1103478177_1103478186 11 Left 1103478177 12:121233543-121233565 CCAGTGAGGCCTACCCCACACCT 0: 1
1: 0
2: 0
3: 6
4: 154
Right 1103478186 12:121233577-121233599 AGCCCCATCAAAGAACAGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 166
1103478177_1103478192 20 Left 1103478177 12:121233543-121233565 CCAGTGAGGCCTACCCCACACCT 0: 1
1: 0
2: 0
3: 6
4: 154
Right 1103478192 12:121233586-121233608 AAAGAACAGAGAGGAGGAGGAGG 0: 1
1: 0
2: 45
3: 498
4: 3211
1103478177_1103478191 17 Left 1103478177 12:121233543-121233565 CCAGTGAGGCCTACCCCACACCT 0: 1
1: 0
2: 0
3: 6
4: 154
Right 1103478191 12:121233583-121233605 ATCAAAGAACAGAGAGGAGGAGG 0: 1
1: 0
2: 2
3: 56
4: 669

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103478177 Original CRISPR AGGTGTGGGGTAGGCCTCAC TGG (reversed) Exonic
900542352 1:3209501-3209523 GGGTGTGGAATAGGCCTCGCTGG + Intronic
901243139 1:7706321-7706343 AAGTCAGGGGTTGGCCTCACTGG - Intronic
901318892 1:8327399-8327421 AGGTGTGAGGTCAGCCCCACTGG + Intronic
901921118 1:12538335-12538357 AGGTGAGGGGTGGGGGTCACAGG + Intergenic
903025502 1:20427313-20427335 TGGTGTGGGGTGGCCCTAACTGG - Intergenic
903277727 1:22232528-22232550 AGGTTTGGGGTAGGACAGACAGG + Intergenic
906541088 1:46586616-46586638 AGGTGTGGGGTATGTCACACTGG + Intronic
910542050 1:88370739-88370761 GGGTGTGGGGAAGGTCTCAATGG - Intergenic
910656862 1:89628709-89628731 AGGTATGGGGTAGGACCCCCTGG + Intergenic
912790228 1:112642181-112642203 AGGTGCGGGGTAGTCTTCAGAGG - Intronic
915909736 1:159907109-159907131 AGGTATGGGGCAGGACTCTCTGG - Intergenic
916240227 1:162632106-162632128 AGGTGTGGGGTAGGCGGCGGGGG + Intronic
919748349 1:201022285-201022307 AGGTCTAGGGTAGGTCTCTCAGG - Intronic
921181504 1:212635486-212635508 AGGGCTGGGGCAGGCCTCTCTGG - Intergenic
922580680 1:226695643-226695665 AGGGGAGGGGGAGGCCCCACAGG - Intronic
1062968080 10:1625761-1625783 AGGGGTCGGGCAGGCCTCGCTGG - Intronic
1063017397 10:2092701-2092723 AGGTGTGGGGTTGGTTACACTGG - Intergenic
1067927722 10:50527194-50527216 AGCAGTGGGGTAGGCCTCTGTGG + Intronic
1069241442 10:66145226-66145248 AGCTGTGGAGTAGCCCTTACAGG - Intronic
1071416907 10:85449978-85450000 CGGTGTGGGGTTGGCCTCTCTGG - Intergenic
1072743753 10:97925988-97926010 AGGTCTGGAGTTGGCCTCAAGGG + Intronic
1072921930 10:99583932-99583954 AGGGGTGGGGTAGGGCTCCGGGG - Intergenic
1073480495 10:103783525-103783547 AGGTGTGGGGTGGTCCCAACCGG + Intronic
1076140782 10:128077348-128077370 AGGGGTTGGGCAGTCCTCACAGG + Intronic
1076453099 10:130570483-130570505 AGGTGTGTGTCAGGCCTCAGTGG + Intergenic
1076455400 10:130589557-130589579 AGCTGGGGTGTAGGCTTCACAGG - Intergenic
1080060818 11:27954874-27954896 AGGTCTGTGGAAGGCTTCACTGG + Intergenic
1081585535 11:44381415-44381437 AGGTTTGGGGTGAGCCTCAGGGG - Intergenic
1081752642 11:45522929-45522951 AGGTGTGGGTTAGTTATCACGGG + Intergenic
1083637885 11:64130077-64130099 TGGTGTGGGGTAGGTTTCTCGGG - Intronic
1084549671 11:69833830-69833852 AGGTGTTGGGGAGGGGTCACAGG + Intergenic
1088989698 11:114941885-114941907 AGTTGTGTGGTAGGCCTAAAGGG - Intergenic
1091807303 12:3365871-3365893 AGGGGTGGGGCAGGCATCCCGGG - Intergenic
1093387493 12:18576289-18576311 AGCTCTGGGGTAGGCTGCACTGG + Intronic
1094557235 12:31513171-31513193 AGGTTTGGGGAAGACCACACAGG + Intronic
1095811184 12:46373983-46374005 AGGTTTGGGGTAGGGAACACAGG - Intergenic
1099065519 12:77973576-77973598 ATGTGTGTGGTAGGGGTCACGGG - Intronic
1102783261 12:115583844-115583866 AGGTGTGGGGAAAGCCAGACCGG - Intergenic
1103478177 12:121233543-121233565 AGGTGTGGGGTAGGCCTCACTGG - Exonic
1104797507 12:131529754-131529776 AGGTGTGGAGAATGCCTGACAGG - Intergenic
1107414832 13:40190774-40190796 AGCTGTGGTGTGGGGCTCACAGG - Intergenic
1111425250 13:88071719-88071741 AGGTATGGGGTAGGACCCTCTGG - Intergenic
1113586231 13:111468054-111468076 AAGTGAGTGGTAGGCCCCACAGG + Intergenic
1113592904 13:111513191-111513213 AAGTGTGGGGAAGGCCTTTCTGG + Intergenic
1113750868 13:112775791-112775813 AGGTGTGGGCTGGGCTTCCCTGG - Intronic
1114568094 14:23647126-23647148 GGGGGTGGGGGTGGCCTCACAGG - Intergenic
1117067066 14:52021691-52021713 AGGTGAGTGGTTGGCCTCCCTGG + Intronic
1117119185 14:52550577-52550599 AGGTGGCAGGTAAGCCTCACAGG + Intronic
1121042456 14:90760221-90760243 AGGTGGGGGGTTGGCCTGGCAGG + Intronic
1121181125 14:91929836-91929858 AGGTCTGGGGTGGGCCCCAAGGG - Intronic
1121638691 14:95471144-95471166 AGGTGTGGAGGAGGCTTCTCTGG - Intronic
1121642019 14:95491138-95491160 GGTTGCGGGGTAAGCCTCACGGG + Intergenic
1121720625 14:96106121-96106143 ATGTGCGGGGTAGTCCTCCCTGG + Intergenic
1122152396 14:99732072-99732094 AGGTGATGGGGAGGCCTCCCAGG - Intergenic
1122883917 14:104702188-104702210 AGGTGTGGGCCAGACCTCAAGGG - Intronic
1122917852 14:104866986-104867008 AGCTCTGGGGCCGGCCTCACAGG + Intronic
1125972988 15:43927244-43927266 AGGTGGGGTGGAGGTCTCACTGG + Intronic
1130678198 15:85973062-85973084 AGGGGTGGGGGAGGCATGACGGG + Intergenic
1132575627 16:662469-662491 GGGTGTGGCCTGGGCCTCACTGG + Intronic
1133017132 16:2949226-2949248 AGGTGCTGGGTAGGCCTTCCTGG + Exonic
1134249352 16:12563547-12563569 AGGGGTGGGGTAGACCCCTCAGG - Intronic
1136777152 16:32878028-32878050 AGGGGTAAGGTAGGGCTCACAGG + Intergenic
1136893469 16:33983485-33983507 AGGGGTAAGGTAGGGCTCACAGG - Intergenic
1137026919 16:35486163-35486185 AGGGGTGGGGTCGAGCTCACAGG - Intergenic
1140335262 16:74098854-74098876 AGGTGTGGGGCAGGACCCTCTGG - Intergenic
1140654544 16:77126032-77126054 AGGTGTGGGGCAGGGCTCCTAGG - Intergenic
1141289555 16:82705065-82705087 AGGTATATGGTAGGCCTCACTGG - Intronic
1141576053 16:84964110-84964132 AGGGGTGGGGTCAGCCTCAGGGG + Intergenic
1141586167 16:85034993-85035015 AGGTGTGGGGTGGGGCTTAGGGG - Intronic
1142156973 16:88537097-88537119 AGGTTTGGGGTGGGGCTCAAAGG - Intergenic
1142192322 16:88723593-88723615 AGGTGTTGGGCCGGTCTCACAGG + Intronic
1142252786 16:89000381-89000403 ACGTGTGGTGCAGGCCCCACGGG + Intergenic
1203079567 16_KI270728v1_random:1140137-1140159 AGGGGTAAGGTAGGGCTCACAGG + Intergenic
1142782286 17:2190544-2190566 AGGTGGGGGCTAGGGCTCAGAGG + Intronic
1142902044 17:3018235-3018257 AGGTCTGGGGGGGGCCTCCCTGG - Intronic
1144661219 17:17072227-17072249 AGGCGTGGGAAAGGCCTCCCAGG - Intronic
1144804267 17:17953709-17953731 GGGTGTGTAGTGGGCCTCACTGG + Intronic
1145289020 17:21528463-21528485 GGGTGTGGGGTGGGGATCACAGG + Exonic
1145994211 17:29096308-29096330 AGGAGGGGGGTGGCCCTCACAGG - Intronic
1146299934 17:31679919-31679941 TGTTGTGGGGTCTGCCTCACAGG - Intergenic
1146931456 17:36781031-36781053 GGGTGTGAGGTAGGCATCCCAGG - Intergenic
1149684609 17:58528147-58528169 TGGTCTGGGGTAGTCCCCACTGG - Intronic
1151236450 17:72723473-72723495 GTGTTTGGGGTTGGCCTCACTGG - Intronic
1151318211 17:73336871-73336893 AGGTGTTGGGCTGGCCTTACAGG + Exonic
1151966753 17:77435507-77435529 AGGTGTAGGGCAGGCGGCACTGG - Intronic
1153053701 18:925146-925168 CGGTGTGGGTGAGGCCTCAAGGG - Intergenic
1162062176 19:8102731-8102753 GGGAGTGGGGCAGGCCTCACAGG + Exonic
1164606840 19:29605752-29605774 GTGAGTGGGGTCGGCCTCACAGG - Exonic
1165662597 19:37594720-37594742 AGGTGAGTGGGCGGCCTCACCGG - Exonic
1167472569 19:49683873-49683895 AGGTGAGGGGCAGGCCTCCCGGG + Intronic
930005464 2:46892742-46892764 TGGTGTAGGGTTGGCCTCAGTGG - Intergenic
930185421 2:48407956-48407978 AGGGGAGGGGTAGGCCAAACTGG + Intergenic
931423423 2:62149263-62149285 AGATGAGGGATAAGCCTCACAGG - Intergenic
932725744 2:74178597-74178619 GGTTGTGGGGGAGGCCTCCCCGG - Intronic
935754531 2:106266593-106266615 TGGTGTGAGATCGGCCTCACAGG + Intergenic
937895859 2:126976494-126976516 AGGTGTGGGCTTGGCCCCCCGGG - Intergenic
946611684 2:221465482-221465504 AGGTGTTGGGTTGGCCTCTTTGG + Intronic
947202073 2:227622690-227622712 ATGGGTGGGCTAGGACTCACAGG + Intronic
1168938660 20:1690398-1690420 TGGTGTGGGCTTGGCCTCAGGGG + Intergenic
1172700420 20:36850199-36850221 AGGTGTGGAGTAGGAGTCCCAGG - Intronic
1173235277 20:41239583-41239605 AGGTGTGGGGTTTACCTGACTGG + Intronic
1174767596 20:53268582-53268604 AGTCTTGGGGTAGGCCTCAAAGG + Intronic
1175571119 20:60023199-60023221 AGGAGTGGAGTAGGGCTCCCTGG - Intronic
1175717768 20:61266769-61266791 AGGTCTGGGATAGGACCCACGGG - Intronic
1179003741 21:37489792-37489814 AGTTGTGAGGTAGGGCTCTCGGG + Intronic
1179874538 21:44261475-44261497 AGGTGGGGGGCACGCCTCAGGGG - Intronic
1180149366 21:45939872-45939894 AGGTGTGGGCGGGGCCTCTCCGG + Intronic
1181667224 22:24406595-24406617 GGGGGTGGAGAAGGCCTCACTGG + Intronic
1183522909 22:38306276-38306298 AGGGGTGGGGGACGCTTCACTGG + Intronic
1183714101 22:39523656-39523678 GGGTGTGGCGTCTGCCTCACGGG - Intergenic
1183950385 22:41349340-41349362 AGGTGAGGGGTAGGCGGCGCAGG + Intronic
1184269639 22:43371851-43371873 AAGTCTGGGGTATGCCTTACAGG - Intergenic
1184332529 22:43835195-43835217 TGGTGTGGGGTGGGGCACACAGG + Intronic
1184984340 22:48119224-48119246 AGGTATGGGGTAGGTCTTCCTGG + Intergenic
1185343657 22:50302240-50302262 GGGTGTGGGCTGGGCCCCACAGG + Intronic
950399675 3:12760345-12760367 AGGTGTGGGGAAGATCTCGCAGG - Intronic
954427198 3:50449695-50449717 TGGTGTGGCGGAGGCATCACAGG - Intronic
961062598 3:123844177-123844199 TGGTTTGGGGGAGGCCTCCCAGG + Intronic
961345760 3:126262307-126262329 AGGTCTGCGGTGGGTCTCACTGG - Intergenic
961569040 3:127785176-127785198 AGGAGGGGGGAAGGTCTCACAGG - Intronic
961933105 3:130554627-130554649 AGGTGTGGTGGAGGGATCACAGG + Intergenic
963988416 3:151625049-151625071 GGTTGTGGGGAAGGCCTCATTGG + Intergenic
964726571 3:159819893-159819915 AGGTGAGGCGTAGCCCTCAGAGG + Intronic
968742404 4:2337937-2337959 AGGCCTGGGGTAGGCCTGGCTGG - Intronic
969724436 4:8910983-8911005 AGGTCTGACGTAGGCATCACTGG - Intergenic
981023391 4:140051937-140051959 AGGTCTGAGATAGTCCTCACAGG - Intronic
982036650 4:151352694-151352716 AGTTGTGGAGACGGCCTCACAGG + Intergenic
982105509 4:152008564-152008586 AGGTGCTGGGCAGGGCTCACAGG - Intergenic
991503696 5:67302980-67303002 AGGGGTAGGGAAGGCATCACTGG + Intergenic
996127624 5:119744883-119744905 AGGTGCTGGCTAGGCCTCAGAGG + Intergenic
999411324 5:151352426-151352448 AGATGTGGAGTAAGCCTCAGAGG + Intergenic
1001380140 5:171300564-171300586 AGCAGTGGGGCAGGCCTGACCGG - Intergenic
1002649250 5:180679697-180679719 AGGTGGGGGGAAAGCCTCTCAGG + Intergenic
1005638037 6:27769722-27769744 AAGCTTGGGGTTGGCCTCACAGG - Intergenic
1005956251 6:30665413-30665435 AGTTGTGGGGAAGGCTTCAGGGG - Intronic
1006538361 6:34719304-34719326 ATGTGTGGGTTATGACTCACTGG - Intergenic
1007371339 6:41428394-41428416 AGCTGAGGGCTAGGCCTCCCGGG - Intergenic
1008624142 6:53301195-53301217 AGGTCTGTGGTTGGCCTCACTGG + Intronic
1014533219 6:122585380-122585402 AGGTGAAGGGTAGTCCTAACAGG - Intronic
1016300859 6:142629688-142629710 AGGTTTGGGGTACCTCTCACAGG - Intergenic
1019349997 7:550127-550149 AGGGGTGGGGTGGGCCCCCCAGG + Exonic
1019586630 7:1808389-1808411 AGCTGTGGGGTGGCCCTCATGGG + Intergenic
1030294981 7:107915075-107915097 ACGTTTGGGGAAAGCCTCACTGG - Intronic
1033545193 7:142393221-142393243 AGGTGTGGTGGAGGCCACCCGGG - Intergenic
1033716986 7:144012366-144012388 AGGTGGAGGGAAGACCTCACAGG - Intergenic
1034014945 7:147572334-147572356 TCCTGTGGTGTAGGCCTCACTGG - Intronic
1035217284 7:157377611-157377633 TGGTGTGGGGTGGGGATCACAGG + Intronic
1041738160 8:61132934-61132956 TTTTGTGGGGTGGGCCTCACAGG + Intronic
1047057911 8:121188120-121188142 AAGTGTGGTGTAAGCATCACTGG + Intergenic
1047224326 8:122943791-122943813 AGGTGTGGGGTGGGGCTGGCGGG - Intronic
1054904559 9:70403309-70403331 AGGTGTGGGGTCACCCTCCCTGG - Intronic
1056058300 9:82852634-82852656 AGGTATAGGGTAGACCTTACAGG - Intergenic
1059647212 9:116279443-116279465 CTCTGTGGGGTAGGCCTCCCGGG - Intronic
1060667800 9:125443366-125443388 AGGGGTGGGGGAGCCCTCTCTGG + Intronic
1061101019 9:128492528-128492550 AAGAGTCAGGTAGGCCTCACTGG + Exonic
1186944054 X:14545376-14545398 AGGAGTGGGTTAGTTCTCACTGG - Intronic
1189668730 X:43385036-43385058 AGGTGTGGGAAATGCCTCTCTGG - Intergenic
1200102712 X:153696020-153696042 AGGGGTAAGGTAGGGCTCACAGG - Exonic
1202249137 Y:22851909-22851931 TGGTATGGAGTAGGCCACACAGG - Intergenic
1202402123 Y:24485657-24485679 TGGTATGGAGTAGGCCACACAGG - Intergenic
1202468657 Y:25184426-25184448 TGGTATGGAGTAGGCCACACAGG + Intergenic