ID: 1103478180

View in Genome Browser
Species Human (GRCh38)
Location 12:121233552-121233574
Sequence GGAGAGCCCAGGTGTGGGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 586}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103478180_1103478191 8 Left 1103478180 12:121233552-121233574 CCTACCCCACACCTGGGCTCTCC 0: 1
1: 0
2: 4
3: 61
4: 586
Right 1103478191 12:121233583-121233605 ATCAAAGAACAGAGAGGAGGAGG 0: 1
1: 0
2: 2
3: 56
4: 669
1103478180_1103478194 20 Left 1103478180 12:121233552-121233574 CCTACCCCACACCTGGGCTCTCC 0: 1
1: 0
2: 4
3: 61
4: 586
Right 1103478194 12:121233595-121233617 AGAGGAGGAGGAGGGAGAAATGG 0: 1
1: 12
2: 219
3: 1639
4: 8255
1103478180_1103478192 11 Left 1103478180 12:121233552-121233574 CCTACCCCACACCTGGGCTCTCC 0: 1
1: 0
2: 4
3: 61
4: 586
Right 1103478192 12:121233586-121233608 AAAGAACAGAGAGGAGGAGGAGG 0: 1
1: 0
2: 45
3: 498
4: 3211
1103478180_1103478186 2 Left 1103478180 12:121233552-121233574 CCTACCCCACACCTGGGCTCTCC 0: 1
1: 0
2: 4
3: 61
4: 586
Right 1103478186 12:121233577-121233599 AGCCCCATCAAAGAACAGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 166
1103478180_1103478189 5 Left 1103478180 12:121233552-121233574 CCTACCCCACACCTGGGCTCTCC 0: 1
1: 0
2: 4
3: 61
4: 586
Right 1103478189 12:121233580-121233602 CCCATCAAAGAACAGAGAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 275
1103478180_1103478193 12 Left 1103478180 12:121233552-121233574 CCTACCCCACACCTGGGCTCTCC 0: 1
1: 0
2: 4
3: 61
4: 586
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103478180 Original CRISPR GGAGAGCCCAGGTGTGGGGT AGG (reversed) Exonic
900154124 1:1197331-1197353 GGTGAGCTGAGGTGTGGGGAAGG - Intronic
900244940 1:1632387-1632409 GGGGAGGCCAGGTGCCGGGTTGG + Intronic
900342539 1:2195628-2195650 GGAGGGGCCAGGTGAGGGGTAGG - Intronic
900393109 1:2442430-2442452 GAGGAGGCCAGGGGTGGGGTAGG - Intronic
900742169 1:4337301-4337323 GGAGAGAGCAGATGTGGGGCTGG + Intergenic
900777292 1:4594615-4594637 GCAGAACCCAGGCGTGGGGGCGG - Intergenic
900780140 1:4612568-4612590 GCAGAGTCCAGGGATGGGGTTGG + Intergenic
900968709 1:5977277-5977299 GGAGAGCCCAGGTTTGCTGACGG - Intronic
901003007 1:6158135-6158157 GGAGAGGCCAGGGGTGAGGTTGG - Intronic
901719457 1:11184864-11184886 GGGGAGCCCAGGTGAGGAGCGGG - Intronic
901804295 1:11728267-11728289 AGAGAGCCTAGGTGTGTGGGAGG + Intergenic
901897862 1:12330006-12330028 GGAAAGGGCAGGGGTGGGGTGGG + Intronic
902005028 1:13225476-13225498 TGAAAGCCCAGGTCAGGGGTGGG - Intergenic
902024254 1:13371270-13371292 TGAAAGCCCAGGTCAGGGGTGGG - Intronic
902195682 1:14796275-14796297 GGAAAGCCCGGGTGTGGGTGGGG - Intronic
902243406 1:15103293-15103315 GCAGAGGCCACGTGTGGAGTGGG - Intronic
902250441 1:15151630-15151652 GGAGAGGCCTGGGGTGGGGGCGG - Intergenic
902359982 1:15937148-15937170 GGAGGGCCCTGGTGTAGGGAAGG - Exonic
902561886 1:17282784-17282806 GTAGAGTAGAGGTGTGGGGTGGG + Intronic
902702037 1:18179101-18179123 AGAGAAGCCAGCTGTGGGGTGGG + Intronic
902771304 1:18646959-18646981 TGGGAGCCCGGGGGTGGGGTGGG + Intronic
902876753 1:19344954-19344976 TGGGAGCCCAGGTCTGGGGGTGG + Intronic
903165576 1:21518093-21518115 GCCCACCCCAGGTGTGGGGTAGG + Intronic
903165748 1:21519262-21519284 GCCCACCCCAGGTGTGGGGTAGG - Intronic
903813324 1:26046615-26046637 GGAGGGTCCTGGGGTGGGGTGGG + Intergenic
903996334 1:27307429-27307451 GGAGAGGCCTGGTGAGTGGTGGG - Exonic
904127327 1:28250477-28250499 GTAGAGACGAGGTGGGGGGTGGG - Intergenic
904366091 1:30011799-30011821 GGAGCCCCCAGATGTGGGGGAGG + Intergenic
904471567 1:30739754-30739776 GCAGAGCCCAGGTCTGGCATGGG - Intronic
905183601 1:36180705-36180727 GGGGATCCCAGGTCTGGGGATGG + Exonic
905297450 1:36963115-36963137 AGGGAGCCCAGGGGAGGGGTCGG + Intronic
905444394 1:38016193-38016215 GCAGAGCCCAGTTGTGGGGAGGG + Intronic
905463087 1:38134040-38134062 GGAGGGCCCAGGGCCGGGGTGGG + Intergenic
906040701 1:42785844-42785866 GGAGAGACTAAGTCTGGGGTGGG - Intronic
906187062 1:43870416-43870438 GGGAAGCCCAGGTCTGGGGAGGG + Intronic
906237347 1:44219968-44219990 GCAGAGCCCAGGTGTGGTAGAGG - Intronic
906272984 1:44496137-44496159 GGATAGCCCAGGTGATGGGGTGG + Intronic
906295211 1:44645348-44645370 GGGCAGCACAGGTGAGGGGTTGG - Intronic
906674983 1:47687159-47687181 GGGCAGCGCAGGTGTGGGGAAGG - Intergenic
907411937 1:54289374-54289396 GGAGAAACAAGGTGGGGGGTGGG + Intronic
909048979 1:70745647-70745669 GCAGAGACCAGGTGTGTTGTAGG + Intergenic
909759669 1:79271654-79271676 GGAGTGCCCAGGGGTAGGGACGG + Intergenic
911552348 1:99298462-99298484 GGGGAGCCCACGTGTGTGTTTGG - Intronic
912628142 1:111223083-111223105 CGGGAGTCCAGGTTTGGGGTGGG + Intronic
914001728 1:143699998-143700020 GGAGAGACCAGGGGTGGGGAAGG - Intergenic
914305097 1:146409511-146409533 GGAGAGACCAGGGATGGGGATGG + Intergenic
914513622 1:148354924-148354946 GGCGTGCGGAGGTGTGGGGTGGG + Intergenic
915577078 1:156786583-156786605 GGTGAGCCCAGGTGTGGGATAGG - Intronic
917869467 1:179229185-179229207 GGGGAGGCCGGGGGTGGGGTCGG - Intronic
918323302 1:183384949-183384971 TGGGAGTCCAGGGGTGGGGTGGG + Intronic
919744289 1:200999279-200999301 CCAGTGCCCAAGTGTGGGGTCGG - Intronic
919912639 1:202121319-202121341 GCAGAGCCCAAGCATGGGGTGGG - Intergenic
920382942 1:205546251-205546273 GGGGAGCCAAGGGCTGGGGTGGG + Intergenic
920788710 1:209067638-209067660 GGAGAAGCAAGGTGAGGGGTTGG + Intergenic
921131685 1:212225123-212225145 AGGGAGACCAGTTGTGGGGTGGG + Intergenic
922030029 1:221789015-221789037 GGAGAGGGCAGTTGTGGGGTTGG - Intergenic
922891413 1:229064772-229064794 AGAGAGCCCAGGAGTGAGGAGGG + Intergenic
924439904 1:244077512-244077534 GGAGAGCCCAGGTCCGGTGCGGG + Intergenic
1062858870 10:794474-794496 GGTGGGCCCAGGTGTGGAGCTGG - Intergenic
1062874591 10:932860-932882 CTTGATCCCAGGTGTGGGGTTGG - Intergenic
1062996451 10:1871069-1871091 GGGGAGCCCAGGACAGGGGTTGG - Intergenic
1063124051 10:3124537-3124559 GGAGAGCAGAGATGTGGCGTGGG + Intronic
1063353920 10:5380769-5380791 TGAGAGGCCAGGTGTGGGAGAGG - Intergenic
1064597705 10:16962355-16962377 AGAGAACCAAGGGGTGGGGTGGG + Intronic
1065790629 10:29257187-29257209 GGAGAGTGCAGCTGTGGAGTAGG - Intergenic
1067201107 10:44172825-44172847 GGAGAGCCCTGGACTCGGGTGGG - Intergenic
1067537414 10:47124037-47124059 GGTGAGCCCTGGTTTGGTGTGGG + Intergenic
1067712030 10:48657127-48657149 GGAGACCCCGGGTGTGGGGCAGG + Intergenic
1067781278 10:49209216-49209238 ACAGGGCCCAGGAGTGGGGTTGG - Intergenic
1067828857 10:49598450-49598472 TGGGAGACCAGGTGTGGGGAGGG - Intergenic
1067849841 10:49747450-49747472 GGAGAGCACAAGAGTGGGGAAGG + Intronic
1068860334 10:61841386-61841408 GGAAACCCCAGGTGGGGAGTAGG + Intergenic
1069333544 10:67321826-67321848 GCAGATCCAAGGTGTGTGGTAGG - Intronic
1069787972 10:71001520-71001542 AGAGAGCTCAGGTGTGGCTTGGG - Intergenic
1069857442 10:71449128-71449150 GGAGAGCCCATGTGTGGCCCAGG + Intronic
1070664016 10:78331080-78331102 GCAGAGCCCAGGGGTTGGGTAGG + Intergenic
1071721471 10:88150881-88150903 ATAGAGCCCAGGTGTGTAGTAGG + Intergenic
1075092697 10:119452490-119452512 GGTGAGTCCAGGGGAGGGGTCGG - Intronic
1075393822 10:122112954-122112976 GGAGAGCCCAGAGCTGGGGGAGG + Intronic
1075495526 10:122915758-122915780 GGAGAGCCCAGGGTGGGGGTGGG + Intergenic
1075969527 10:126640617-126640639 GGAGAGACCTGGGGTGGGGTGGG + Intronic
1076227608 10:128792855-128792877 GGAGGGCCCAGGTTCGGGGAAGG + Intergenic
1076381475 10:130027189-130027211 GGAGAGCCCTGAAGTGGGGCAGG - Intergenic
1076480004 10:130778754-130778776 TGAAAGCCCAGCTGTGTGGTTGG + Intergenic
1076682948 10:132184341-132184363 AGAGTGCCCAAGTGTGGGTTTGG + Exonic
1076805856 10:132858444-132858466 GGCGACCCCAGGTTTGGGGCAGG + Intronic
1076813259 10:132899899-132899921 GGAGTGCCCACGTGTGGCCTGGG + Intronic
1077034064 11:486407-486429 GGGGAGCGCAGGTGTGGAGATGG + Intronic
1077076512 11:704834-704856 GGAGAGGACAGCTGGGGGGTGGG - Intronic
1077081256 11:725685-725707 GCAGAGCCTGGGTGTGGGGAGGG + Intronic
1077090661 11:777003-777025 GGGGAGCCCGGGTGTGGGGAGGG - Intronic
1077248062 11:1548667-1548689 GGAGGCCCCAGGTGTGTGGGGGG + Intergenic
1077327927 11:1971678-1971700 GGGGATCCCAGGTGAGGGGAAGG - Intronic
1077352198 11:2098217-2098239 AGAGGGCCCATGTGTGAGGTCGG - Intergenic
1077413533 11:2414280-2414302 GCAGAGCCCAGGTCTGGGCAGGG - Intronic
1077529256 11:3087573-3087595 CGAGCGTCCAGGTGTGGGGGTGG + Exonic
1078066922 11:8084749-8084771 TTAGAACCCAGGTGTGGGGCTGG - Intronic
1078217147 11:9321048-9321070 CGAGAGGCCAGGTGTGGTATTGG - Intergenic
1078929191 11:15900437-15900459 GGACAGCCTAGGTGTGTAGTAGG + Intergenic
1079027358 11:16960025-16960047 GGAGGGCACAGGAGTGAGGTTGG - Intronic
1081604282 11:44517727-44517749 GGTGAGCCCTGGGCTGGGGTCGG + Intergenic
1081914325 11:46720892-46720914 GAAGAGCTCAGGGGTGGGTTTGG + Intronic
1083260297 11:61518864-61518886 GGAGAGCGCCTCTGTGGGGTAGG - Intronic
1084492315 11:69485587-69485609 GGGGAGCACAGGTGGGGGATGGG + Intergenic
1084598043 11:70128869-70128891 GGAGAGCCTAGGAGAGCGGTAGG + Intronic
1085098414 11:73779593-73779615 GGAGAGGCAAGGGGCGGGGTTGG + Intergenic
1085263867 11:75224855-75224877 GGGAAGACCAGGTGTGAGGTGGG - Intergenic
1086375740 11:86199098-86199120 GGAGAGACCATGTGTGTGTTGGG + Intergenic
1086642294 11:89174768-89174790 GGTGAGAACAGATGTGGGGTGGG - Intergenic
1087137090 11:94731977-94731999 GGAGAGCCCTGCTGTGAGCTTGG - Intronic
1089442405 11:118528560-118528582 GGAGAAGCCAGGTGTGCAGTTGG - Intronic
1089645471 11:119876003-119876025 GGGGAGCCTGGGTGAGGGGTGGG - Intergenic
1089788088 11:120922419-120922441 GCAGGGCCTAGCTGTGGGGTAGG - Intronic
1090074405 11:123570955-123570977 GCAGTGTCCAGGTGTGGGGAGGG + Intronic
1090665288 11:128911174-128911196 GGAGAGCCCCGGGGTGGGGGTGG + Intronic
1091007943 11:131970655-131970677 GGAGAGCCCAGGTATAAGATTGG - Intronic
1202810907 11_KI270721v1_random:26858-26880 GGGGATCCCAGGTGAGGGGAAGG - Intergenic
1091641618 12:2241449-2241471 GGAGAGCACGCGTGTGGGATGGG + Intronic
1091812613 12:3412112-3412134 GGATAGCCTAGGTGTGCAGTCGG - Intronic
1091973042 12:4804211-4804233 GGAAAGCTCAAGAGTGGGGTGGG + Intronic
1092119415 12:6033678-6033700 GGCCAGCCCGGGTGTGAGGTGGG + Intronic
1092917808 12:13203913-13203935 GAGGAGCCAAGGTGTGGGTTGGG - Intronic
1094092260 12:26663224-26663246 GGAGAGCCCAGTGGTGGCTTTGG - Intronic
1096154611 12:49335030-49335052 AGAGGCCGCAGGTGTGGGGTAGG - Intronic
1096532578 12:52250933-52250955 ACAGAGCCCAGGTGTGTAGTAGG - Intronic
1096539317 12:52296060-52296082 GTAGAGACCAGGTGTCGGATTGG + Intronic
1097029894 12:56082642-56082664 GGAAAGACCATGTGTGGGGTGGG - Intronic
1097194218 12:57234993-57235015 GGGAGGCCCAGGTGTGGGGCTGG + Exonic
1097949953 12:65416516-65416538 ACAGAGCCCAGGTGTGTAGTAGG - Intronic
1098222032 12:68280442-68280464 TGAGAGCACTGGTGTGTGGTTGG + Intronic
1100967133 12:100025114-100025136 ATATAGCCCAGGTGTGTGGTAGG - Intergenic
1101671872 12:106883200-106883222 GGTAAACTCAGGTGTGGGGTGGG - Intronic
1101732636 12:107439471-107439493 GCCGAGCCCATCTGTGGGGTGGG + Intronic
1102261792 12:111447534-111447556 GGATAGCCAAGGTATGGGGTGGG + Exonic
1102463563 12:113115010-113115032 AGAGAGGCCAGGGCTGGGGTAGG + Intronic
1102993117 12:117328889-117328911 GTATAGCCTAGGTGTGGAGTAGG - Intronic
1103021521 12:117538445-117538467 GTGCCGCCCAGGTGTGGGGTGGG + Intronic
1103360467 12:120350581-120350603 GGAGAGTCTGGGGGTGGGGTGGG + Intronic
1103409571 12:120701246-120701268 GGAGAGCCGAGTTGCGAGGTAGG + Exonic
1103478180 12:121233552-121233574 GGAGAGCCCAGGTGTGGGGTAGG - Exonic
1103576679 12:121882661-121882683 AAACAGCCCAGCTGTGGGGTGGG + Intergenic
1103971237 12:124674148-124674170 GTTGAGCCCAGGGCTGGGGTTGG - Intergenic
1104580817 12:130009515-130009537 GGAGACCACAGGTGTGCGGTGGG - Intergenic
1104775078 12:131386064-131386086 GGAGAGCCCGGGGGTGGCGCAGG + Intergenic
1105330521 13:19411494-19411516 GTACAGCCTAGGTGTGGAGTAGG + Intergenic
1105354347 13:19645165-19645187 TGAGAGAGCAGCTGTGGGGTGGG - Intronic
1105918595 13:24940264-24940286 GTACAGCCTAGGTGTGGAGTAGG + Intergenic
1106024921 13:25947428-25947450 GGTGAGGCCCGCTGTGGGGTGGG + Intronic
1106507821 13:30386913-30386935 GGAGAGCCCAGGTGGAGTGTGGG - Intergenic
1107275711 13:38676856-38676878 ATATAGCCCAGGTGTGGAGTAGG - Intergenic
1107482079 13:40793495-40793517 GAATAGCCTAGGTGTGGAGTAGG + Intronic
1107851802 13:44577976-44577998 GGCGAGCCCAGGTGCGGCGAGGG - Intergenic
1108555867 13:51591843-51591865 GGCCAGGCCAGGGGTGGGGTAGG - Intronic
1108662132 13:52596933-52596955 GTACAGCCTAGGTGTGGAGTAGG - Intergenic
1109299339 13:60574766-60574788 CCAGAGCCTAGGGGTGGGGTTGG + Intergenic
1112533502 13:100227270-100227292 TAAGAGCTCAGGTGTGGGCTGGG - Intronic
1113055325 13:106260828-106260850 GAAGAGGCCTGGGGTGGGGTGGG - Intergenic
1113741900 13:112716785-112716807 GCAGGGCCCAGGTGGGGTGTGGG + Intronic
1113775591 13:112943345-112943367 GCAGAGCCCAGGCGCGGGGAGGG + Intronic
1113836246 13:113330345-113330367 TGGGAGCCCAGGTGTGTGGAAGG + Intronic
1113836357 13:113330824-113330846 TGGGAGCCCAGGTGTGTGGAAGG + Intronic
1113941029 13:114018683-114018705 GGTGGGCCCGGGTGTAGGGTGGG + Intronic
1114261540 14:21040335-21040357 GGACAGCACAGCTGTGGGTTGGG - Intronic
1115286215 14:31715461-31715483 ATAGAGCCTAGGTGTGTGGTAGG - Intronic
1116034607 14:39612719-39612741 GAAGAGGCCAGGTTTGGGGAAGG + Intergenic
1117471713 14:56052701-56052723 GATGAGCCCAGGGGTGGGGCCGG + Intergenic
1118348290 14:64955605-64955627 TGAGAGCACAGGGGTGGGGAGGG - Intronic
1118440530 14:65807639-65807661 GGAGAGAACTTGTGTGGGGTAGG + Intergenic
1118443902 14:65835084-65835106 GGAGAGCCCACTTGTGGCGGTGG + Intergenic
1119084935 14:71730955-71730977 GTAGAGCCCTGGAATGGGGTGGG - Intronic
1119421626 14:74510837-74510859 GGAGCGCCCCGCTGTGCGGTGGG + Intronic
1121522660 14:94597153-94597175 GGAGGGCACACGAGTGGGGTTGG + Intronic
1121743010 14:96267196-96267218 GGAGAGGTCAGGTGGTGGGTGGG + Intronic
1122302778 14:100740578-100740600 AAAGAGCCCAGGGGTGGGGATGG + Intergenic
1122470399 14:101962271-101962293 GGAGAGGCCAGGTTTGGGTGAGG + Intergenic
1122815021 14:104307966-104307988 CGGGAGCGCAGGTGTGGGGCCGG + Intergenic
1122889879 14:104727328-104727350 AGACAGCCGAGGTGTGAGGTGGG - Intronic
1123758583 15:23415816-23415838 GGAGAGCCCCTGTGTGTGGGGGG - Intergenic
1123973372 15:25529587-25529609 GGCAAGGCCAGGTGTGGGGTTGG + Intergenic
1124109182 15:26772013-26772035 GGAGAGGCGAGATGTGGGGGTGG - Intronic
1125543805 15:40488240-40488262 GCAGAGCCCAGTGGTGGGGAGGG - Intergenic
1125887655 15:43240694-43240716 GGACAGCCTTGGTGGGGGGTGGG + Intronic
1126334776 15:47575360-47575382 GTAAAGCCCAGATATGGGGTAGG + Intronic
1126348950 15:47724628-47724650 CAAAAGCCCAGGGGTGGGGTGGG + Intronic
1126689219 15:51274963-51274985 GGAGAGCCCAGGTGTGGCTGGGG - Intronic
1126709864 15:51443629-51443651 GGACAGCCCAGCCCTGGGGTAGG + Intergenic
1127460721 15:59196400-59196422 GGTGTGCTCAGCTGTGGGGTGGG - Intronic
1127531804 15:59850734-59850756 GAAGAGCCCAGTTGGGGGCTGGG - Intergenic
1128778836 15:70344673-70344695 GCAGAGCCAAGGTGGGGGCTGGG - Intergenic
1128780833 15:70357610-70357632 TGTGAGCACAGGTCTGGGGTGGG - Intergenic
1129592628 15:76931406-76931428 GGAGTGGGCAGGAGTGGGGTGGG + Intergenic
1130021908 15:80238880-80238902 GTATAGCCTAGGTGTGTGGTAGG + Intergenic
1130122269 15:81061084-81061106 GGAGAGCAGAGGAGTGGGTTGGG + Intronic
1130556258 15:84924466-84924488 GGACAGCCCAGGTGTGAGACTGG - Intronic
1131000128 15:88933323-88933345 GGAGAGGCTGGGTGTTGGGTAGG - Intergenic
1131455393 15:92579272-92579294 GGGGAATCCAGGGGTGGGGTGGG - Intergenic
1132056225 15:98651333-98651355 GGAGAGCCCAGATCTGTGGAAGG - Intronic
1132331267 15:101013858-101013880 GGCCAGCCCAGGTCTGGGGACGG - Intronic
1132617341 16:848140-848162 GGTGGGCCCGGGTGTGGGCTGGG + Intergenic
1132695236 16:1199073-1199095 GCAGAGCCATGGTGGGGGGTGGG - Intronic
1133143863 16:3769169-3769191 GGGGAGCCCAGGTCTGAGGTGGG - Exonic
1133155733 16:3874278-3874300 GGAGAGCCCAGGTGAGCAGCAGG - Intronic
1133268550 16:4599442-4599464 GGAGAGCCCAGGCGGGGTGTGGG - Intronic
1133794658 16:9036002-9036024 AGAGAGCCCAGGTTTGGATTTGG - Intergenic
1134435226 16:14250675-14250697 GGAGAGCCAAGGAGTGTGGTAGG + Intronic
1134598265 16:15512988-15513010 GTAGAACTGAGGTGTGGGGTGGG + Intronic
1134903864 16:17962612-17962634 GGAGAGACAAGGTGAGGGTTGGG - Intergenic
1135154249 16:20038664-20038686 GGAGATCCCTGGGGTGGGGTGGG + Intronic
1135587820 16:23684173-23684195 TGAGAGCTCAGGTGTGGAGTAGG + Intronic
1136716638 16:32287818-32287840 TGAGAGCTCACGTGTGAGGTGGG - Intergenic
1136835018 16:33494063-33494085 TGAGAGCTCACGTGTGAGGTGGG - Intergenic
1137675181 16:50300639-50300661 GAAGCTCCCAGGTGTGGGGTGGG - Intronic
1137697249 16:50469505-50469527 GGAGATCCCAGGTTTGAGGAAGG - Intergenic
1137795783 16:51217789-51217811 TGAGAGCCAAGGTGTAGGGTGGG - Intergenic
1137851526 16:51750738-51750760 GGAGAGGGTGGGTGTGGGGTTGG - Intergenic
1138206772 16:55131059-55131081 GCACAGCCCAGGGGTGGGGCAGG + Intergenic
1138366529 16:56483091-56483113 GTATAGCCTAGGTGTGGAGTAGG - Intronic
1138495190 16:57404493-57404515 GGAGAGAGCAGGTGTAGGGGTGG + Intergenic
1138531371 16:57636095-57636117 GGGGAGCCCAGGTGGGAGCTTGG + Intronic
1138552070 16:57753625-57753647 ACGGAGCCCAGGTGTGGGTTAGG - Intronic
1138615489 16:58162094-58162116 GGAGGGCTGAGGAGTGGGGTGGG + Intronic
1138863518 16:60789150-60789172 TCAGAGCCCAGGTGTTGGCTTGG + Intergenic
1139426094 16:66880771-66880793 GGAGAGCTGAGGTGAGGGGGCGG + Intronic
1141188504 16:81806694-81806716 TGAGGGTCCAGGTGTGGGGCTGG + Intronic
1141572502 16:84942370-84942392 GGAGGGCAGAGGGGTGGGGTGGG - Intergenic
1142212723 16:88816140-88816162 AGAGAGCACAGGTGTGGCGGTGG + Intronic
1142272513 16:89097718-89097740 GCAGAGTCCAGGTGTGTGGGCGG + Intronic
1203009785 16_KI270728v1_random:229969-229991 TGAGAGCTCACGTGTGAGGTGGG + Intergenic
1203145188 16_KI270728v1_random:1794384-1794406 TGAGAGCTCATGTGTGAGGTGGG - Intergenic
1143028465 17:3954281-3954303 GGGGAGCCCTGCTGTGCGGTGGG - Intronic
1143117426 17:4588805-4588827 ACAGAGCCCTGGTTTGGGGTGGG + Intronic
1143269286 17:5664000-5664022 GGAGAGCTCAGGCATGGGGTGGG + Intergenic
1143363945 17:6393334-6393356 CGAGAGCCCATGTGTTGGGAAGG + Intergenic
1143379797 17:6488880-6488902 GCAGTGCCCAGATTTGGGGTGGG + Intronic
1143620057 17:8075583-8075605 GGAGAGCTCAGGTATGGGCCTGG - Exonic
1144610915 17:16714409-16714431 GGAAAGACCATGTGAGGGGTAGG - Intronic
1144680729 17:17192343-17192365 GTAGAGCCCCGGGGTAGGGTGGG + Exonic
1144749355 17:17637780-17637802 GGAGAGCTCAAGTGTGGGCTGGG + Intergenic
1144762959 17:17717665-17717687 AGAGGGCCCAGGTGGGGGGCAGG - Intronic
1144901824 17:18600958-18600980 GGAAAGACCATGTGAGGGGTAGG + Intergenic
1144929243 17:18844987-18845009 GGAAAGACCATGTGAGGGGTAGG - Intronic
1145031621 17:19508530-19508552 TGAGAGCCCAGGTGAGTGGGGGG - Intronic
1145130678 17:20345112-20345134 GGAAAGACCATGTGAGGGGTAGG - Intergenic
1145416580 17:22718285-22718307 ATAGAGCCTAGGTGTGCGGTAGG + Intergenic
1145961205 17:28887451-28887473 GTAGAGCCTGGGTGTGAGGTCGG + Intronic
1146374969 17:32287775-32287797 GGACAGCTGAGGTGTGGGCTTGG + Intronic
1146944430 17:36864294-36864316 GCAGACCCCAGGTGTGTGATCGG - Intergenic
1147317494 17:39627746-39627768 AGACCGCCCAGGAGTGGGGTGGG + Intronic
1147594028 17:41705277-41705299 ATTGAGCCCAGGAGTGGGGTGGG - Intergenic
1148133037 17:45273866-45273888 GGTGACCCCTGGTATGGGGTCGG - Intronic
1148349551 17:46930128-46930150 AGGGAGCCCAGCAGTGGGGTGGG - Intronic
1148491869 17:48028521-48028543 GCAGAGTCAAGGGGTGGGGTAGG + Intronic
1148539700 17:48470572-48470594 AGAGAGGCCAGGTGTGGAGAAGG - Intergenic
1149428524 17:56578188-56578210 GGAGAGCCAGGGGGTGGGGGTGG - Intergenic
1150255478 17:63741379-63741401 GGGGAGCCCAGGACCGGGGTCGG + Intronic
1150382155 17:64729321-64729343 GGAGAGGACAGGGGTGGAGTGGG + Intergenic
1150533132 17:66006778-66006800 GCAGAGCCCAGGTGGGAGGTGGG + Intronic
1150774111 17:68065530-68065552 GGAGAGGACAGGGGTGGAGTGGG - Intergenic
1151535818 17:74738263-74738285 GGTGAGCCCTGGTGTCGGGGAGG - Intronic
1151830261 17:76545163-76545185 AGAGAGCCCAGGGGTGGGAGAGG - Intronic
1152344148 17:79741558-79741580 GGAGGGCACAGGTGCGGGGCAGG - Intronic
1152567807 17:81107965-81107987 GGAGCGCCCAGGTGTGGCGCTGG - Intronic
1152718638 17:81911673-81911695 GGAGAGGCCAGGTGTGGGTCGGG - Intergenic
1152741644 17:82020996-82021018 GGAGAGTCCAGGACTGGGGGTGG + Intronic
1154031094 18:10755229-10755251 AGAGACTCCATGTGTGGGGTCGG + Intronic
1154315444 18:13300286-13300308 GCAGAGCACAGGCGCGGGGTGGG - Intronic
1155126404 18:22880825-22880847 GGAGACCCCAGGTGTGGCGGCGG + Intronic
1155306975 18:24488130-24488152 GGAGAGGGCAGGTGTGGGGGTGG - Intergenic
1156337880 18:36186574-36186596 GTAGAGCCCAGGCATGCGGTTGG - Intergenic
1156476779 18:37410447-37410469 TGGTAGCCCAGGTGTGGAGTGGG - Intronic
1156491011 18:37496076-37496098 GGAGGGCCCAAGAGTGGGGAAGG - Intronic
1157094981 18:44679594-44679616 GGTGAGCGCTGGAGTGGGGTCGG - Intergenic
1157273652 18:46294946-46294968 GGAGACCTCAGGTTTGGGGCAGG - Intergenic
1157487042 18:48095369-48095391 GGAGAGCCCTGGAGCAGGGTTGG + Intronic
1157495841 18:48156866-48156888 GGAGAGACCAGGATTGGGGATGG + Intronic
1157812015 18:50704033-50704055 GGAAAGGGCAGGTGTGGGGAAGG - Intronic
1158213598 18:55076760-55076782 GGAGAGCCCTTGTGTGGGATTGG + Intergenic
1158698875 18:59728576-59728598 GGAGTGGTCAGGTGTGGCGTGGG - Intergenic
1158896279 18:61916602-61916624 GGTGAGGCCAGGGGTGGGGAGGG + Intergenic
1160175426 18:76590279-76590301 GGGCAGCCCAGGTGAGGGGGCGG + Intergenic
1160847249 19:1172062-1172084 GGAGGGCCCTGGTGTGGAGGGGG - Intronic
1161342707 19:3751775-3751797 GGAGAGCCCGGCTGTCGGCTTGG - Intronic
1161450809 19:4344292-4344314 GAAGAGCCCCGGTGTGAGGAAGG + Intronic
1162552449 19:11365227-11365249 AGCGAGCCCAGCTGTAGGGTGGG + Exonic
1162779573 19:12999927-12999949 GGTGTGCCCAGGTGTGGGCCGGG + Intronic
1162825220 19:13247156-13247178 GCAGAGGCCAGGTCAGGGGTTGG + Intronic
1163226130 19:15962824-15962846 TGAGAACCCTGGAGTGGGGTTGG - Intergenic
1163374641 19:16922686-16922708 AGAGACCCCAGATGTGGTGTGGG - Intronic
1163679274 19:18671379-18671401 GGGGAGCTCAGGTCGGGGGTGGG - Exonic
1163760406 19:19133234-19133256 GGGAAGCTCAGGCGTGGGGTTGG + Intronic
1164590071 19:29501895-29501917 GGAGCCCCCATGAGTGGGGTCGG + Intergenic
1164802074 19:31085350-31085372 GCACAGCCTAGGTGTGGAGTAGG - Intergenic
1165075529 19:33278151-33278173 CAAGAGCCAAGCTGTGGGGTGGG - Intergenic
1165172938 19:33906344-33906366 GGCGAGCTCAGGTGTGGCCTAGG - Intergenic
1165791030 19:38492657-38492679 GGAGAGGGCAGGGGTGGGGTGGG + Intronic
1165836374 19:38759212-38759234 ATATAGCCTAGGTGTGGGGTAGG + Intronic
1166234422 19:41445545-41445567 GGAGACCCCAGGATTAGGGTGGG + Intergenic
1166679316 19:44757503-44757525 GGAGAGCACCCGGGTGGGGTGGG + Intronic
1166694364 19:44844489-44844511 GGAAAGCCCAGGTGTGTGGCAGG + Intergenic
1166965735 19:46528535-46528557 GGAGAGGCCAGGTCAGGGCTGGG - Intronic
1167278112 19:48551108-48551130 GGAGGGCCAGGGTTTGGGGTGGG + Intergenic
1167560454 19:50223761-50223783 GGAGAGCCCAGGCATGGGAGGGG + Intronic
1167792857 19:51691794-51691816 TCAGAGCCCAGGGGTGGGGAGGG + Intergenic
1167794955 19:51703088-51703110 GGACTGCCCAGGTGAGGGGGCGG + Intergenic
1168170726 19:54586953-54586975 GCAGAGCCCAGGAGTGAGGCTGG + Intronic
1168186089 19:54700530-54700552 GCAGAGCCCAGGTGAGAGGCTGG + Intronic
1168187820 19:54710687-54710709 GGGGAGCCCAGGTGGGGAGTGGG - Intergenic
1168695171 19:58400161-58400183 GGGGAGGCCAGGGGTGGGGCTGG + Intergenic
925024873 2:599771-599793 GAGGAACCCATGTGTGGGGTAGG + Intergenic
925729987 2:6912833-6912855 GGAGAACCTAGGGGTGGAGTAGG + Intergenic
926156443 2:10456800-10456822 GAAGAGCCCAGCTTTGGGGTTGG + Intergenic
926841073 2:17080689-17080711 GTATAGCCCAGGTGTGTAGTAGG - Intergenic
927052001 2:19339081-19339103 GGAGAGCTCAAGTGAGAGGTGGG + Intergenic
927909073 2:26883915-26883937 GGAGACCTCAGGTGTGGGCTGGG - Intronic
929662603 2:43803529-43803551 GGGGAGACCAGGGGAGGGGTCGG + Intronic
929830246 2:45341371-45341393 GGAGAGCCCAAGGCTGGGGGAGG + Intergenic
930185247 2:48406902-48406924 AGAGGGCCCAGGTGTGGAGGAGG - Intergenic
931796630 2:65716805-65716827 GGAGAACCTATGTGTGGGGTTGG - Intergenic
931925752 2:67070733-67070755 GTAGAGCTCAGGTGGGGAGTTGG + Intergenic
932275221 2:70446348-70446370 GGTGAGCCCAGGGGTATGGTGGG + Intergenic
932619843 2:73258932-73258954 AGAGTGCCCTGGTGTGGGGCTGG + Exonic
933691043 2:85179729-85179751 GGAGGGCCCTGCTGTGGTGTTGG + Intronic
934778301 2:96952697-96952719 AGAGAGCCTGGGTTTGGGGTAGG + Intronic
935619881 2:105119727-105119749 GGAGAGACAAGGTATGGGGAGGG - Intergenic
936251369 2:110870681-110870703 TGAGAGTCCAGGTGTGGGGTGGG - Intronic
937003757 2:118492273-118492295 GGAGAACCTAGGGATGGGGTTGG + Intergenic
937044323 2:118843265-118843287 GGAGAGGGCCGGGGTGGGGTGGG + Intronic
937083345 2:119156004-119156026 GGAGAGGCCGGAGGTGGGGTTGG - Intergenic
937247875 2:120505184-120505206 GGAGAGCGCAGGTGTGGCTTGGG - Intergenic
937283695 2:120736846-120736868 GGAGAGCCCAGCAGAGGGGGAGG - Intronic
937883815 2:126886793-126886815 TGAGAGCGGAGGTGTGGCGTGGG - Intergenic
937895861 2:126976503-126976525 GGAGGGCAGAGGTGTGGGCTTGG - Intergenic
937983458 2:127628141-127628163 GTGCAGCCCATGTGTGGGGTTGG - Intronic
939044416 2:137233051-137233073 GGAGAAGCCACGTGTGGTGTAGG + Exonic
941037013 2:160579899-160579921 GTAGAGCCCAGGTTTGGATTTGG + Intergenic
941382018 2:164804856-164804878 AGAGAGTCCATGTGTGGTGTTGG - Intronic
941470333 2:165877548-165877570 AGATAGCCCAGGTGTGTAGTAGG + Intronic
941684751 2:168437015-168437037 TGGGAGCCCAGCTGTGGGGGAGG + Intergenic
941773178 2:169364298-169364320 GGAGAGCCGGGGTCTGGGGAGGG + Intergenic
942812613 2:180016730-180016752 GAAAAGCACAGGTGGGGGGTGGG - Intergenic
943639367 2:190342632-190342654 GGAGAACCCAGGTGCAGGCTGGG + Intronic
944780891 2:203015342-203015364 GGAGAGGCCAGGTGGGCGGGTGG + Intronic
945061706 2:205914978-205915000 GAAGAGCACAAGTGTGGGGTAGG + Intergenic
945748378 2:213747674-213747696 ATATAGCCTAGGTGTGGGGTAGG + Intronic
945957027 2:216096003-216096025 AGAGAGCCCTGGTGGGGGCTTGG - Exonic
945969378 2:216221179-216221201 GGAGAGAGCTGGGGTGGGGTGGG - Intergenic
946145303 2:217726019-217726041 GGAGCTCTCAGGTGTGGGGGAGG - Intronic
946178335 2:217935440-217935462 GGCGAGCCAGGGTGAGGGGTGGG - Intronic
946369875 2:219274310-219274332 GGAGAGGCCAGGATTGGGGGTGG + Intronic
946432029 2:219631184-219631206 GGAGAGCCGAGGGGTCTGGTAGG + Intronic
947527626 2:230888816-230888838 GTATAGCCCAGGTGTGCAGTAGG + Intergenic
947527632 2:230888860-230888882 GTATAGCCCAGGTGTGCAGTAGG + Intergenic
947539538 2:230966262-230966284 GTATAGCCCAGGTGTGCAGTAGG - Intergenic
947750439 2:232529305-232529327 GGTGAGCCCAGGGGTGTGGTTGG + Intronic
948293062 2:236841753-236841775 GGATAGTACAAGTGTGGGGTGGG - Intergenic
948570132 2:238912652-238912674 GGAGAGGCCAGGGCTGGGGGAGG - Intergenic
948880735 2:240856005-240856027 GCAGAGACCCCGTGTGGGGTTGG - Intergenic
948938416 2:241183461-241183483 TGAAAGCTCAGGTGTGGGGAGGG + Exonic
949043807 2:241861075-241861097 CCAGGGCTCAGGTGTGGGGTGGG + Intergenic
1168748981 20:268741-268763 GATGAGCACAGGTGTGGGGTTGG - Intergenic
1168781126 20:491425-491447 GGGGAGCCAAGGTGTGAGGATGG + Intronic
1168830759 20:844160-844182 GGGGAGTCCAGGTGGGGTGTGGG + Intronic
1168895058 20:1318590-1318612 AGAGGGCCCAGGTGCAGGGTAGG + Intronic
1168900563 20:1360564-1360586 GTATAGCCTAGGTGTGTGGTAGG + Intronic
1168916171 20:1490278-1490300 GCAGAACCCAGGTGTGGGGTCGG - Intronic
1169277680 20:4244552-4244574 GGAGGTACCAGGTGTGTGGTAGG - Intronic
1170789817 20:19498441-19498463 GTAGAGACAAGGTGTGGGGGTGG - Intronic
1171197969 20:23216011-23216033 GGAGAGCCCAGGAGGAGGCTGGG - Intergenic
1171972512 20:31573130-31573152 GGAGAACCCAGGTGTGGCCGCGG - Intronic
1172131965 20:32661847-32661869 GGGGAGCACAGGTGTGGAGTGGG - Intergenic
1172282261 20:33716292-33716314 GGAGGGCCCTGGGGTGAGGTAGG - Intronic
1172332709 20:34086740-34086762 GGGGAGCCCAGGTGCGGAGCTGG + Intronic
1172523200 20:35582461-35582483 GAAAAGCCTAGGTGTGGGGAGGG + Intergenic
1172672815 20:36645986-36646008 GGAGAGGCTAGGTGTTGGTTTGG + Exonic
1172786756 20:37473609-37473631 GGGGAGGGTAGGTGTGGGGTAGG - Intergenic
1172901448 20:38337911-38337933 GGGGAGCCCAAGTGTGGGGCAGG - Intergenic
1173220244 20:41126375-41126397 GGAGAGCCCATGTATTGGTTTGG - Intergenic
1173631611 20:44520591-44520613 GGAGAGTCCAAGAGTGGGGAAGG + Intronic
1173753124 20:45492183-45492205 GGAAAGTGCAGGTTTGGGGTTGG + Intergenic
1173867424 20:46321506-46321528 GGGGAGCCCAGGAGAGGGGATGG - Intergenic
1174116742 20:48231463-48231485 GGTGAGCCCAGAGTTGGGGTGGG - Intergenic
1174391883 20:50222885-50222907 GGAGAGCATGGGTGTGGGTTGGG - Intergenic
1174524939 20:51163248-51163270 GGAAGGCACAGGGGTGGGGTGGG + Intergenic
1175190098 20:57205989-57206011 TGAGAGCCCAGGCATGAGGTTGG + Intronic
1175257252 20:57654944-57654966 GGAGTGGCAGGGTGTGGGGTGGG - Intronic
1175816307 20:61884818-61884840 AGAGAGCCCTGGGGTGGGGGCGG + Intronic
1175828707 20:61950822-61950844 GGAGGGCCCAGGGCTGGGGGAGG - Intergenic
1175948066 20:62567938-62567960 GGAGCCTCCAGGTTTGGGGTGGG + Intronic
1175967611 20:62667358-62667380 GGAGAACCGAGGACTGGGGTGGG + Intronic
1176088686 20:63309487-63309509 GCAGGGCCCAGGTGAGGGGCAGG + Exonic
1176306425 21:5125867-5125889 GGCGAGAGCAGGTGTGGGGGTGG - Exonic
1178343784 21:31807883-31807905 GGAGAGGCCGGGAGAGGGGTTGG + Intergenic
1178613824 21:34112570-34112592 GGAGAGAATAGGTGTGGGGAGGG - Intronic
1179410529 21:41159564-41159586 GCAGAGGCCAGAAGTGGGGTTGG - Intergenic
1179430414 21:41317253-41317275 GGAGAGCCCGGGTGGGGGGTGGG - Intronic
1179850634 21:44136163-44136185 GGCGAGAGCAGGTGTGGGGGTGG + Exonic
1180564366 22:16650347-16650369 GTACAGCCTAGGTGTGGAGTAGG - Intergenic
1180625402 22:17190677-17190699 GGAGAGGCCATGGGTGGGGCAGG - Intronic
1180905036 22:19404372-19404394 AGGGTGCCCAAGTGTGGGGTAGG - Intronic
1181027436 22:20134101-20134123 GCATAGGCCAGGTGTAGGGTTGG - Intronic
1181403880 22:22668273-22668295 GGGGAGCCCAGCTGTGCTGTAGG + Intergenic
1181422529 22:22811729-22811751 GGGGAGCCCAGCTGTGCTGTGGG + Intronic
1181426978 22:22850117-22850139 GGTGAGCCCAGCTGTGCTGTGGG + Intronic
1181528703 22:23503901-23503923 GGAGAGTCCAGGTGTGCTGCGGG - Intergenic
1182354902 22:29718531-29718553 GGAGAGCTTTGGAGTGGGGTGGG + Intergenic
1182572256 22:31248274-31248296 GCAGAACCGAGGTGTGTGGTTGG - Intronic
1182587973 22:31356852-31356874 GGAGAGGGCAGGTGTGGTGGTGG - Intergenic
1183310223 22:37105583-37105605 GAAGATCCCAGGTGATGGGTTGG + Intronic
1183346720 22:37312179-37312201 GGGGTGCCCAGGTCTGGGGACGG + Intronic
1183361289 22:37384636-37384658 GGAGAGGCCAGGGGTCGGGTGGG - Intronic
1183380817 22:37489667-37489689 GGCAAGTCCAGGGGTGGGGTTGG - Intergenic
1183428472 22:37751885-37751907 GGGCAGCCCAGGAGTGGGGGTGG + Intronic
1183553283 22:38505909-38505931 GGAGAGGCCTGGCGTGGGGGTGG - Intronic
1183623342 22:38987272-38987294 AGAGAGCCCAGGGCTGGGGCTGG - Intronic
1183901572 22:41009802-41009824 GCAGAGCCCAGCAGTAGGGTAGG + Intergenic
1184096689 22:42319920-42319942 GGAGAGACCAGGTGCTGGGGTGG - Intronic
1184277654 22:43419403-43419425 GGTGAACGCAGGGGTGGGGTTGG + Intronic
1184610840 22:45602175-45602197 CAAGAGGCCAGGTGTGGGGCTGG + Intergenic
1184648658 22:45909600-45909622 GGAGGGACCAGGCCTGGGGTGGG + Intergenic
1184678509 22:46056290-46056312 GGAGCGGGCAGGGGTGGGGTGGG - Intronic
1185314315 22:50172109-50172131 AGGGAGCCCAGGCGTGCGGTGGG + Intronic
1185341159 22:50291768-50291790 GGTGGGCCCAGGAGTGGGGGTGG - Intronic
1185371882 22:50464745-50464767 GGAGACGGCAGGTGTGGGGCAGG + Intronic
949909519 3:8890018-8890040 CTAGAGCCCAGCTGTGTGGTGGG + Intronic
949979137 3:9489433-9489455 GTATAGCCTAGGTGTGAGGTAGG - Intergenic
950510853 3:13425678-13425700 TGAGAGCCCAGGGTCGGGGTGGG - Intergenic
950577218 3:13839349-13839371 GGGGAGCCCAGATAGGGGGTGGG + Intronic
951024788 3:17817656-17817678 GGAGTGCCCAGGAATGGTGTGGG - Intronic
953052920 3:39362094-39362116 GGAGTTCCCAGGGGAGGGGTGGG + Intergenic
953136527 3:40186727-40186749 TGAGGGCCAAGGTTTGGGGTGGG + Intronic
953678560 3:45022209-45022231 TGAGAGCCTAGGTGTGTAGTAGG - Intronic
954368532 3:50158395-50158417 GGAGAGGCCAGGGCTGGGGGAGG + Intronic
955059177 3:55481901-55481923 GCAGCTGCCAGGTGTGGGGTGGG - Intronic
956754427 3:72371041-72371063 GGCGAGCCCAGCTGGGGTGTTGG + Intergenic
958869742 3:99543736-99543758 GGAGAACCCTGATGTGGGGGAGG + Intergenic
959111834 3:102132037-102132059 GTAAAGCCCTGCTGTGGGGTGGG + Intronic
960685116 3:120287534-120287556 GGAGCTCCCAGGGGAGGGGTAGG + Intergenic
961093727 3:124137419-124137441 GGTGAGCAAAGGTGTAGGGTGGG + Intronic
961482551 3:127193374-127193396 GGAGATGCCAGGAGTTGGGTGGG - Intronic
961715337 3:128853764-128853786 GGAGCTTCAAGGTGTGGGGTCGG + Intergenic
961959805 3:130843161-130843183 GGGAGGCCAAGGTGTGGGGTGGG + Intergenic
962411193 3:135143157-135143179 GGAGGGCCCAGGGTGGGGGTGGG + Intronic
962907367 3:139816879-139816901 GGAGAGCACAGTGATGGGGTGGG - Intergenic
964915021 3:161830026-161830048 GGACAGGACAGGTGTTGGGTGGG + Intergenic
966214128 3:177483732-177483754 GGAGAGCCCATTTGAAGGGTGGG + Intergenic
967846236 3:194045301-194045323 GGAGAGCCCGGGAGAGGTGTGGG - Intergenic
967979136 3:195055017-195055039 GGAGGGTCCAGGAGAGGGGTTGG - Intergenic
967987873 3:195108610-195108632 ATACAGCCCAGGTGTGTGGTGGG - Intronic
968047607 3:195632688-195632710 GGGGAGCCCATGTGTGGGAGAGG + Intergenic
968231687 3:197008326-197008348 GTAGTGCCAAGGTGTGAGGTGGG - Intronic
968382402 4:107793-107815 GGAGAGCCCGGCTGCGAGGTCGG + Intergenic
968434341 4:576836-576858 GGAGAGCCCGGGTGCTGGGGTGG + Intergenic
968547611 4:1206787-1206809 GCGAACCCCAGGTGTGGGGTAGG + Intronic
968551100 4:1223697-1223719 GCGGGGCCCAGGTGTGGGGTGGG - Intronic
968551332 4:1225264-1225286 GGAGAGGCCCGGGGCGGGGTGGG - Intronic
968554334 4:1239617-1239639 GGACAGCCCAGGGGTGCAGTGGG + Intronic
968606421 4:1537808-1537830 GGAGAGTCCAGGTGTGGCAGGGG + Intergenic
968653251 4:1768118-1768140 GATGAGGCCAGGTGGGGGGTGGG - Intergenic
968725977 4:2247979-2248001 CGAGAGCACTGGTGTGGGCTGGG + Exonic
968729502 4:2262884-2262906 GGAGGGCCCAGGTCTGGGGAAGG + Intergenic
968935026 4:3605331-3605353 GGTGAGGCCAGGTGTGGCCTTGG + Intergenic
969173895 4:5384849-5384871 GGAGAGGCCAGGTGTGGCCATGG + Intronic
969225186 4:5791891-5791913 GAAAGGCCCAGGTGTGGGCTGGG - Intronic
969292716 4:6251087-6251109 GGAGGGCCAAGGTGAGGGTTGGG + Intergenic
969358638 4:6647164-6647186 TGAGGGCCCAGGTGTGGGGCTGG + Intergenic
969545069 4:7820645-7820667 GGAGAGACTAGGAGTGGGGGAGG + Intronic
971220787 4:24704271-24704293 GGAGAGCCAGGGGGCGGGGTAGG + Intergenic
972412743 4:38809362-38809384 GAAGTGCCCAGGTATGGGATAGG - Intronic
972718851 4:41675658-41675680 GGAGGGTACAGGTGGGGGGTGGG - Intronic
974019497 4:56680191-56680213 TGAGAGTCAAGGTGTGGGTTGGG + Intronic
974109843 4:57512547-57512569 AGAGTGCCCAGAGGTGGGGTGGG - Intergenic
976797990 4:88956378-88956400 ATATAGCCTAGGTGTGGGGTAGG + Intronic
982136609 4:152279131-152279153 GGGGAGCCCAGATGCGGGGCTGG - Intergenic
983882679 4:172951086-172951108 GGAGAGCCTGGGTGTTGGGCTGG - Intronic
985670591 5:1204643-1204665 TGAGGGGCCAGCTGTGGGGTGGG - Intronic
985796290 5:1964461-1964483 GTACAGCCCAGGTGTGGAGAAGG - Intergenic
986026965 5:3859862-3859884 GGAAAGCCCGGGTCTGGGGGAGG - Intergenic
986061070 5:4191846-4191868 GAGGAGCCCAGGTGCGGGCTGGG + Intergenic
986787163 5:11125123-11125145 TGAGTGCCCAGGGGTGGGGAAGG + Intronic
987099222 5:14577528-14577550 GGGGAGCCCATGTGTGGGGCAGG - Intergenic
989146836 5:38258178-38258200 GGAGGGCCCAGGTGGGGTGGAGG + Intergenic
990003510 5:50921662-50921684 GGAGAGCCCAGGTCTGCAGGTGG + Intergenic
990568684 5:57055763-57055785 TGAGAGTCCATGAGTGGGGTAGG - Intergenic
990619046 5:57540245-57540267 TGAGATCCCAGGGGTGAGGTTGG + Intergenic
991613861 5:68476051-68476073 GGTGACCACAGGTGTGGGGTGGG - Intergenic
992420355 5:76597613-76597635 GGAGACCCCAGCTGTGGGGACGG + Intronic
992998376 5:82355071-82355093 GCAAAACCTAGGTGTGGGGTTGG + Intronic
993903329 5:93598585-93598607 GGCGAGCCAGGGTGTGGGGTGGG + Intergenic
994209316 5:97070515-97070537 AGAGAGCCCAAGAGTGGGGAGGG - Intergenic
995751852 5:115460392-115460414 GGAGAGCCCAGATGGGGGTGGGG - Intergenic
995802914 5:116019092-116019114 ATAGAGCCCAGGTGTGTAGTAGG - Intronic
997191892 5:131945423-131945445 GGAGAGCCTAGGTCTGGCGTCGG + Intronic
997439525 5:133899460-133899482 GGAGAGGCGGGGTGTGGGGGTGG - Intergenic
997604900 5:135167818-135167840 TGACAGCCCAGGTATGGGGGAGG + Intronic
1000568042 5:162875407-162875429 GGAGAGCCCAGGTGGTGTTTGGG - Intergenic
1001583982 5:172820410-172820432 GGAGCGCACAGGGGTGGGGCAGG + Intergenic
1001672092 5:173482003-173482025 GGTATGCCCAGGAGTGGGGTAGG - Intergenic
1001762543 5:174220250-174220272 GGAGAAACTAGGAGTGGGGTTGG + Intronic
1001887345 5:175305517-175305539 AGAGAGCCTAGGTGTGTAGTAGG - Intergenic
1002108398 5:176891638-176891660 GAAGAGCCGAGGAGTGGGCTGGG - Intronic
1002194881 5:177496395-177496417 GGTGAGCCTAGGTTTGGGGAGGG - Exonic
1002212192 5:177605647-177605669 GAAGGGCCCAACTGTGGGGTGGG - Intronic
1002689679 5:181042062-181042084 GGAGAGAACAGGAGTGGGGCGGG + Intronic
1004473560 6:15950381-15950403 GGAGAGCCAGGGGCTGGGGTAGG - Intergenic
1005576817 6:27197664-27197686 GGAGAGACCACGTGTGGTTTGGG - Intergenic
1005886370 6:30100903-30100925 GGCGGGCCCAGGTGTCGGGGCGG - Intergenic
1006385294 6:33727317-33727339 GAAGGGCACAGGAGTGGGGTGGG + Intronic
1006510568 6:34519057-34519079 GGAGAGCACAGGGGTGGTGAAGG + Intronic
1006840400 6:37025003-37025025 GGGGAGCCCAGATGTGGGCGTGG - Intronic
1006929806 6:37680898-37680920 GGAGAGCTCAGTTGTGGATTTGG - Intronic
1007072810 6:39049089-39049111 GGAAGGCCCAGGTGAGGGCTTGG + Intronic
1007400784 6:41601115-41601137 GTAGTGCCCAGGTGTGGTGGTGG + Exonic
1007740625 6:44007413-44007435 GGAGAGCGATGGGGTGGGGTGGG + Intergenic
1007798300 6:44369300-44369322 TGAGAGGCCAAGGGTGGGGTGGG + Intronic
1008661159 6:53669545-53669567 GGAGAGTGCAGGTGTGTGGATGG + Intergenic
1009043328 6:58208522-58208544 GGAGAGCCAAGCTGTGTGCTAGG + Intergenic
1009219161 6:60962780-60962802 GGAGAGCCAAGCTGTGTGCTAGG + Intergenic
1009624877 6:66126544-66126566 GGAGAGGCCAGGTAGGGGTTGGG + Intergenic
1010721016 6:79283388-79283410 GGAGAGTGCAGGTTTGGGATAGG + Intergenic
1010747123 6:79576797-79576819 GGAGGAGCCAGGTTTGGGGTGGG - Intergenic
1011130993 6:84051749-84051771 AGAGTGCCCAGGAGTGGTGTGGG + Intronic
1011320685 6:86089117-86089139 GGAGACTCCAGATGTGTGGTGGG - Intergenic
1011533501 6:88351095-88351117 GAAAAGCCCAGTTTTGGGGTGGG - Intergenic
1012399410 6:98832068-98832090 GGAGGGCGGGGGTGTGGGGTGGG + Intergenic
1013449819 6:110269064-110269086 GGAGAGGCTTGGGGTGGGGTTGG - Intronic
1014146094 6:117999491-117999513 TGATAGCCCAGGGGTGGGGGTGG - Intronic
1015275218 6:131377212-131377234 GGTGAGTCCAGGTGTCGGGGAGG + Intergenic
1015625755 6:135180476-135180498 GGGGAGCAAAGGTGTGCGGTGGG + Intergenic
1015840291 6:137469476-137469498 TTAGAGCCTAGGTGTGTGGTAGG + Intergenic
1017247048 6:152238170-152238192 GGAGTGCCCAGGTGTGTGCCTGG + Intronic
1017347903 6:153405853-153405875 GGAAAGGCAAGATGTGGGGTGGG + Intergenic
1018285989 6:162238316-162238338 GTACAGCCCAGGTGTGCAGTAGG + Intronic
1018312440 6:162525110-162525132 TTGGAGCCCAGGTGTGGGCTGGG - Intronic
1018368925 6:163149700-163149722 GGAGCTCACAGGTGTTGGGTTGG - Intronic
1018527813 6:164733710-164733732 ATAGAGCCTAGGTGTGTGGTGGG + Intergenic
1018827711 6:167421943-167421965 GGGGAGCCCGTGTGTGGGGGGGG - Intergenic
1018901049 6:168051886-168051908 GGAGTGCCCACCTGTGGGCTGGG - Intergenic
1019271251 7:150282-150304 GGAGAGGCCAGGTGTTGGCCTGG + Intergenic
1019271351 7:150710-150732 TGACAGCCCAGGCGTAGGGTCGG + Intergenic
1019338499 7:496226-496248 GGAGAGCCCTGGGGAGGGGCAGG - Intergenic
1019354773 7:572727-572749 GGAGGCCCCAGGTGGAGGGTAGG + Intronic
1019541676 7:1554516-1554538 GGTGTGCGCAGGGGTGGGGTGGG - Intronic
1019608170 7:1920541-1920563 GGAGGGTGCAGGTGTGGGGTGGG + Intronic
1019910097 7:4095128-4095150 GAAGAGCTCAGATGTGGGGGAGG - Intronic
1020088293 7:5323337-5323359 GGTGAGGACAGGTGTGGGGGTGG - Intronic
1020683684 7:11267791-11267813 GGAATTCCCATGTGTGGGGTAGG + Intergenic
1021751962 7:23809840-23809862 GTATAGCCTAGGTGTGTGGTAGG + Intronic
1022189982 7:28007843-28007865 GGAGAGGCCATGCATGGGGTGGG - Intronic
1022325160 7:29324097-29324119 GGCGGGCACAGGAGTGGGGTTGG + Intronic
1022372371 7:29783716-29783738 GGAAAGCCCACATGTGGGCTTGG - Intergenic
1022701222 7:32762118-32762140 GGAGAGTGCACGTGTGGGCTTGG - Intergenic
1023095431 7:36655439-36655461 GAAGATCCAAGGTGTAGGGTGGG + Intronic
1023132327 7:37015198-37015220 GAAGAGTCCGGGGGTGGGGTGGG + Intronic
1023763124 7:43485537-43485559 GTACAGCCTAGGTGTGTGGTAGG - Intronic
1023770289 7:43550703-43550725 GGAGAGCCAAGGTGGGCAGTGGG + Intronic
1023960506 7:44922207-44922229 TGAGAGCCCAGGCCTGGGGTGGG - Intergenic
1023990940 7:45127860-45127882 GAAGGGACTAGGTGTGGGGTGGG - Intergenic
1024333438 7:48179486-48179508 GGACAGCCCAGGAATCGGGTAGG - Intronic
1024686793 7:51754806-51754828 ATAGAGCCTAGGTGTGTGGTAGG - Intergenic
1025092852 7:56077840-56077862 GGAGAAGTCAGGTGTGGGCTGGG + Intronic
1025206019 7:56993778-56993800 GGTGAGGACAGGTGTGGGGGTGG + Intergenic
1025665921 7:63583161-63583183 GGTGAGGACAGGTGTGGGGGTGG - Intergenic
1026162342 7:67880773-67880795 GAAGAGGCCAGGTGTCAGGTTGG + Intergenic
1027833999 7:83218143-83218165 GGAGGGACCCGGAGTGGGGTGGG + Intergenic
1028177147 7:87672381-87672403 GGAGCGTCCAGGGGAGGGGTGGG - Intronic
1028599832 7:92589929-92589951 GGCGGGGCCAGGTGTGGGGGGGG + Intronic
1028798227 7:94929745-94929767 AGAAAGGCTAGGTGTGGGGTGGG + Intronic
1029611785 7:101630494-101630516 GGAGAACCCAGCTCTGGGGACGG + Intergenic
1030232299 7:107221267-107221289 GAAGACCCCAGGGGTGGGGGTGG + Intronic
1030331877 7:108279641-108279663 TTTGAGCCCAGGGGTGGGGTGGG - Intronic
1030696205 7:112588133-112588155 GGAGTGCCTAGGTGAGGGGAGGG + Intergenic
1031333936 7:120502370-120502392 GGAGAGCAGAGGGGAGGGGTAGG + Intronic
1033198697 7:139349974-139349996 GCCGAGACCAGGTGTGGGGAAGG - Intronic
1033553753 7:142470435-142470457 GGACAGACCATGGGTGGGGTGGG - Intergenic
1034413284 7:150952367-150952389 GGAGAGGCCAGGAATGTGGTGGG - Intronic
1034449189 7:151128382-151128404 GGAGAGCCGAGTTCTGGGGAAGG + Intronic
1034814373 7:154159162-154159184 GGAGGGCCCGGGTGCGGGGAAGG - Intronic
1034841248 7:154399728-154399750 GGAGAACGCAGGGGTGGGGGAGG + Intronic
1035256651 7:157633555-157633577 GCAGAGCCTGGGTGTGGGGACGG + Intronic
1035394669 7:158527217-158527239 GGAGAAGCTGGGTGTGGGGTGGG - Intronic
1035454928 7:159001966-159001988 GGAGAGCCCATGTGTGTGGGTGG + Intergenic
1035678223 8:1469741-1469763 GGAGGGCCCATTTCTGGGGTTGG - Intergenic
1035717330 8:1764053-1764075 GGGGATCCCAGGTGAGGGGCCGG + Intronic
1035717356 8:1764125-1764147 GGGGAGCCCGGGTGAGGGGCCGG + Intronic
1036703137 8:11027075-11027097 GTATAGCCTAGGTGTGTGGTAGG - Intronic
1037482032 8:19313986-19314008 GGCGGGCTCAGGTGCGGGGTTGG + Intronic
1037688265 8:21162150-21162172 GGAGAGGCCTGGTTTGGAGTGGG - Intergenic
1037837138 8:22221008-22221030 GGAGAGCCCAGGAGGTGGGCAGG + Exonic
1038187188 8:25285869-25285891 AGAGAGCCAAGATGTGGCGTGGG + Intronic
1038602263 8:28957395-28957417 GGAGACTCCAGGAGTGGGGAAGG + Intronic
1041198312 8:55424024-55424046 GGATGGCCCAGGTGTGCGTTTGG - Intronic
1041304955 8:56448262-56448284 GCAGAGCCCTGGAGTGGGGCTGG + Intergenic
1041333075 8:56749551-56749573 GTATAGCTCAGGTGTGTGGTAGG - Intergenic
1041423254 8:57692887-57692909 GCAAGGCTCAGGTGTGGGGTCGG + Intergenic
1042416685 8:68528169-68528191 TGAGAGGCCAGGTTTGGGGAAGG - Intronic
1042659809 8:71142017-71142039 GTAGGGCACATGTGTGGGGTGGG + Intergenic
1042734964 8:71977994-71978016 CCAGAGCCAAGGGGTGGGGTGGG - Intronic
1044930213 8:97244921-97244943 GGAAACCCCAGGTGTGAGGGAGG - Intergenic
1045244392 8:100430175-100430197 GAAGAGCCCGGGTGATGGGTGGG - Intergenic
1047338131 8:123955435-123955457 CGAGAGCCCAGGTCTGGTGATGG + Intronic
1047645059 8:126861622-126861644 GCAGAGCTGTGGTGTGGGGTAGG - Intergenic
1048973010 8:139655719-139655741 GGAGAGCCCAGGGGTGTGGGAGG - Intronic
1049173415 8:141176361-141176383 GGCGAGCCCAGCTGTGTGGGTGG + Intronic
1049204871 8:141359033-141359055 GGTCAGCCCAGCTGTAGGGTGGG - Intronic
1049542742 8:143215836-143215858 GGGGCCCCCAGGTGTGTGGTGGG - Intergenic
1049657044 8:143803592-143803614 GGAGAGACCTGTTGGGGGGTGGG + Intronic
1049686180 8:143940178-143940200 GGAGGGGCCAGGCCTGGGGTGGG - Intronic
1050360250 9:4823412-4823434 GGAAAGCCCAGGTGTGATGCAGG + Intronic
1051263949 9:15293227-15293249 AGAGAGCCTAGGTGTGTAGTAGG + Intronic
1051387036 9:16520221-16520243 GAAGAGCCCAAGTGTCGGGTTGG - Intronic
1053016763 9:34666162-34666184 GGTGAGGCCAGGGGCGGGGTCGG + Intergenic
1053157526 9:35791484-35791506 CGAGCGCCCGGGTGGGGGGTGGG + Intergenic
1054455148 9:65426647-65426669 GGTGAGGCCAGGTGTGGGCTTGG - Intergenic
1054962261 9:70982064-70982086 GGAGAACCCAGGAGTGAAGTTGG - Intronic
1055832096 9:80392049-80392071 ATAGAGCCTAGGTGTGCGGTAGG - Intergenic
1056512783 9:87321647-87321669 GGGGAACCCATGTGTGTGGTAGG - Intergenic
1057758889 9:97857214-97857236 GAAGAGCCCAGGCGTGGGACTGG + Intergenic
1057819706 9:98321583-98321605 GCAGAGCCAAGGTGGGCGGTGGG + Intronic
1057953597 9:99389390-99389412 GGTGAGCCAAGGTGTGGGATTGG - Intergenic
1058255492 9:102757066-102757088 GGAGAGTTTAGGTGTGAGGTAGG - Intergenic
1059391504 9:114002255-114002277 GGACAGCTCAGGTGTGGGAGGGG + Intronic
1059450939 9:114371129-114371151 AGGGAGCCCAGCTGTGGGGCAGG - Intronic
1059466302 9:114470819-114470841 GAAGGGCCCCGGGGTGGGGTGGG - Intronic
1061045731 9:128163855-128163877 GGAGCGCCCAGGAGTTGGGTGGG - Exonic
1061158917 9:128882240-128882262 GGCGAGCCCAGGTGAGTGGACGG + Intronic
1061181377 9:129026978-129027000 GGAGTGCCCGGGTTGGGGGTGGG + Intronic
1061255411 9:129452253-129452275 GGAGAGTCCAGGTGTGCTGCGGG + Intergenic
1061449211 9:130659616-130659638 GGAGGGGACAGGGGTGGGGTGGG + Intergenic
1061520187 9:131113169-131113191 GGAGTGCTCAGCTGTGGGGAGGG + Intronic
1061557094 9:131377600-131377622 GTGGAGCCCAGGGCTGGGGTGGG - Intergenic
1061757622 9:132826551-132826573 GGAGAGGCAAGGGATGGGGTGGG - Intronic
1061805403 9:133135084-133135106 GGAGGGCCCCTGTGTGTGGTGGG + Intronic
1061860159 9:133463910-133463932 GGAGCTCCCAGGACTGGGGTGGG + Intronic
1185445927 X:258060-258082 GCAGAGCCCAGCTCTGGGGGTGG - Intergenic
1186877386 X:13829610-13829632 ACAGAGCACAGGTCTGGGGTGGG - Intronic
1187191944 X:17043771-17043793 GGTGACGCCAGGTGTGAGGTGGG + Intronic
1189205636 X:39236337-39236359 GGAGAGTCCAGGTGTGGCTGGGG - Intergenic
1189226889 X:39420539-39420561 GGAGAGCCCAGGGCAGGGCTTGG - Intergenic
1189282347 X:39827753-39827775 GGAGGGGGCAGGTGTGGGGAAGG - Intergenic
1190169453 X:48100294-48100316 GGAGAGCAGAGCTGTGGGGAAGG + Intergenic
1190823423 X:53995588-53995610 TGAGAGCCCAGGGGAAGGGTCGG - Intronic
1191153973 X:57251870-57251892 GGTGAGCCAAAGTGGGGGGTGGG + Intergenic
1192176198 X:68887060-68887082 GGAGAGCGTAGTTGTGGGGCTGG - Intergenic
1194817554 X:98462852-98462874 GGAGAAGCCGGGGGTGGGGTTGG - Intergenic
1197361008 X:125504130-125504152 TGAGTGCCCAGATCTGGGGTAGG + Intergenic
1198567125 X:137916305-137916327 GGAGAGGCCAGGTGGTGGGGTGG - Intergenic
1200148900 X:153941938-153941960 GCAGAACCCAGGTGAGGGGCGGG - Exonic
1201967596 Y:19754976-19754998 GGAGTGCCTAGGGGAGGGGTGGG - Intergenic
1202607202 Y:26649201-26649223 GGAGTGCCCAGGAGTGGAATGGG + Intergenic
1202608407 Y:26658588-26658610 GGAGTGCCCAGGAGTGGAATGGG + Intergenic
1202609531 Y:26667177-26667199 GGAGTGCCCAGGAGTGGAATGGG + Intergenic
1202610042 Y:26671013-26671035 GGAGTGCCCAGGAGTGGAATGGG + Intergenic