ID: 1103478181

View in Genome Browser
Species Human (GRCh38)
Location 12:121233556-121233578
Sequence CTGTGGAGAGCCCAGGTGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 870
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 812}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103478181_1103478192 7 Left 1103478181 12:121233556-121233578 CCCCACACCTGGGCTCTCCACAG 0: 1
1: 0
2: 4
3: 53
4: 812
Right 1103478192 12:121233586-121233608 AAAGAACAGAGAGGAGGAGGAGG 0: 1
1: 0
2: 45
3: 498
4: 3211
1103478181_1103478191 4 Left 1103478181 12:121233556-121233578 CCCCACACCTGGGCTCTCCACAG 0: 1
1: 0
2: 4
3: 53
4: 812
Right 1103478191 12:121233583-121233605 ATCAAAGAACAGAGAGGAGGAGG 0: 1
1: 0
2: 2
3: 56
4: 669
1103478181_1103478189 1 Left 1103478181 12:121233556-121233578 CCCCACACCTGGGCTCTCCACAG 0: 1
1: 0
2: 4
3: 53
4: 812
Right 1103478189 12:121233580-121233602 CCCATCAAAGAACAGAGAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 275
1103478181_1103478193 8 Left 1103478181 12:121233556-121233578 CCCCACACCTGGGCTCTCCACAG 0: 1
1: 0
2: 4
3: 53
4: 812
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528
1103478181_1103478186 -2 Left 1103478181 12:121233556-121233578 CCCCACACCTGGGCTCTCCACAG 0: 1
1: 0
2: 4
3: 53
4: 812
Right 1103478186 12:121233577-121233599 AGCCCCATCAAAGAACAGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 166
1103478181_1103478194 16 Left 1103478181 12:121233556-121233578 CCCCACACCTGGGCTCTCCACAG 0: 1
1: 0
2: 4
3: 53
4: 812
Right 1103478194 12:121233595-121233617 AGAGGAGGAGGAGGGAGAAATGG 0: 1
1: 12
2: 219
3: 1639
4: 8255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103478181 Original CRISPR CTGTGGAGAGCCCAGGTGTG GGG (reversed) Exonic
900015590 1:146812-146834 CTGTGGGGGGCCAAGGTGAGAGG + Intergenic
900045853 1:505406-505428 CTGTGGGGGGCCAAGGTGAGAGG + Intergenic
900068055 1:747122-747144 CTGTGGGGGGCCAAGGTGAGAGG + Intergenic
900399174 1:2466027-2466049 ACATGCAGAGCCCAGGTGTGGGG + Intronic
900421247 1:2556889-2556911 CTGTGGTGAGCCCAGTGCTGGGG - Intronic
900674543 1:3876786-3876808 CTGTGCAGGCCCCTGGTGTGAGG - Intronic
900690322 1:3976906-3976928 CTGTGCAGGGCCCACCTGTGTGG + Intergenic
900722824 1:4188750-4188772 CTTTGGGAGGCCCAGGTGTGTGG - Intergenic
900875284 1:5338199-5338221 TTGTGGAGAGTCCAGGCATGTGG - Intergenic
900997230 1:6129186-6129208 GTGTGGTGCGTCCAGGTGTGTGG + Intronic
901826354 1:11864262-11864284 CTTTGGAAGGCCCAGGTGGGAGG + Intergenic
902250443 1:15151634-15151656 CTTTGGAGAGGCCTGGGGTGGGG - Intergenic
903011901 1:20337369-20337391 CTGTGGGAAGCCGAGGTGGGTGG - Intronic
903499442 1:23793361-23793383 CTGTGGAGCCCCCAGGAGTGGGG + Intronic
903762308 1:25707327-25707349 CTGTGCAGAGCCCAGGTAGGGGG + Intronic
903832520 1:26183562-26183584 CTCTGCAGAGCCCAGGTGATGGG + Intronic
903854933 1:26331501-26331523 CTGGAGAGAGCCCAGGACTGTGG + Exonic
903982900 1:27202799-27202821 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
904228478 1:29045596-29045618 CTTTGGGGAGCCAAGGTGGGAGG - Intronic
904717240 1:32477811-32477833 CTGTGGGAGGCCCAGGTGGGTGG + Intronic
905444392 1:38016189-38016211 TTGGGCAGAGCCCAGTTGTGGGG + Intronic
905987482 1:42299957-42299979 CTTTGGAAGGCCCAGGTGGGCGG + Intronic
906006968 1:42481973-42481995 CTTTGGAAGGCCCAGGTGGGTGG + Intronic
906011299 1:42529228-42529250 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
906053296 1:42892881-42892903 CTGTGGAAGGCCGAGGTGGGCGG + Intergenic
906165660 1:43684259-43684281 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
906353583 1:45084151-45084173 CTTTGGGAAGCCAAGGTGTGTGG - Intronic
906476008 1:46169963-46169985 CTGTGGAGAGCACCTGGGTGGGG - Intronic
906580773 1:46933906-46933928 CTGTGGAGAGTTTAGGTGAGAGG + Intronic
908209072 1:61881275-61881297 TTCAGGAGAGCCCAGCTGTGGGG + Intronic
909300361 1:74005253-74005275 CTTTGGAAAGCCGAGGTGGGCGG - Intergenic
909311355 1:74153996-74154018 CTTTGGGGGGCCGAGGTGTGCGG + Intronic
910452818 1:87364188-87364210 CTCTGGGGAACCCAGTTGTGTGG + Intergenic
910621116 1:89255795-89255817 CTTTGGGGAGCCGAGGTGGGTGG + Intergenic
910665777 1:89724829-89724851 ATGTGGAGAGACCAGGGGTGGGG + Intronic
911608993 1:99939856-99939878 CTTTGGGGGGCCCAGGTGGGTGG - Intergenic
911641599 1:100295664-100295686 CTTTGGAGGGCCGAGGTGGGTGG + Intergenic
911646006 1:100337760-100337782 CTTTGGAAAGCCGAGGTGGGCGG + Intergenic
911895985 1:103435960-103435982 CTTTGGAGGGCCGAGGTGGGTGG + Intergenic
913006571 1:114638513-114638535 CTTTGGGGGGCCCAGGTGGGAGG + Intronic
913049604 1:115105589-115105611 CTATGGAGAGCCCAGATATTTGG - Intergenic
913296472 1:117326114-117326136 CTTTGGGAAGCCAAGGTGTGTGG + Intergenic
913466106 1:119144682-119144704 CTTTGGAAAGCCGAGGTGGGCGG + Intergenic
915357571 1:155264736-155264758 GTGTGAAGAGCACAGCTGTGCGG - Exonic
915426811 1:155834065-155834087 CTTTGGAAGGCCAAGGTGTGAGG - Intronic
915453580 1:156024001-156024023 CTTTGGAAAGCCGAGGTGGGTGG + Intergenic
916121774 1:161534442-161534464 CTGTGGCCAGCCAAGGTATGGGG + Intergenic
916131367 1:161614388-161614410 CTGTGGCCAGCCAAGGTATGGGG + Intronic
916251155 1:162739548-162739570 CTTTGGGCAGCCCAGGTGGGCGG - Intronic
917700759 1:177578446-177578468 CGGTGGAGAGCACAGGTTTGTGG + Intergenic
917725770 1:177825747-177825769 CAGTGATGAGCCCAGGTCTGGGG + Intergenic
917959804 1:180133063-180133085 CTTTGGACAGCCAAGGTGGGAGG + Intergenic
917996031 1:180439294-180439316 CTGGGGAGGGGCCGGGTGTGGGG + Intronic
918055511 1:181018139-181018161 CTTTGGGAAGCCAAGGTGTGTGG + Intronic
918226421 1:182487380-182487402 ATGTGAAGAGCCCAGGGATGGGG - Intronic
918361821 1:183766970-183766992 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
918522933 1:185434686-185434708 CTTTGGAAAGCCGAGGTGGGAGG - Intergenic
919776265 1:201195867-201195889 CTGTGGGGAGCCCAGGCCCGAGG + Exonic
919956711 1:202424564-202424586 CTTTGGAAAGCCTAGGTGGGTGG - Intronic
920132311 1:203741649-203741671 CTGTGGACAGCTCAGGTGAAAGG - Exonic
920535091 1:206731969-206731991 GCGGGGAGTGCCCAGGTGTGAGG + Intronic
920630336 1:207645664-207645686 CTCTGGAGTGCACAGGTGCGTGG + Intronic
920813686 1:209310684-209310706 CTTTGGGGTGCCAAGGTGTGAGG - Intergenic
921592864 1:217024113-217024135 CTTTGGGAAGCCCAGGTGGGCGG + Intronic
922103417 1:222492500-222492522 CTGTGGGGGGCCAAGGTGAGAGG + Intergenic
922263736 1:223965012-223965034 CTGTGGGGGGCCAAGGTGAGAGG + Intergenic
922369956 1:224899994-224900016 CTTTGGAGGGCCTAGGTGGGAGG + Intronic
922462824 1:225826218-225826240 CTTTGGAAAGCCGAGGTGGGCGG + Intronic
922522137 1:226263826-226263848 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
922616227 1:226962775-226962797 CGGGGGAGAGCACAGGTGTGAGG - Intronic
923243489 1:232108818-232108840 CTGTGGAGGCCCCAGGGTTGGGG + Intergenic
923473817 1:234314515-234314537 CTTTGGAAAGCCGAGGTGTGTGG + Intronic
924058596 1:240147599-240147621 CTTTGGGGGGCCCAGGTGGGAGG - Intronic
924157571 1:241195230-241195252 CTTTGGAAAGCTCAGGTGGGCGG + Intronic
924345580 1:243070007-243070029 CTGTGGGGGGCCAAGGTGAGAGG + Intergenic
924495264 1:244582643-244582665 CTCTGGGGAGCCAAGGTGGGCGG - Intronic
924810394 1:247396143-247396165 CTTTGGGGGGCCCAGGTGAGAGG + Intergenic
924905480 1:248447478-248447500 CCGTGGAGAGCTGAGGTGTGTGG - Intergenic
924922411 1:248644556-248644578 CCGTGGAGAGCTGAGGTGTGTGG + Intergenic
1062911187 10:1213487-1213509 CAGGGGGGTGCCCAGGTGTGGGG - Intronic
1063397496 10:5703977-5703999 CTTTGGGGGGCCCAGGTGGGTGG + Intronic
1064149220 10:12849038-12849060 CTTTCCAAAGCCCAGGTGTGTGG + Intergenic
1064173838 10:13057046-13057068 CTTTGGAGAGCCGAGGCGGGAGG + Intronic
1064275174 10:13898937-13898959 CTCTGGAGGGCCGAGGTGGGAGG + Intronic
1064473046 10:15656649-15656671 ATGGGGAGAGGCCAGGTGCGGGG - Intronic
1064605079 10:17030673-17030695 CTTTGGGAAGCCGAGGTGTGTGG + Intronic
1065346957 10:24757696-24757718 CTTTGGGAAGCCCAGGTGGGAGG - Intergenic
1065661147 10:28005383-28005405 ATGTGCAGAGCCCAGATCTGTGG + Intergenic
1065953665 10:30674593-30674615 CTGTGGGGAGCCAAGGTGGGAGG + Intergenic
1066730760 10:38434805-38434827 CTGTGGGGGGCCAAGGTGAGAGG - Intergenic
1067355672 10:45523280-45523302 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1067576854 10:47414595-47414617 CTCTGGACAGCCCAGGTTGGTGG - Intergenic
1067712028 10:48657123-48657145 CCCTGGAGACCCCGGGTGTGGGG + Intergenic
1068033949 10:51736877-51736899 CTTTGGAAAGCCAAGGTGAGAGG - Intronic
1068036236 10:51763494-51763516 CTTTGGAAGGCCCAGGTGAGTGG - Intronic
1068639383 10:59385585-59385607 CTGTGGAGACAGCAGATGTGAGG - Intergenic
1068696473 10:59972890-59972912 CTGTGGAAGGCCGAGGTGGGCGG - Intergenic
1069523432 10:69145276-69145298 CTTTGGGAAGCCAAGGTGTGTGG - Intronic
1069715379 10:70517583-70517605 CTTTGGAAAGCCGAGGTGAGCGG - Intronic
1069789791 10:71012253-71012275 CTGTGGAGAGCCCTGAGGTTGGG + Intergenic
1069832496 10:71289779-71289801 CTCTGGGGAGCCCAAGAGTGAGG + Intronic
1069851569 10:71408773-71408795 CTGTGGAGGGCCTGGGTGTCAGG + Intronic
1070168964 10:73918250-73918272 CTTTGGGAAGCCGAGGTGTGTGG + Intronic
1070308506 10:75255548-75255570 CTTTGGAAAGCCGAGGTGGGTGG + Intergenic
1070380742 10:75878420-75878442 CTGAGGAGAGTCCAGCTGTTGGG - Intronic
1072278154 10:93842666-93842688 CTCTTGTGAGCCCAGGAGTGGGG - Intergenic
1072329006 10:94327349-94327371 CTGTGGGAGGCCGAGGTGTGTGG + Intronic
1072338217 10:94419429-94419451 CTTTGGGAAGCCCAGGTGGGTGG + Intronic
1072350759 10:94554903-94554925 CTTTGGGGAGCCTAGGTGGGTGG + Intronic
1072419939 10:95281733-95281755 CTTTGGAAGGCCGAGGTGTGAGG - Intronic
1072918598 10:99556609-99556631 CTTTGGAAAGCCAAGGTGAGAGG + Intergenic
1072974546 10:100046361-100046383 CTTTGGAAGGCCAAGGTGTGAGG + Intronic
1073277154 10:102322101-102322123 CTGTGGGAAGCCGAGGTGGGTGG - Intronic
1073450979 10:103608895-103608917 CTTTGGGAAGCCCAGGTGGGAGG + Intronic
1073792098 10:106951177-106951199 CTGTGGACAGTCAAGGTGAGAGG - Intronic
1074090242 10:110246076-110246098 CTTTGGAAAGCCCAGGTGGGAGG + Intronic
1074392254 10:113068318-113068340 CTGTTGACAGCCCATGTGTGAGG + Intronic
1074427283 10:113362652-113362674 CTGGGGAGAGACCAGCTTTGAGG + Intergenic
1075043556 10:119127871-119127893 CTTTGGAAAGCCGAGGTGGGAGG - Intronic
1075074706 10:119343025-119343047 CTGTGGAGGGTCCCAGTGTGGGG + Intronic
1075338146 10:121623698-121623720 CTGTGGAAAGCACACGTGTTTGG + Intergenic
1075499562 10:122960512-122960534 CTGTGGAAGGCCCAGGTGGGTGG - Intronic
1076138805 10:128063819-128063841 CTGTGGGGAGCCTGGGTGCGGGG + Intronic
1076278858 10:129228072-129228094 CTGTGGCGAGACCAGTTATGTGG - Intergenic
1076410785 10:130248189-130248211 CTTTGGGAAGCCAAGGTGTGTGG + Intergenic
1076664237 10:132077020-132077042 CTGTGGTGGCCCCAGGTCTGTGG + Intergenic
1076691460 10:132225710-132225732 GTGTGGGCAGCCCAGGTGGGTGG - Intronic
1076729235 10:132429946-132429968 CAGTGGAGGGCTCAGGTGGGAGG - Intergenic
1076972181 11:141879-141901 CTGTGGGGGGCCAAGGTGAGAGG + Intergenic
1077093721 11:790685-790707 CTGTGGAGGGCCCCGGTTTTGGG + Exonic
1077113184 11:870842-870864 CTGTCCAGACCCCAGGTGAGAGG + Intronic
1078232256 11:9454223-9454245 CTGTGGGAGGCCCAGGTGGGTGG - Intergenic
1078260073 11:9698027-9698049 CTGTGGTAAGCCCAGGTGGGAGG - Intronic
1078274228 11:9827282-9827304 CTTTGGGAAGCCCAGGTGGGAGG + Intronic
1078997301 11:16715988-16716010 CTTTGGAAAGCCGAGGTGGGAGG + Intronic
1079030104 11:16980382-16980404 CTGTGGAGAGCCCACTTGCCAGG - Intronic
1079242931 11:18733430-18733452 CTGTGAAGAGCCTGAGTGTGGGG - Intronic
1079836639 11:25342810-25342832 CTGTGGGAAGCCAAGGTGGGTGG + Intergenic
1081900898 11:46626994-46627016 CTGTGGAAAGCCGAGGTGGATGG + Intronic
1081978934 11:47254205-47254227 CTGTGGGGAGACTAGGTGTCAGG + Intronic
1082931100 11:58606308-58606330 CTCTGGAGGGCCAAGGTGGGCGG - Intronic
1083614395 11:64019128-64019150 CTGTGGAGTGCCCTAGTCTGTGG + Intronic
1083640998 11:64145258-64145280 CTTTGAGGGGCCCAGGTGTGCGG - Intronic
1083830919 11:65233084-65233106 CTGTTGTGAGCCCAGGGGAGGGG - Intergenic
1083922833 11:65789729-65789751 CAGTGGAGGGCCCAGGAATGTGG + Intronic
1084340887 11:68499814-68499836 CTTTGGAGGGCCGAGGTGGGAGG - Intronic
1084521570 11:69666375-69666397 GTGTGGAGAGCCAGCGTGTGGGG + Exonic
1084559053 11:69892547-69892569 CGGTGGAGCGCTCATGTGTGCGG + Intergenic
1084998455 11:73006619-73006641 ATGTGCAGAGCACAGGTGTTGGG - Intronic
1085179433 11:74521125-74521147 CTCTGGAAAGCCCAGGCATGAGG + Intronic
1085229287 11:74950787-74950809 CTTTGGGGAGCCAAGGTGGGAGG - Intronic
1085453391 11:76651927-76651949 CTTTGGAAAGCCGAGGTGGGTGG - Intergenic
1086174213 11:83870599-83870621 CTGTGAAGGGCTCAGCTGTGGGG + Intronic
1086656383 11:89361871-89361893 CTGTGGAGAGCGCAGTTGGCAGG + Intronic
1087037751 11:93772077-93772099 CTTTGGAAGGCCCAGGTGGGAGG + Intronic
1087192600 11:95271153-95271175 CTGGGGAGAACCCAGGTTTAAGG - Intergenic
1087492692 11:98848494-98848516 CTTTGGGGTGCTCAGGTGTGTGG + Intergenic
1088416672 11:109596921-109596943 CTTTGGAGGGCCAAGGTGGGTGG - Intergenic
1088480120 11:110288992-110289014 CTGTGGGAGGCCCAGGTGAGCGG + Intronic
1088714011 11:112532951-112532973 CTTTGGAGAGCTGAGGTGGGTGG + Intergenic
1089065935 11:115662091-115662113 CTGTTCTGGGCCCAGGTGTGGGG - Intergenic
1089184380 11:116605024-116605046 CTGAGGAGACCCCAGGAGAGAGG - Intergenic
1089278521 11:117356034-117356056 GACAGGAGAGCCCAGGTGTGAGG - Intronic
1089681422 11:120121055-120121077 GTTGTGAGAGCCCAGGTGTGCGG - Intronic
1089843813 11:121442389-121442411 CTTTGGAAAGCCGAGGTGGGTGG + Intergenic
1090371563 11:126258150-126258172 CTGTGGGAGGCCCAGGTGGGAGG + Intronic
1091582749 12:1799012-1799034 CTGGGGACAGCCCAGGTGGTGGG + Intronic
1091584936 12:1810764-1810786 ATGTGGAGAGCACGTGTGTGAGG + Intronic
1091638974 12:2219894-2219916 CAGTGGAGGGCCCAGGAGGGAGG + Intronic
1092151573 12:6252517-6252539 CTTTGGAAGGCCCAGGTGGGTGG - Intergenic
1092269019 12:7007292-7007314 CTTTGGAAAGCCAAGGTGGGTGG - Intronic
1092307557 12:7317143-7317165 CTCTGAAGAGCACAGCTGTGTGG + Exonic
1092928204 12:13291307-13291329 CTGGGGGGTGCCCAGGTCTGTGG + Intergenic
1093522545 12:20067337-20067359 ATCTGGGGAGCCCAGGTGAGTGG + Intergenic
1093994403 12:25625859-25625881 CTGTGTACAGCCCAGGTGGCAGG - Intronic
1094181570 12:27597395-27597417 CTTTGGGGAGCCGAGGTGGGTGG - Intronic
1094205586 12:27837215-27837237 CTTTGGAGGGCCGAGGTGAGTGG - Intergenic
1094495618 12:30987619-30987641 CTGCGGGGAGCCCAGGCCTGGGG - Intronic
1095352233 12:41227419-41227441 CTTTGGAAAGCCGAGGTGGGAGG + Intronic
1095740294 12:45599334-45599356 CTTTGGGAAGCCCAGGTGGGAGG + Intergenic
1096272317 12:50175118-50175140 CTTTGGAAAGCCGAGGTGGGTGG + Intergenic
1096380027 12:51148779-51148801 CTTTGGAAAGCCGAGGTGGGCGG + Intronic
1096415049 12:51405637-51405659 CTTTGGAAGGCCCAGGTGGGAGG - Intronic
1096452832 12:51758679-51758701 CTTTGGAATGCCCAGGTGGGTGG - Intronic
1096791368 12:54047217-54047239 CCGCGGAGAGCCCAGCTTTGAGG + Intronic
1097117119 12:56705695-56705717 CTTTGGAAAGCCGAGGTGGGTGG - Intergenic
1097233480 12:57525684-57525706 CGGAGGAGAGCCCAGGTCAGAGG - Exonic
1097742996 12:63267480-63267502 CTGTGCAGAGCTGAGGGGTGGGG + Intergenic
1098912616 12:76225112-76225134 CTGTGGGGACCCAAGGTGGGAGG - Intergenic
1098958139 12:76708871-76708893 CTTTGGAAGGCCCAGGTGGGAGG + Intergenic
1099192709 12:79576163-79576185 CTTTGGAAAGCCAAGGTGGGTGG - Intronic
1100169923 12:91962896-91962918 CTTTGGGGAGCCCAGGCGGGCGG - Intergenic
1100400275 12:94223394-94223416 TTGTATAGAGCCCAGGTTTGGGG - Intronic
1101573509 12:105976796-105976818 CTTTGGGGAGCCGAGGTGAGTGG + Intergenic
1101573835 12:105979687-105979709 CTTTAGAGCGCCCAGGTGGGAGG - Intergenic
1101879511 12:108616854-108616876 CTGTGGAAGGCCAAGGTGGGCGG - Intergenic
1102161435 12:110772169-110772191 CTGTGGGAAGCCAAGGTGGGTGG + Intergenic
1102428031 12:112859865-112859887 CTGTTGAGAGCCACTGTGTGGGG - Intronic
1102692997 12:114776296-114776318 CTTTGGGAAGCCCAGGTGAGTGG + Intergenic
1102799818 12:115722372-115722394 ATGTGCAGAGCTCAGGTGTGTGG - Intergenic
1102982166 12:117250570-117250592 CTGTGGGAGGCCAAGGTGTGTGG - Intronic
1103478181 12:121233556-121233578 CTGTGGAGAGCCCAGGTGTGGGG - Exonic
1103577835 12:121891660-121891682 CTTTGGAAGGCCGAGGTGTGTGG + Intronic
1103611094 12:122124448-122124470 CTGTGAAGAGCCGAGGACTGAGG - Intronic
1103662818 12:122535395-122535417 CTTTGGAAGGCCCAGGTGGGTGG + Intronic
1104033090 12:125079213-125079235 CGGTGGTGAGTCCAGGAGTGTGG + Intronic
1104311529 12:127657827-127657849 GTGGGTAGAGGCCAGGTGTGGGG - Intergenic
1104430734 12:128713942-128713964 CAGTGGAGAGCCCAGGGTTCTGG - Intergenic
1104434819 12:128747547-128747569 CTGTGGAGTTCGCAGGTGCGTGG - Intergenic
1104567257 12:129896229-129896251 CTTTGGGGGGCCCAGGTGGGAGG - Intronic
1104712270 12:130995254-130995276 CTCTGCGGAGCCCAGGTGTGGGG + Intronic
1104895965 12:132163753-132163775 CTGTGCAGAGCCAGGATGTGTGG + Intergenic
1104944213 12:132408436-132408458 CTGGGCAGAGACCAGGTGAGGGG - Intergenic
1106058674 13:26263988-26264010 CTTTGGGGGGCCCAGGTGGGCGG - Intronic
1106236381 13:27864314-27864336 CTTTGGAAGGCCCAGGTGGGAGG - Intergenic
1106954261 13:34918296-34918318 CTTTGGAAAGCCAAGGTGGGTGG + Intergenic
1107241692 13:38242855-38242877 CTCTGGGAAGCCCAGGTGGGAGG + Intergenic
1107428655 13:40318682-40318704 CTGGGGAGAGACCAGAGGTGAGG - Intergenic
1107435420 13:40376903-40376925 CTGTGGAGAGCCGTGTGGTGGGG - Intergenic
1107724706 13:43286993-43287015 CTCTGGAAAGCCATGGTGTGGGG + Intronic
1107902941 13:45035919-45035941 CTTTGGAGGGCCAAGGTGGGAGG + Intronic
1108016784 13:46085091-46085113 CTTTGGAGGGCCGAGGTGGGCGG - Intronic
1108408503 13:50126133-50126155 CTGGGGAGGGCAGAGGTGTGAGG + Intronic
1108974331 13:56419062-56419084 CTTTGGAAGGCCCAGGTGGGTGG - Intergenic
1109578833 13:64298871-64298893 CTTTGGAAGGCCCAGGTGGGAGG + Intergenic
1109917432 13:69009175-69009197 CTTTGGAAGGCCCAGGTGGGTGG - Intergenic
1110223267 13:73094756-73094778 CTTTGGAAGGCCCAGGTGGGAGG - Intergenic
1110240692 13:73263031-73263053 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1110561330 13:76913373-76913395 CTTTGGGAAGCCAAGGTGTGAGG + Intergenic
1111086110 13:83377235-83377257 CTGTGGTCAGCCCATATGTGTGG + Intergenic
1111223627 13:85240050-85240072 CTGTGGGAAGCCGAGGTGGGAGG - Intergenic
1112335395 13:98511105-98511127 CTTTGGAAAGCCGAGGTGGGAGG - Intronic
1112565091 13:100545707-100545729 GAGTGGAGAGCCCAGGAGTGTGG + Intronic
1114452297 14:22835341-22835363 CTGTGGAGCCTCCAGGTTTGTGG - Intergenic
1114632575 14:24168832-24168854 CTTTGGAAGGCCCAGGTGGGTGG + Intergenic
1116368815 14:44104332-44104354 CTGTGGCGATCACAGCTGTGTGG - Intergenic
1117213737 14:53528246-53528268 CTGAGCAGAGCCCAGCTGTGTGG + Intergenic
1117418749 14:55523000-55523022 CTTTGGGAAGCCCAGGTGGGCGG + Intergenic
1118348292 14:64955609-64955631 CTGCTGAGAGCACAGGGGTGGGG - Intronic
1118349253 14:64961662-64961684 CTTTGGGAAGCCAAGGTGTGAGG + Intronic
1118405831 14:65422749-65422771 CTCTGGAAGGCCCAGGTGGGAGG - Intronic
1118730564 14:68663055-68663077 CTGTGGGAAGCCAAGGTGGGTGG + Intronic
1119385253 14:74254119-74254141 GTGGGGAGAGGCCAGGCGTGGGG + Intronic
1119441353 14:74630900-74630922 CTGTGGAGGGGCCAGGTGTAGGG + Intergenic
1119473729 14:74914953-74914975 CTTTGGGGAGCCAAGGTGGGTGG - Intronic
1120762306 14:88296029-88296051 CTGTGTATAGCCCAGGTGCATGG - Intronic
1120981978 14:90298332-90298354 CAGTGGAGAGCCCCGGGCTGGGG - Exonic
1121091221 14:91184088-91184110 CCGTGGAGAGCTGAGGGGTGAGG + Intronic
1121141431 14:91545803-91545825 CTTTGGGGAACCAAGGTGTGAGG - Intergenic
1121261331 14:92568578-92568600 GTGGGCAGAGCCCAGGTCTGTGG - Intronic
1122378325 14:101283963-101283985 CTGTGGGAAGCCAAGGTGGGTGG - Intergenic
1123162626 14:106293943-106293965 CTGAGGAAGGCACAGGTGTGGGG + Intergenic
1123973371 15:25529583-25529605 CTGTGGCAAGGCCAGGTGTGGGG + Intergenic
1124028573 15:25989360-25989382 TTGTGGAGAGTCCATGTCTGGGG + Intergenic
1124067187 15:26355176-26355198 CTGGGGAGGACCCAGGTGAGGGG - Intergenic
1125473197 15:40024639-40024661 CTTTGGGGAGCCGAGGTGGGTGG - Intronic
1125669703 15:41461846-41461868 CTTTGGAAAGCCGAGGTGGGTGG - Intronic
1125791223 15:42367244-42367266 GTGTGGAAAGCACAGGAGTGTGG + Intronic
1128155450 15:65388967-65388989 GTGTGGAGGGCCCTGGGGTGCGG + Exonic
1128561516 15:68671700-68671722 CTATGGAGAGACCAGGTGTGAGG - Intronic
1128647876 15:69390257-69390279 CTTTGGAGGGCCAAGGTGGGTGG - Intronic
1129244278 15:74270271-74270293 CTGGCGAGGGCCCAGGAGTGAGG - Intronic
1129317572 15:74754692-74754714 CTGTTGAGAACACAAGTGTGAGG - Intronic
1129387658 15:75204751-75204773 CTTTGGGAAGCCGAGGTGTGCGG - Intronic
1129538779 15:76334869-76334891 CTGTGGGAAGCCGAGGTGGGCGG + Intergenic
1129580063 15:76799504-76799526 CTTTGGGGAGCCGAGGTGGGAGG - Intronic
1129787432 15:78319064-78319086 CTGTGGTGAGCACTGCTGTGGGG + Intergenic
1129995647 15:80002987-80003009 CTTTGGGAAGCCCAGGTGGGCGG + Intergenic
1130615217 15:85400040-85400062 CTTTGGGAAGCCCAGGTGGGAGG - Intronic
1130788319 15:87124293-87124315 CTGTGCAGAGCTCAACTGTGCGG - Intergenic
1130904153 15:88228173-88228195 CAGTGGGGAGCCCAGGAGAGAGG - Intronic
1130906269 15:88242804-88242826 CTGTGGGGTGCCCAGGTGTCTGG - Intronic
1131285093 15:91050322-91050344 CTTTGGGGAGCCGAGGTGGGAGG - Intergenic
1132080209 15:98857460-98857482 CTTTGGAAAGCCGAGGTGGGTGG - Intronic
1132161027 15:99542881-99542903 CTGTGGAGAGGGGAGGAGTGGGG + Intergenic
1132297196 15:100748317-100748339 CTGTGGACACCCAAGCTGTGGGG + Intergenic
1132538647 16:496726-496748 CTGTGGAGATACGAGGTGGGCGG - Intronic
1132579484 16:678471-678493 GTGTGGTCAGGCCAGGTGTGTGG + Intronic
1132618077 16:852129-852151 CTGTGGAGAGTTCAGACGTGAGG + Intergenic
1133095470 16:3442308-3442330 CTTTGGGGAGCCGAGGTGGGAGG + Intronic
1133390612 16:5407255-5407277 CTGAGGAGAGACCTGGTGGGAGG - Intergenic
1133508143 16:6432210-6432232 CTTTGGGAAGCCCAGGTGGGAGG - Intronic
1133660598 16:7913021-7913043 CTGTGGGGGGCCAAGGTGGGAGG + Intergenic
1133815837 16:9196765-9196787 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1134185830 16:12084385-12084407 CTTTGGAAAGCCGAGGTGGGCGG - Intronic
1134630735 16:15753960-15753982 CTGTGGAAGGCCAAGGTGGGTGG + Intronic
1135232110 16:20718356-20718378 CTCTGAAGAGCACAGCTGTGTGG + Intronic
1135494358 16:22938594-22938616 CTTTGGAGGGCTGAGGTGTGAGG - Intergenic
1135545909 16:23366488-23366510 CTTTGGGAAGCCAAGGTGTGGGG + Intronic
1135734884 16:24922918-24922940 CTTTGGGGAGCCGAGGTGGGAGG - Intronic
1135741153 16:24976281-24976303 CTTTGGAAGGCCCAGGTGGGAGG + Intronic
1136007200 16:27339096-27339118 CTTTGGGGAGCCAAGGTGGGTGG - Intronic
1136461128 16:30410774-30410796 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1136558844 16:31026207-31026229 CTTTGGGAAGCCCAGGTGGGAGG + Intergenic
1137404051 16:48176261-48176283 CTCTGGGGTGCCCAGGAGTGGGG + Intronic
1137861298 16:51849382-51849404 CTGTCAAGAGCCCTGGTATGTGG + Intergenic
1138231723 16:55342448-55342470 CTGTGGAAAGCCAAGGTGGGAGG + Intergenic
1138560580 16:57798536-57798558 CTGGGAAGGGCTCAGGTGTGGGG - Intronic
1139018168 16:62715126-62715148 CTTTGGGAAGCCAAGGTGTGAGG - Intergenic
1139130858 16:64142877-64142899 CTTTGGGAAGCCAAGGTGTGCGG - Intergenic
1139374751 16:66489969-66489991 CTGTGACGAGCCCAGGTCTGAGG + Intronic
1139417062 16:66821130-66821152 CTGTGGAGAGCTAAGGAATGTGG - Intronic
1139726561 16:68904853-68904875 CTTTGGAAGGCCAAGGTGTGAGG + Intronic
1140378373 16:74463816-74463838 CTTTGGGAAGCCCAGGTGGGTGG - Intronic
1140456046 16:75106177-75106199 CTGTGCAGAGCCCAGGAGAATGG - Intronic
1140862598 16:79031242-79031264 CCCTGCAGAGCCCACGTGTGGGG + Intronic
1140926418 16:79588703-79588725 CTGTGGGAGGCCCAGGTGAGCGG - Intronic
1141126785 16:81406550-81406572 CTTTGGAAAGCCGAGGTGGGGGG - Intergenic
1141462062 16:84183532-84183554 CTGGGGAGGGCACAGGAGTGCGG + Intronic
1141626622 16:85264771-85264793 CTGTGGAGACCCCTGGTGTCAGG + Intergenic
1141641558 16:85344484-85344506 ATGTGTAGAGGACAGGTGTGCGG + Intergenic
1141681033 16:85544076-85544098 CTGTGGGAAGCCGAGGTGGGTGG - Intergenic
1142448068 16:90155643-90155665 CTGTGGGGGGCCAAGGTGAGAGG - Intergenic
1142459420 17:79681-79703 CTGTGGGGGGCCAAGGTGAGAGG + Intergenic
1142585604 17:971187-971209 CTGTGGGAAGCCGAGGTGGGCGG - Intronic
1142586541 17:978520-978542 CTGTGCAGAGCTCAGCTGCGTGG - Intronic
1142886476 17:2915476-2915498 CTTTGGAAAGCCAAGGTGGGCGG - Intronic
1143337538 17:6184407-6184429 CTTTGGGAAGCCCAGGTGGGTGG + Intergenic
1143748054 17:9007984-9008006 CTTTGGGGAGCCGAGGTGGGAGG - Intergenic
1144763244 17:17719142-17719164 CTGTGAAGAGGGCAGATGTGGGG - Intronic
1144967402 17:19086588-19086610 CTTTGGGGGGCCAAGGTGTGTGG + Intergenic
1144980517 17:19165478-19165500 CTTTGGGGGGCCAAGGTGTGTGG - Intergenic
1144987705 17:19212755-19212777 CTTTGGGGGGCCAAGGTGTGTGG + Intergenic
1145031625 17:19508534-19508556 CAGGTGAGAGCCCAGGTGAGTGG - Intronic
1145829435 17:27903616-27903638 CTTTGGAAAGCCGAGGTGGGAGG + Intergenic
1145883922 17:28369902-28369924 GTGTTCAGAGCCCAGGTGGGTGG - Intronic
1145886749 17:28387465-28387487 CTGTGGGGGGCCAAGGTGGGTGG - Intronic
1146108207 17:30062528-30062550 CTGGGGAGAGCACAGGTATGTGG - Intronic
1146156521 17:30528910-30528932 CTTTGGAAAGCCGAGGTGGGCGG - Intergenic
1146576804 17:34001369-34001391 GTGTGGACAGGCCTGGTGTGTGG + Intronic
1146682357 17:34817249-34817271 CTTTGGAAAGCCAAGGTGGGAGG + Intergenic
1147139514 17:38453571-38453593 CTGTGTAGTGCCCTGGCGTGTGG + Intronic
1147536849 17:41327158-41327180 CTGTCCAGGGCCCAGGTTTGGGG - Intergenic
1147681445 17:42249903-42249925 CTTTGGAGGGCCGAGGTGGGTGG - Intronic
1147812820 17:43185328-43185350 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
1147868853 17:43573006-43573028 CTTTGGGAAGCCCAGGTGGGCGG + Intronic
1147869833 17:43579284-43579306 CTGAAGAGAGCCCAGGTAAGGGG - Intronic
1148040217 17:44700732-44700754 CTTTGGGGAGCCGAGGTGGGTGG - Intergenic
1148429134 17:47627586-47627608 CTTTGGAAAGCCGAGGTGGGTGG + Intergenic
1148515293 17:48211196-48211218 CTTTGGAGGGCCAAGGTGGGAGG + Intronic
1148970992 17:51481514-51481536 CTGTGGACTGCCAGGGTGTGTGG + Intergenic
1149232901 17:54555471-54555493 CTGGAGAGAGCACAGCTGTGTGG + Intergenic
1150105175 17:62457435-62457457 CTTTGGGGGGCCAAGGTGTGAGG + Intergenic
1150362651 17:64550534-64550556 CTGTGGAAGGCCGAGGTGGGTGG + Intronic
1150529255 17:65959550-65959572 CTCGGGAGCGCCCAGGTCTGGGG - Intronic
1152022008 17:77784874-77784896 CTCTGGGAAGCCCAGGTGGGCGG - Intergenic
1152294545 17:79459099-79459121 CTGTGGAGTGCCTAGGGGAGGGG - Intronic
1152612441 17:81322462-81322484 CACTGGAGAGTCCAGGTGTGAGG - Intronic
1152675028 17:81635648-81635670 CTTTGGGAAGCCCAGGTGGGTGG - Intronic
1152911899 17:83009983-83010005 CTGTGGAGGCCCCTGGTGTTGGG + Intronic
1152911913 17:83010009-83010031 CTGTGGGGGCCCCTGGTGTGGGG + Intronic
1152911939 17:83010059-83010081 CTGTGGGGGCCCCTGGTGTGTGG + Intronic
1153504696 18:5784539-5784561 CTTTGGACAGCCAAGGTGGGAGG - Intergenic
1154008526 18:10556289-10556311 CTGGGGAGTGCCCAGGCATGGGG - Intergenic
1154078906 18:11234820-11234842 CTGTGGAGAGCCCAGAGCTGTGG - Intergenic
1154296103 18:13150141-13150163 CTATGGAGAGACCAGCTGGGAGG - Intergenic
1154356582 18:13626436-13626458 GTGTGGACAGCCCAGGGGTAGGG + Intronic
1154368469 18:13733619-13733641 CTGTGGGAGGCCCAGGTGGGAGG - Intronic
1154939023 18:21092336-21092358 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1155046225 18:22105707-22105729 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1155227843 18:23745424-23745446 TTCTAGAGAGCCCAGGGGTGGGG - Intronic
1155306977 18:24488134-24488156 GCGTGGAGAGGGCAGGTGTGGGG - Intergenic
1156513570 18:37661403-37661425 GAGTGGAGAGCCTAGGTGGGAGG - Intergenic
1157559081 18:48633456-48633478 CTGTGGGAAGCCAAGGTGGGTGG + Intronic
1157722295 18:49934571-49934593 CTGTGCAGGGCCCAGGGGAGAGG - Intronic
1158113175 18:53964359-53964381 CTATGGAGAGCCAAGGTTTAAGG + Intergenic
1158798329 18:60875727-60875749 CTGTGGGAAGCCGAGGTGGGCGG + Intergenic
1159953774 18:74505353-74505375 CTTTGGAAAGCCGAGGTGGGTGG + Intronic
1160141519 18:76327854-76327876 CTGGGGAAAGCACAGCTGTGTGG - Intergenic
1160415795 18:78709807-78709829 CTGTCCAGCCCCCAGGTGTGAGG + Intergenic
1160649136 19:212188-212210 CTGTGGGGGGCCAAGGTGAGAGG + Intergenic
1160663904 19:313950-313972 CTGTGGACAGCCTAGATCTGGGG + Intronic
1160822649 19:1065751-1065773 CTGTGGCCAGCCCAGGAGTTGGG + Intergenic
1160886713 19:1353285-1353307 CTTTGGGGAGCCGAGGTGGGAGG + Intergenic
1161066492 19:2241021-2241043 CTGTGGAGAGTGCAGGCTTGGGG + Intronic
1161536899 19:4825034-4825056 CTTTGGAAGGCCGAGGTGTGTGG + Intronic
1161810349 19:6467794-6467816 CAGTGGAGAGCCAGGGAGTGGGG + Exonic
1162201433 19:9023473-9023495 CTTTGGAGAGCCGAGGTGGGAGG + Intergenic
1162516134 19:11148988-11149010 CTTTGGGAAGCCCAGGTGGGAGG - Intronic
1162724682 19:12682932-12682954 CTTTGGAAAGCCCAGGCGGGCGG - Intergenic
1162834485 19:13307475-13307497 CTTTGGGAAGCCCAGGTGGGCGG - Intronic
1162905452 19:13820477-13820499 CTTTGGAAAGCCAAGGTGGGCGG - Intronic
1162908676 19:13838029-13838051 CTTTGGAAAGCCGAGGTGGGCGG - Intergenic
1163130420 19:15269125-15269147 CTGTGGAGCAGCCAGGGGTGAGG - Intronic
1164565785 19:29324869-29324891 GTGGGGATAGCCCAGATGTGTGG + Intergenic
1164789850 19:30966836-30966858 CTTTGGAAAGCCTAGGTGGGAGG - Intergenic
1165009357 19:32832666-32832688 CTTTGGAGAGCCAAGGTGGAAGG + Intronic
1165081180 19:33307205-33307227 CTTTGGAAAGCCGAGGTGGGAGG - Intergenic
1165310620 19:35027549-35027571 ATGTGGAGACCCCAGGGGTCAGG - Intergenic
1165331530 19:35143222-35143244 CTGGGGGGAGCCCTGGCGTGGGG - Intergenic
1165722312 19:38088251-38088273 AGGGGCAGAGCCCAGGTGTGAGG + Intronic
1165754470 19:38284336-38284358 CTTTGGAAGGCCCAGGTGGGAGG - Intronic
1165758861 19:38309164-38309186 CTGTGGGGGGCTCAGGGGTGGGG - Intronic
1165787579 19:38471283-38471305 CTGTGGGAAGCCAAGGTGGGAGG + Intronic
1165791028 19:38492653-38492675 CTGGGGAGAGGGCAGGGGTGGGG + Intronic
1165908082 19:39205861-39205883 CTTTGGAAGGCCCAGGTGAGTGG + Intergenic
1165921878 19:39304131-39304153 CTATGGAGACCCCAGCTTTGGGG - Intergenic
1166038056 19:40183711-40183733 CTTTGGAAAGCCAAGGTGGGCGG + Intergenic
1166087835 19:40488545-40488567 CTTTGGGGAGCCAAGGTGGGAGG + Intronic
1166284942 19:41819768-41819790 GTTTGGAGAGCCGAGGTGAGTGG - Intergenic
1166293738 19:41878967-41878989 CTGTGGAGAGACAGGGTGGGTGG - Intronic
1166470926 19:43079094-43079116 CTGGGGAAGGCCTAGGTGTGAGG + Intronic
1166527192 19:43519253-43519275 CTTTGGGAAGCCGAGGTGTGCGG - Intronic
1166694363 19:44844485-44844507 GGGAGGAAAGCCCAGGTGTGTGG + Intergenic
1166731772 19:45063248-45063270 CTTTGGAAGGCCCAGGTGGGAGG - Intronic
1166787743 19:45379274-45379296 CTTTGGAAGGCCGAGGTGTGTGG + Intergenic
1167105275 19:47426763-47426785 CTCTGGAGAGTCCTGATGTGAGG - Intergenic
1167262782 19:48468417-48468439 CTTTGGAGGGCCAAGGTGGGCGG + Intronic
1167377061 19:49118035-49118057 CCGTGGAGGCCCCAGGGGTGTGG - Intronic
1167492022 19:49798557-49798579 AGGAGGAGAGCCCAGGTCTGGGG + Intronic
1167827296 19:51985761-51985783 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
1167938892 19:52930428-52930450 CTTTGGGGAGCCAAGGCGTGTGG - Intronic
1167998467 19:53425854-53425876 CTTTGGAAAGCCAAGGTGGGTGG + Intronic
1168084233 19:54033619-54033641 CTTTGGGAAGCCCAGGTGGGCGG - Intergenic
1168103342 19:54152720-54152742 CAGTGGAGAGCCCAAGTCAGGGG - Intronic
1168138788 19:54370446-54370468 CTGTGGAGAGACCAGGTCCTCGG + Intronic
1168159235 19:54498051-54498073 CTGTGGAGAGACCAGGTCCTCGG - Intronic
1168404060 19:56101801-56101823 CTGTGGAAATCTCAAGTGTGTGG - Intronic
1168532862 19:57143631-57143653 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1168603870 19:57742614-57742636 CTTTGGAGAGCCGAGGTGGATGG + Intronic
925046827 2:778582-778604 CAGGGGAGAGCCGAGGGGTGTGG + Intergenic
925097718 2:1220489-1220511 CCCTGGAGAGCCCCGGTCTGAGG + Intronic
925834728 2:7933326-7933348 CTGTGGGGTGCCCAGCTCTGAGG + Intergenic
926335337 2:11858573-11858595 CTGTGGAGACCCCAGGCCTGAGG - Intergenic
926665393 2:15516477-15516499 CTTTGGGAAGCCCAGGTGGGTGG + Intronic
927958998 2:27228478-27228500 CTTTGGAAAGCTCAGGTGGGAGG + Intronic
928178171 2:29049242-29049264 CTGTGGGGGTCCCAGGTGGGTGG - Intronic
928965952 2:36975517-36975539 CTTTGGGAAGCCGAGGTGTGAGG + Intronic
929164515 2:38867799-38867821 CTTTGGGAGGCCCAGGTGTGTGG - Intronic
929442274 2:41973481-41973503 GTTTGCAGCGCCCAGGTGTGGGG + Intergenic
929935926 2:46294714-46294736 CTCTGGGAAGCCCAGGTGGGTGG + Intronic
930065917 2:47327501-47327523 CTTTGGAGAGCCGAGGCGGGTGG + Intergenic
930953643 2:57176649-57176671 CTTTGGAAGGCCGAGGTGTGTGG - Intergenic
931378690 2:61731942-61731964 CAGTGGAGATGCCAGGTGAGAGG + Intergenic
931492562 2:62764642-62764664 CTGTGGAAAGCTGAGGAGTGTGG + Intronic
932373877 2:71217384-71217406 CTGTGGGAGGCCCAGGTGGGTGG - Intronic
932630403 2:73337638-73337660 CTGTGGAGGGCCATGGTGGGAGG + Intergenic
934568667 2:95354501-95354523 CTGGGGACAGCAGAGGTGTGAGG + Intronic
934587234 2:95512393-95512415 CTGTGGGAGGCCCAGGTGGGTGG - Intergenic
934657584 2:96124108-96124130 CTGGGGAGAGCCCACATGGGTGG - Exonic
934737933 2:96699352-96699374 CTTTGGATAGGCCTGGTGTGGGG - Intergenic
935195270 2:100810178-100810200 CTGGGGAGAGCCCAGCCCTGTGG - Intergenic
936174462 2:110207512-110207534 CTTTGGGGAGCCGAGGTGGGTGG + Intergenic
936233178 2:110721962-110721984 CTGTTGAGAGGCCTGGTTTGTGG + Intergenic
936242157 2:110797134-110797156 CTGGGGAGAGCCAAGAAGTGAGG + Intronic
936251371 2:110870685-110870707 CAGGTGAGAGTCCAGGTGTGGGG - Intronic
937914693 2:127093076-127093098 CTGTGGACAGCCCTAGCGTGGGG - Intronic
938210597 2:129463304-129463326 CTTTGGAAGGCCCAGGTGGGTGG + Intergenic
938308601 2:130270222-130270244 GTGTGGGGAGCCCAGGAGTGGGG + Intergenic
938446731 2:131386615-131386637 GTGTGGGGAGCCCAGGAGTTGGG - Intergenic
938804545 2:134793938-134793960 CTTTGGGAAGCCCAGGTGGGTGG - Intergenic
938968269 2:136407567-136407589 CAGTGCTGAGCCCTGGTGTGGGG + Intergenic
941078434 2:161032838-161032860 CTTTGGGAGGCCCAGGTGTGTGG + Intergenic
941892107 2:170593344-170593366 CTTTGGAAAGCCAAGGTGGGAGG - Intronic
941908432 2:170739159-170739181 CTGTGGTCAGCACAGATGTGAGG + Intergenic
942245704 2:174005952-174005974 CTTTGGAAGGCCAAGGTGTGTGG - Intergenic
942338464 2:174916946-174916968 CTTTGGAAAGCCGAGGTGGGTGG + Intronic
942537320 2:176978595-176978617 CTTTGGGAAGCCCAGGTGGGAGG + Intergenic
942788979 2:179736724-179736746 CTTTGGAAGGCCCAGGTGGGTGG + Intronic
942904361 2:181163220-181163242 CTGTGGAGGGCTGAGGTGGGTGG + Intergenic
943534608 2:189132675-189132697 CTTTGGAAAGCCGAGGTGGGTGG + Intronic
944780889 2:203015338-203015360 AGGTGGAGAGGCCAGGTGGGCGG + Intronic
944783897 2:203048138-203048160 CTTTGGAGGGCCAAGGTGGGTGG + Intronic
945299068 2:208199292-208199314 CTTTGGGAAGCCCAGGTGGGAGG - Intergenic
946314020 2:218897719-218897741 CTGGGGAGCGGCCAGGGGTGGGG + Intronic
946440118 2:219687982-219688004 CTTTGGAAAGCCGAGGTGGGCGG - Intergenic
946837639 2:223788188-223788210 CTTTGGGAAGCCCAGGTGGGTGG - Intronic
947715373 2:232336446-232336468 CTGTGCAGAGCCCAGCCGTGAGG - Intronic
947734413 2:232447244-232447266 CTGTGCAGAGCCCGGCAGTGAGG - Intergenic
947833169 2:233156238-233156260 CTGGGCAGGGGCCAGGTGTGTGG + Intronic
948373551 2:237505559-237505581 CTGGGGAGAGCCCAGGATGGCGG - Intronic
948543378 2:238705597-238705619 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
1168781125 20:491421-491443 CTTTGGGGAGCCAAGGTGTGAGG + Intronic
1168831930 20:850379-850401 CTGTGGGAAGCCAAGGTGGGTGG - Intronic
1169277681 20:4244556-4244578 GTGTGGAGGTACCAGGTGTGTGG - Intronic
1169728029 20:8757142-8757164 CTGTGGAGAGCCTGGGAGGGTGG - Exonic
1169750383 20:8986541-8986563 CTTTGGGAAGCCCAGGTGGGTGG - Intergenic
1172339881 20:34148362-34148384 CTTTGGAAAGCCGAGGTGGGTGG - Intergenic
1172368333 20:34366599-34366621 CTGTTGAGATTACAGGTGTGAGG - Intronic
1172664855 20:36591966-36591988 CAGTAGTTAGCCCAGGTGTGGGG + Exonic
1172955460 20:38754830-38754852 CTTTGGGGAGCCGAGGTGGGCGG - Intronic
1173605449 20:44327801-44327823 CTTTGGGAAGCCAAGGTGTGCGG - Intergenic
1173842870 20:46169938-46169960 CTGTGCAGAGCCGTGGCGTGTGG + Intergenic
1173971733 20:47158269-47158291 CTTTGGAAGGCCCAGGTGGGTGG + Intronic
1174132042 20:48352039-48352061 CTTTGGAGGGCCAAGGTGAGAGG - Intergenic
1174256772 20:49262169-49262191 CTTTGGAGAGCCGAGGTGGGCGG + Intronic
1174345397 20:49925348-49925370 CTTTGGGAAGCCAAGGTGTGTGG + Intergenic
1174561107 20:51431463-51431485 CTGTGGTGAGCCCAGCTGATGGG - Intronic
1174565844 20:51463963-51463985 TTTTGGAGAGCCCAGGATTGGGG - Intronic
1175325119 20:58120221-58120243 CTTTGGAAAGCCAAGGTGGGAGG + Intergenic
1175351617 20:58325233-58325255 CTTTGGAAGGCCCAGGTGGGCGG + Intronic
1175668815 20:60883390-60883412 CTCTGGAGACCCTGGGTGTGTGG - Intergenic
1176037712 20:63048480-63048502 TTGTGGAAACCCCAGGAGTGAGG - Intergenic
1176192748 20:63820673-63820695 CTTTGGAAGGCCCAGGTGGGCGG - Intronic
1176292015 21:5050969-5050991 CTGGGGACAGCCCGGGAGTGAGG - Intergenic
1176956132 21:15106174-15106196 CTTTGGAGGGCCAAGGTGGGTGG - Intergenic
1177140414 21:17352494-17352516 CTTTGGGAAGCCCAGGTGGGCGG + Intergenic
1178207652 21:30487898-30487920 CTTTGGGAAGCCAAGGTGTGTGG - Intronic
1178571488 21:33741647-33741669 CTTTGGGGGGCCCAGGTGGGCGG + Intronic
1178603990 21:34019168-34019190 GTGAGGACAGGCCAGGTGTGTGG - Intergenic
1178897620 21:36572389-36572411 CTCTGCGGAGTCCAGGTGTGGGG + Intronic
1179402036 21:41093373-41093395 CTTTGGAAAGCCGAGGTGGGAGG + Intergenic
1179430416 21:41317257-41317279 GCGTGGAGAGCCCGGGTGGGGGG - Intronic
1179792594 21:43764233-43764255 CTGTGGCGTGTCCAGGGGTGGGG + Intergenic
1179865242 21:44212676-44212698 CTGGGGACAGCCCGGGAGTGAGG + Intergenic
1180594103 22:16962478-16962500 CTGTTGGGAGCCCGGGTCTGAGG + Exonic
1180625403 22:17190681-17190703 CTGGGGAGAGGCCATGGGTGGGG - Intronic
1181027971 22:20136457-20136479 CTGTGGATAGGGCAAGTGTGAGG - Intronic
1181135813 22:20765577-20765599 CTGTGGAGGGCTCAGGTAGGGGG - Exonic
1181180557 22:21065193-21065215 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1181284924 22:21745040-21745062 CTGAGGAGACCACAGGTATGTGG - Intergenic
1181521343 22:23450324-23450346 CTGTGCAGAGCCCAGCTGTGAGG + Intergenic
1181664576 22:24383894-24383916 CTTTGGGGGGCCCAGGTGGGCGG - Intronic
1182164828 22:28162703-28162725 CTTTGGAAAGCCGAGGTGGGAGG + Intronic
1182490635 22:30669075-30669097 CTATGCATAGCCTAGGTGTGAGG - Intergenic
1182499409 22:30734945-30734967 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1182764446 22:32748681-32748703 CTGGGGACAGCGCAGTTGTGGGG + Intronic
1183488225 22:38101608-38101630 CTTTGGAAGGCCAAGGTGTGTGG + Intronic
1183699530 22:39443099-39443121 CTTTGGAAAGCCAAGGTGAGTGG + Intergenic
1183720605 22:39559539-39559561 CTGAGCAGAGACCAGGTCTGGGG + Intergenic
1184087370 22:42272916-42272938 CTTTGGGAAGCCGAGGTGTGAGG + Intronic
1184296865 22:43530469-43530491 TGCAGGAGAGCCCAGGTGTGGGG + Intronic
1184490528 22:44805987-44806009 CTGGGGAGAGCCCAGCGCTGGGG + Intronic
1184676998 22:46048948-46048970 CTGTGGAAAGCTGAGGTGGGTGG - Intergenic
1185219898 22:49624019-49624041 CTGGGGAGAGGCCAGGAGAGTGG - Intronic
1185358640 22:50391188-50391210 CTGTGGGGGGCCTAGGTGGGCGG + Intronic
1185407258 22:50660041-50660063 CTGTGGGAAGCCAAGGTGGGCGG + Intergenic
949094250 3:67055-67077 CTGTGGGAGGCCCAGGTGAGAGG - Intergenic
949241602 3:1879674-1879696 CTTTGGAAAGCCGAGGTGGGTGG - Intergenic
949708671 3:6848314-6848336 CTGTGGGAAGCTCAGGTGGGAGG + Intronic
949708769 3:6850014-6850036 CTGTGGGAGGCCCAGGTGGGAGG + Intronic
949721284 3:6993236-6993258 TTGTGGAGGGACCTGGTGTGAGG - Intronic
950360621 3:12446951-12446973 CTTTGGATGGCCCAGGTGGGTGG + Intergenic
950570063 3:13794169-13794191 CTGTAGAGAGCCCAGGTCCTGGG + Intergenic
950774064 3:15334705-15334727 CTTTGGAAAGCCAAGGTGGGTGG + Intronic
951333300 3:21391352-21391374 CTTTGGAAGGCCCAGGTGGGTGG + Intergenic
952232395 3:31445500-31445522 CTTTGGGAGGCCCAGGTGTGTGG + Intergenic
952438087 3:33293097-33293119 CTTTGGAGGGCCAAGGTGGGAGG - Intronic
952451227 3:33434926-33434948 CTTTGGAGGGCCAAGGTGGGCGG - Intronic
953530027 3:43732185-43732207 CTGTGGAAGGCCGAGGTGGGTGG + Intronic
953888781 3:46735219-46735241 CTTTGGAAAGCCCAGGAGGGAGG + Intronic
953936711 3:47050974-47050996 CTTTGGGAAGCCGAGGTGTGGGG - Intronic
953942132 3:47109400-47109422 CTTTGGAAAGCCAAGGTGAGAGG + Intronic
953946960 3:47157628-47157650 CTTTGGGAAGCCCAGGTGGGTGG + Intronic
954152903 3:48667109-48667131 CTTTGGAGGGCCAAGGTGGGTGG + Intergenic
954345783 3:49997566-49997588 CAATGGAGTACCCAGGTGTGTGG - Intronic
954404014 3:50335189-50335211 CTTTGGAAAGCCGAGGTGGGTGG - Intronic
954437174 3:50502606-50502628 CCCTGGAGAGCCCAGTTGGGAGG - Intronic
954447073 3:50552553-50552575 CTTTGAGGAGCCCAGGTTTGGGG + Intergenic
954636083 3:52071595-52071617 CTGGGGAGAGCACAGGCTTGAGG - Intergenic
954863893 3:53712806-53712828 CTGTGGAGAACAGAGGAGTGAGG + Intronic
954964477 3:54598044-54598066 CTTTGGGAAGCCCAGGTGGGTGG + Intronic
955658473 3:61270355-61270377 CTTTGGAAAGCCGAGGTGGGTGG - Intergenic
955679552 3:61486295-61486317 CTTTGGAAAGCCAAGGTGGGGGG - Intergenic
955861346 3:63333659-63333681 CTTTGGAAAGCCAAGGTGAGAGG - Intronic
957422037 3:79982701-79982723 CTTTGGAAAGCCGAGGTGGGAGG - Intergenic
957441594 3:80254958-80254980 CTTTGGGAAGCCCAGGTGGGTGG + Intergenic
958083665 3:88779324-88779346 CTTTGGGAAGCCCAGGAGTGTGG - Intergenic
958514696 3:95098761-95098783 CTTTGGAAAGCCGAGGTGGGTGG - Intergenic
958632065 3:96697575-96697597 CTTTGGAAGGCCCAGGTGGGTGG - Intergenic
958700822 3:97586997-97587019 CTTTGGAAAGCCGAGGTGGGCGG + Intronic
961442392 3:126960726-126960748 CAGAGGGGATCCCAGGTGTGAGG + Intergenic
961582845 3:127897117-127897139 CTTTGGAGAGGCCAGGTAGGAGG + Intergenic
962280739 3:134049875-134049897 CTGTGGGTTGCCCAGGTGAGAGG - Intronic
962311730 3:134331608-134331630 GTCTGGAGAGCCAAGGAGTGGGG - Intergenic
962593762 3:136917988-136918010 CTGGGGACAGGCCAGGTGTCAGG - Intronic
963806417 3:149727487-149727509 CTTTGGAAGGCCCAGGTGGGGGG + Intronic
964233331 3:154496145-154496167 CTGTGGGGAGGGTAGGTGTGTGG + Intergenic
964519411 3:157546975-157546997 CTTTGGAAGGCCCAGGTGGGAGG - Intronic
964625374 3:158753530-158753552 CTTTGGAAAGCCGAGGTGGGAGG - Intronic
964668190 3:159196584-159196606 AAGTGCAGAGCCCAGCTGTGAGG - Intronic
964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
965196593 3:165605260-165605282 CTTTGGGAAGCCAAGGTGTGTGG - Intergenic
965206241 3:165721182-165721204 GTGGGGAGAGGCCAGGCGTGGGG + Intergenic
966281207 3:178231523-178231545 CTTTGGAAAGCCAAGGTGGGCGG - Intergenic
968213197 3:196866822-196866844 CTGTGGGAGGCCCAGGTGGGAGG + Intergenic
968368710 3:198207939-198207961 CTGTGGGGGGCCAAGGTGAGAGG - Intergenic
968515203 4:1012716-1012738 CTGTGGACAGCCCATGGGTGAGG - Intronic
968539113 4:1154125-1154147 CGGTGGGGAGGCTAGGTGTGGGG + Intergenic
968551102 4:1223701-1223723 CTGGGCGGGGCCCAGGTGTGGGG - Intronic
968665567 4:1820177-1820199 CTGTGGGAAGCCGAGGTGGGAGG - Intronic
968870418 4:3239224-3239246 CTGTGGAGGGCCTGGGTGAGGGG + Intronic
969474370 4:7412833-7412855 CCTGGGAGAGCCCAGGGGTGGGG - Intronic
969495884 4:7525924-7525946 CTGAGGAGGGGACAGGTGTGAGG - Intronic
969499232 4:7543071-7543093 CAGTGGACAGCCCAGGTTTTGGG + Intronic
969756371 4:9153013-9153035 CTGGGGAGAGTCCAGGTTGGCGG - Intergenic
971448442 4:26777835-26777857 CTTTGGAAGGCCAAGGTGTGAGG + Intergenic
971558042 4:28038398-28038420 CTTTGGATAGCCGAGGTGGGTGG - Intergenic
971699384 4:29949997-29950019 CTGTGGAAGGCCGAGGTGGGCGG + Intergenic
972065317 4:34935472-34935494 CTTTGGAAAGCCAAGGTGAGAGG - Intergenic
972490389 4:39581804-39581826 CTTTGGAAGGCCCAGGTGTGTGG - Intronic
973913187 4:55604774-55604796 CTTTGGAAGGCCCAGGTGGGTGG - Intronic
974007095 4:56569564-56569586 CTTTGGGAAGCCCAGGTGGGTGG + Intronic
976111825 4:81683615-81683637 CTGTGGAAAGCCTAGGTGAGCGG - Intronic
976292898 4:83439306-83439328 CTTTGGGAAGCCAAGGTGTGCGG - Intronic
976694903 4:87909099-87909121 CTTTGGAAAGCCGAGGTGGGAGG - Intergenic
976945926 4:90767894-90767916 CTTTGGGAGGCCCAGGTGTGTGG - Intronic
977875784 4:102148542-102148564 GTGTGGAGAGCTCAGATGTTGGG - Intergenic
978356272 4:107878155-107878177 CTTTGGGAAGCCCAGGTGGGTGG - Intronic
978409548 4:108411985-108412007 CTGTGGAAAGCACAGCTATGTGG - Intergenic
979257135 4:118617671-118617693 CTGTGGGGGGCCAAGGTGAGAGG - Intergenic
979331212 4:119422871-119422893 CTGTGGGGGGCCAAGGTGAGAGG + Intergenic
979408193 4:120340779-120340801 TTGTGGAGTGTCCATGTGTGTGG + Intergenic
979630662 4:122899120-122899142 CTTTGGGAAGCCCAGGTGGGAGG - Intronic
980094298 4:128473578-128473600 CTTTGGAAAGCCAAGGTGGGAGG + Intergenic
980540918 4:134193728-134193750 TTGTGGAGAGACAAGGTGTTTGG - Intergenic
980911783 4:139000581-139000603 CTTTGGGGAGCCAAGGTGAGAGG + Intergenic
980921235 4:139088041-139088063 CTTTGGGGAGCCTAGGTGGGTGG + Intronic
981398401 4:144281989-144282011 CTGTGGAGAGCCCAGTGGTATGG + Intergenic
981445571 4:144833992-144834014 CTTTGGAAAGCCGAGGTGGGCGG + Intergenic
982203844 4:152982420-152982442 CTGTGGGGAGGCCACCTGTGTGG + Intergenic
982469633 4:155772661-155772683 CTTTGGGAAGCCCAGGTGGGAGG - Intronic
983239414 4:165214642-165214664 CTCTGGAGAACTCAGTTGTGCGG - Intronic
983657385 4:170097349-170097371 CTTTGGAAGGCCGAGGTGTGTGG - Intergenic
983729013 4:170970862-170970884 CTTTGGGGGGCCCAGGTGGGTGG + Intergenic
983892590 4:173046038-173046060 CTGTGGGAAGCCAAGGTGGGAGG + Intergenic
984169536 4:176343724-176343746 CTCTGGAGAGCACAGGTGTTGGG + Intergenic
984701685 4:182822493-182822515 CTGAGGGGAGCGGAGGTGTGGGG - Intergenic
984742268 4:183176664-183176686 CTTTGGTGAGCCAAGGTGGGTGG - Intronic
985556580 5:561581-561603 TGGAGGAGAGCCCGGGTGTGCGG + Intergenic
985755095 5:1709057-1709079 TTGTGGAATGTCCAGGTGTGTGG - Intergenic
985916012 5:2919754-2919776 CTGTGGAGATGCCAGCTGAGTGG + Intergenic
986003868 5:3651363-3651385 CTGTTGAGGGCCCAGGTGCTGGG - Intergenic
986335847 5:6754818-6754840 CTGTGGGTAGCGGAGGTGTGCGG + Exonic
986502893 5:8418801-8418823 CTGTGGGAGGCCGAGGTGTGTGG + Intergenic
986513256 5:8531225-8531247 CTGTGGACAGCCAAGGTGGAAGG - Intergenic
986744314 5:10730790-10730812 CTATTGAGAGCCCTGGTGGGGGG + Intronic
986744323 5:10730822-10730844 CTATTGAGAGCCCTGGTGGGGGG + Intronic
986744359 5:10730986-10731008 CTATTGAGAGCCCTGGTGGGGGG + Intronic
986787162 5:11125119-11125141 TTGTTGAGTGCCCAGGGGTGGGG + Intronic
987099223 5:14577532-14577554 CGCTGGGGAGCCCATGTGTGGGG - Intergenic
987772907 5:22330003-22330025 CTATGGAGACACCAGCTGTGGGG + Intronic
989099896 5:37813804-37813826 CTTTGGAAAGCCAAGGTGGGAGG - Intronic
990524117 5:56608044-56608066 CAGTGTGGAGCTCAGGTGTGGGG - Intergenic
990890257 5:60641119-60641141 CAGTGGAGAGCAAAGATGTGAGG - Intronic
992420354 5:76597609-76597631 CAGAGGAGACCCCAGCTGTGGGG + Intronic
992433004 5:76727994-76728016 CTTTGGGAAGCCCAGGTGGGAGG - Intronic
992777686 5:80102779-80102801 CTGTGGACAGCCCCTGAGTGAGG - Intergenic
993009483 5:82464008-82464030 CTTTGGAAGGCCCAGGTGGGTGG + Intergenic
994493321 5:100476537-100476559 CTTTGGAAGGCCCAGGTGGGAGG + Intergenic
994734894 5:103540472-103540494 CTGTGGAGCGGCCAGGGGTCTGG - Intergenic
995955906 5:117776087-117776109 CTATGGAAAGCCGAGGTGGGAGG + Intergenic
996562487 5:124845710-124845732 CTTTGGAAAGCCGAGGTGGGTGG + Intergenic
997130945 5:131275535-131275557 CTTTGGAAGGCCCAGGTGGGTGG - Intronic
997199513 5:132001354-132001376 GTGTGGAGAGGGCAGGTGTTGGG - Intronic
997322585 5:132990817-132990839 CTTTGGAAGGCCCAGGTGGGTGG + Intergenic
997680729 5:135748960-135748982 CTGTGGGAGGCCCAGGTGGGTGG - Intergenic
998509538 5:142699976-142699998 CTTTGGGAAGCCAAGGTGTGTGG - Intergenic
998537226 5:142945005-142945027 ATGAGGACAGCCCAGGTGAGAGG - Intronic
998574518 5:143299255-143299277 CTTTGGGAAGCCCAGGTGGGTGG - Intronic
999015293 5:148096865-148096887 CTTTGGAAAGCTGAGGTGTGAGG - Intronic
999764209 5:154726081-154726103 CTGTGGAAGGCCAAGGTGGGCGG - Intronic
999850114 5:155528639-155528661 CTGTGGGAGGCCCAGGTGGGTGG - Intergenic
999868274 5:155725774-155725796 CAGAGGAGAGACCAGGTGGGAGG + Intergenic
1000349642 5:160343358-160343380 CTGTGGGAGGCCCAGGTGGGTGG + Intronic
1000606224 5:163330526-163330548 CTGTGGGAGGCCCAGGTGGGTGG + Intergenic
1000611351 5:163378450-163378472 CTGTGGAGAGGCCAGGGCAGAGG - Intergenic
1000731242 5:164836339-164836361 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1000864624 5:166497781-166497803 CTTTGGGGAGCCCAGGTGGGAGG - Intergenic
1001046703 5:168378929-168378951 GTGTGGAGAAAACAGGTGTGTGG + Intronic
1001622508 5:173100217-173100239 CTTTGGAGGGCCGAGGTGGGCGG - Intronic
1002036561 5:176475373-176475395 CTGTGGGAAGCCAAGGTGGGTGG - Intronic
1002096162 5:176832281-176832303 CTGTGGAGAAGTCAGGTGTTTGG + Intronic
1002469044 5:179423815-179423837 CTTTGGAAAGCCAAGGTGGGTGG + Intergenic
1002498261 5:179630666-179630688 CTTTGGAGGGCCGAGGTGGGCGG + Intronic
1002501960 5:179652464-179652486 CTGTGGGGTGCCCAGATGAGGGG - Intergenic
1002727988 5:181313504-181313526 CTGTGGGGGGCCAAGGTGAGAGG - Intergenic
1003162399 6:3647179-3647201 CAGTGGAGAGGCCAGGCTTGAGG - Intergenic
1003395888 6:5751663-5751685 CTGTGCACAGCCCAGGGTTGGGG - Intronic
1003769676 6:9285093-9285115 CTTTGGAAGGCCCAGGTGGGAGG - Intergenic
1003887355 6:10533542-10533564 CTTTGGGGAGCCGAGGTGGGCGG + Intronic
1003989312 6:11470132-11470154 CTGCGAAGAGCACATGTGTGAGG + Intergenic
1004285923 6:14320707-14320729 CTCAGGAGAGCCCAGGCCTGCGG + Intergenic
1004495916 6:16162705-16162727 CTTTGGAGGGCCGAGGTGGGAGG + Intergenic
1005027618 6:21478533-21478555 CTGTGCAGATCCCAGTTGGGTGG + Intergenic
1005098274 6:22142242-22142264 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
1005293197 6:24399011-24399033 CTTTGGGAAGCCAAGGTGTGCGG - Intergenic
1006343972 6:33465032-33465054 CTTTGGGAGGCCCAGGTGTGTGG - Intergenic
1006750453 6:36373518-36373540 CAGCGGCGAGCCCTGGTGTGTGG - Exonic
1006762187 6:36472732-36472754 CTTTGGGGAGCCAAGGTGGGCGG + Intronic
1006949374 6:37808895-37808917 CTTTGGGGGGCCCAGGTGGGTGG - Intergenic
1007751556 6:44074632-44074654 CTGTGCAGAGCCCAGGCGCGTGG - Intergenic
1007914933 6:45552596-45552618 CAGTGAACAGCCCAGCTGTGGGG + Intronic
1008638072 6:53432350-53432372 CTTTGGGGAGCCGAGGTGAGAGG + Intergenic
1008662719 6:53684876-53684898 CTTTGGAGGGCCAAGGTGGGAGG - Intergenic
1008714519 6:54272729-54272751 CTGTGGAGATCTCAGGTCTGAGG + Intergenic
1008911263 6:56736131-56736153 CTTTGGAAAGCCAAGGTGGGTGG - Intronic
1009645591 6:66396495-66396517 CTGTGGAGCCCCAAGGGGTGAGG - Intergenic
1009823069 6:68829343-68829365 CTGTGGGAAGCCGAGGTGGGTGG - Intronic
1009836398 6:69006749-69006771 CTTTGGAAAGCCTAGGTGGGTGG - Intronic
1010246355 6:73663124-73663146 CTTTGGAAAGCCGAGGTGGGAGG + Intergenic
1011320687 6:86089121-86089143 CTCTGGAGACTCCAGATGTGTGG - Intergenic
1012906224 6:105069479-105069501 CTTTGGAGAACCAAGGTGGGAGG + Intronic
1015938350 6:138424702-138424724 CTTTGGAGAGGCCAGGCTTGGGG + Exonic
1016007913 6:139108118-139108140 CTCTGGGAAGCCCAGGTGGGAGG + Intergenic
1016107212 6:140177717-140177739 CTTTGGAAGGCCCAGGCGTGCGG - Intergenic
1016611755 6:145998124-145998146 CTGTGAAAAGTCCAGGTGTGTGG - Intergenic
1016696031 6:146997552-146997574 CTTTGGAAAGCCAAGGTGGGTGG + Intergenic
1017092475 6:150772374-150772396 CTGTGGGAGGCCCAGGTGGGAGG + Intronic
1017127538 6:151079929-151079951 CTTTGGAGAGCCGAGGTAGGCGG + Intronic
1017151922 6:151288269-151288291 CTTTGGAAAGCCGAGGTGGGTGG + Intronic
1017638654 6:156468414-156468436 CTGTGTAGAGCAGAGGTGTCTGG + Intergenic
1017897888 6:158697193-158697215 CTTTGGAAGGCCCAGGTGGGTGG + Intronic
1018554965 6:165039658-165039680 CTGTGGAGTGGCAAGGGGTGAGG + Intergenic
1018827715 6:167421947-167421969 GTGTGGGGAGCCCGTGTGTGGGG - Intergenic
1018908571 6:168089074-168089096 CTGTGTATGGCCCTGGTGTGGGG - Intergenic
1019121071 6:169804162-169804184 CTGTGGAGAACCCAGTGGTGTGG - Intergenic
1019121093 6:169804374-169804396 CTGTGGAGAGCTCTGTAGTGTGG - Intergenic
1019121103 6:169804478-169804500 CTGTGGAGAGCCCTGTGGTGTGG - Intergenic
1019121132 6:169804910-169804932 CTGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019121145 6:169805032-169805054 CTGTGGAGAGCTCAGTGGTATGG - Intergenic
1019121166 6:169805257-169805279 CTGTGGAGAGCCCTGTGGTGTGG - Intergenic
1019121218 6:169805852-169805874 CTGTGGAGAGCCCTATGGTGAGG - Intergenic
1019121289 6:169806808-169806830 CTGTGGAGAGCTCTGTTGTGTGG - Intergenic
1019121356 6:169807736-169807758 CTGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019147151 6:169982835-169982857 CTGTGGAGAGGCCAGGGTGGGGG - Intergenic
1019601102 7:1884251-1884273 CTCTTGGGCGCCCAGGTGTGAGG - Intronic
1019984899 7:4648472-4648494 CAGTGGAGAGCCCTGGTGGAAGG - Intergenic
1020034359 7:4955807-4955829 CTTTGGAAAGCCAAGGTGGGTGG + Intronic
1020674295 7:11162331-11162353 CTGTGGAAGGCCGAGGTGGGTGG - Intronic
1020808990 7:12828217-12828239 CTTTGGGGAGCCAAGGTGGGTGG + Intergenic
1021168903 7:17374051-17374073 GTGTGGAGAGCCCAGGTGTAAGG + Intergenic
1021674961 7:23071087-23071109 CTTTGGGCAGCCCAGGTGGGTGG + Intergenic
1021729843 7:23585590-23585612 GTGTGAAGAGCACAGCTGTGCGG - Intergenic
1021743801 7:23717040-23717062 CTTTGGAGGGCCGAGGTGGGAGG - Intronic
1021888745 7:25166342-25166364 CTTTGGAAGGCCCAGGTGGGCGG + Intronic
1022309648 7:29184765-29184787 CTGTGGGGTGCCCAGGTATGTGG - Intronic
1022881360 7:34591395-34591417 CTGGGGAGAGGCCTGGTGGGAGG - Intergenic
1022944319 7:35266694-35266716 CTGTGGGAGGCCCAGGTGGGTGG + Intergenic
1023160358 7:37291669-37291691 CTGTGGAAGGCCGAGGTGGGTGG + Intronic
1023399110 7:39778947-39778969 CTGTGGGGGGCCAAGGTGAGAGG - Intergenic
1025110054 7:56208889-56208911 CTTTGGGAAGCCCAGGTGGGCGG - Intergenic
1025133541 7:56391568-56391590 CTGTGGGGGGCCAAGGTGAGAGG + Intergenic
1025719925 7:64000370-64000392 CTTTGGGAAGCCCAGGTGGGTGG - Intergenic
1025793434 7:64716733-64716755 CTTTGGGAAGCCGAGGTGTGTGG + Intergenic
1026277524 7:68893117-68893139 CTCTGGGAAGCCAAGGTGTGCGG - Intergenic
1026338259 7:69413346-69413368 CTTTGGAAAGCCGAGGTGGGAGG - Intergenic
1026496829 7:70910752-70910774 CTTTGGGAAGCCCAGGTGGGTGG - Intergenic
1027135258 7:75619277-75619299 CTTTGGGAAGCCCAGGTGGGCGG + Intronic
1027653832 7:80904282-80904304 CTTTGGAGAGCTGAGGTGGGTGG - Intronic
1028816495 7:95152191-95152213 CTGTGGAAAGCCAAGGCGGGTGG - Intronic
1028873113 7:95790433-95790455 CTGAGGAAAGCACAGGTGAGTGG - Intronic
1028889495 7:95971091-95971113 CTGTGGACATGTCAGGTGTGAGG + Intronic
1029144550 7:98436510-98436532 CTTTGGACAGCCGAGGTGGGAGG + Intergenic
1029146168 7:98447635-98447657 CTTTGGAAAGCCAAGGTGGGAGG + Intergenic
1029328435 7:99830272-99830294 CTTTGGAAAGCCGAGGTGGGTGG + Intronic
1029401421 7:100349233-100349255 CTGTCGAGAACCCAGCTGGGAGG + Intronic
1029563451 7:101319464-101319486 CTCTGGGAGGCCCAGGTGTGTGG - Intronic
1029568342 7:101354543-101354565 CTGTGGGAGGCCGAGGTGTGTGG - Intergenic
1029755713 7:102572435-102572457 CTGCGGAGGGCCGAGGTGCGCGG - Intronic
1029773663 7:102671515-102671537 CTGCGGAGGGCCTAGGTGCGCGG - Intronic
1029803213 7:102971780-102971802 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
1030083478 7:105797723-105797745 CTGAGGAGAGGCCAGGTGAGTGG - Intronic
1030183958 7:106741051-106741073 CTGTGGGAAGCCGAGGTGGGTGG + Intergenic
1030230785 7:107206202-107206224 CTTTGGGAAGCCCAGGTGGGCGG - Intronic
1030265545 7:107616980-107617002 CTTTGGAAGGCCCAGGTGGGCGG - Intronic
1030363024 7:108615204-108615226 ATGTGGAGTGCCCAGGTATTAGG - Intergenic
1032034344 7:128510648-128510670 CTTTGGGGGGCCGAGGTGTGAGG + Intergenic
1032049442 7:128638449-128638471 CTGTGGGGGGCCAAGGTGAGAGG - Intergenic
1032650506 7:133873064-133873086 TTTTGGAGGGCCCAGGTATGAGG + Intronic
1032784654 7:135191362-135191384 CTTTGGGAAGCCCAGGTGGGTGG + Intronic
1033124406 7:138695266-138695288 CTTTGGAAAGCCGAGGTGGGCGG + Intronic
1033192182 7:139291605-139291627 CTTTGGAAGGCCTAGGTGTGAGG + Intronic
1033422894 7:141218653-141218675 CACCGGAGAGTCCAGGTGTGGGG - Intronic
1034368019 7:150568900-150568922 CTCTGGAGAGCCGAGGCCTGCGG + Intronic
1034898031 7:154890102-154890124 CTGGGAAGAGCCCAGGTTTGAGG - Intronic
1035225001 7:157428065-157428087 CTGTGGTGAGCCCAGGGTTCTGG - Intergenic
1035282073 7:157784771-157784793 CTGCAGAGAGGCCGGGTGTGGGG - Intronic
1035752905 8:2008428-2008450 CATGGGAGAGCCCAGATGTGAGG + Intergenic
1035909910 8:3554960-3554982 CTGACAAGAGCCCAGGTGTCTGG - Intronic
1036468276 8:9024041-9024063 CTTTGGACGGCCAAGGTGTGCGG - Intronic
1036721611 8:11180659-11180681 CTTTGCAAAGCCCAGGTGGGAGG + Intronic
1036805316 8:11827956-11827978 CTTTGGGAAGCCCAGGTGAGTGG + Intronic
1037161543 8:15779309-15779331 CTATGGGAAGCCCAGGTGGGAGG - Intergenic
1037168844 8:15865247-15865269 CTTTGGAAAGCCAAGGTGGGCGG - Intergenic
1037512188 8:19594793-19594815 CTGTGGAAGGCCAAGGTGGGTGG - Intronic
1037570194 8:20151273-20151295 CTGAGGCTAGGCCAGGTGTGGGG - Intronic
1037833313 8:22201581-22201603 CTGAGCAGGGCCCAGCTGTGGGG - Intronic
1037879574 8:22566204-22566226 CTGTGGAGAGCCCAGGACCCGGG + Intronic
1037885871 8:22596036-22596058 CTTTGGAAAGCCAAGGTGGGAGG - Intronic
1038080306 8:24127453-24127475 ATGTGGAGAGTCCAGAGGTGAGG - Intergenic
1038117370 8:24572601-24572623 CTGTGGAGAGCATAGGTGACTGG + Intergenic
1038606663 8:29013375-29013397 CTTTGGAAAGCCGAGGTGGGTGG - Intronic
1039052506 8:33507740-33507762 CTTTGGAAAGCCAAGGTGAGAGG + Intronic
1039490661 8:37945040-37945062 ATGTGGAGTGCCCAGGGCTGGGG + Intergenic
1040696841 8:50009752-50009774 CTGTGGAAGGCCGAGGTGGGTGG + Intronic
1042601652 8:70504699-70504721 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1042863162 8:73333839-73333861 CTTTGGGAAGCCCAGGTGGGTGG + Intergenic
1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
1043086862 8:75845896-75845918 CTTTGGGTAGCCCAGGTGCGTGG + Intergenic
1044733184 8:95249417-95249439 CTTTGGGGAGCCAAGGTGGGTGG + Intronic
1044831442 8:96253760-96253782 CTTTGGAAAGCCGAGGTGGGAGG + Intronic
1044900210 8:96935911-96935933 ATTTGGAAAGCCCAGGTGTGAGG - Intronic
1045480418 8:102587085-102587107 CAGAGGAGAGCCCAGGCCTGGGG + Intergenic
1045508406 8:102794720-102794742 CTGGGGACAGCCCACATGTGGGG + Intergenic
1045648033 8:104318219-104318241 CTTTGGAGAGCCAAGGTGGGAGG - Intergenic
1045656797 8:104395240-104395262 CTTTGGAAAGCCAAGGTGGGTGG - Intronic
1045673407 8:104582637-104582659 CTGTGGAGAACTCAGTTCTGAGG - Intronic
1046597087 8:116273324-116273346 CTGTGCAGAGCCCAGAGGTTTGG - Intergenic
1046988963 8:120427718-120427740 CTGTGGAAGGCTGAGGTGTGAGG + Intronic
1047242272 8:123101654-123101676 CTGTGGGAAGCCAAGGTGGGTGG - Intronic
1048969577 8:139637858-139637880 GTGGGGAGTGCCCAGGGGTGAGG - Intronic
1048973012 8:139655723-139655745 GTGGGGAGAGCCCAGGGGTGTGG - Intronic
1049007779 8:139866518-139866540 CCGTTGAGAGCCTAGGAGTGTGG + Intronic
1049015003 8:139913989-139914011 CAGGGGTGAACCCAGGTGTGAGG - Intronic
1049082540 8:140454671-140454693 GTGTTGAGATCACAGGTGTGAGG - Intronic
1049474485 8:142790426-142790448 GAGTGGGGAGGCCAGGTGTGAGG - Intergenic
1049861251 8:144901055-144901077 CTGAGGAGATCCAAGGTGGGAGG + Intronic
1051225964 9:14899393-14899415 CTGTGGAGAATGCAGGTGGGAGG + Intronic
1052707219 9:32008573-32008595 CTTTTGGGAGCCCAGGTGTTGGG + Intergenic
1052811506 9:33064984-33065006 CTTTGGGAAGCCCAGGTGGGTGG - Intronic
1054856384 9:69903965-69903987 CTTTGGAAGGCCAAGGTGTGAGG - Intronic
1055177215 9:73334828-73334850 CTTTGGAAGGCCCAGGTGGGTGG - Intergenic
1055637805 9:78295594-78295616 CTGTGTATAGCCCTGGTGTTAGG + Intergenic
1055722797 9:79194230-79194252 CTATGGTTAGCCCAGGGGTGTGG + Intergenic
1056236794 9:84602608-84602630 CTGTGGAGAGCCCAGCTGTATGG - Intergenic
1057008537 9:91581973-91581995 CTGTGGAAGGCCGAGGTGGGTGG - Intronic
1057516016 9:95721872-95721894 CTTTGGGGAGGCGAGGTGTGTGG - Intergenic
1057560229 9:96122354-96122376 CTGTGGTGAGCTCAGGCCTGGGG + Intergenic
1057832786 9:98419611-98419633 CTGCGGAGGGCCCAGGTCAGGGG + Intronic
1057872355 9:98727912-98727934 CTGTGCAGAGCCCAGGGCTCGGG - Intergenic
1057878703 9:98777075-98777097 CTGTGGAGAACCAGGGTGAGAGG - Intronic
1058048042 9:100378390-100378412 CTTTGGAAGGCCCAGGTGGGAGG - Intergenic
1058133367 9:101278617-101278639 CTGTGGTGGGCCCAGGGTTGGGG - Intronic
1058445688 9:105052886-105052908 ACGTGGAGACCTCAGGTGTGTGG - Intergenic
1058491721 9:105508418-105508440 CTTTGGAAGGCCCAGGTGGGCGG - Intronic
1058667999 9:107337929-107337951 CTGTGCTGAGGCCAGGTCTGAGG + Intergenic
1058710877 9:107678109-107678131 CTTTGGAAAGCCGAGGTGGGTGG + Intergenic
1058858364 9:109089030-109089052 CTTTGGGAAGCCAAGGTGTGAGG + Intronic
1058916180 9:109568256-109568278 CTGTGCAGAGCCCAGTGGGGTGG + Intergenic
1059318428 9:113447016-113447038 CTTTGGAAAGCCGAGGTGGGTGG + Intronic
1059363867 9:113770218-113770240 CTTTGGAAAGCCAAGGTGGGTGG - Intergenic
1059460419 9:114426078-114426100 CAATGGAGGGCCCTGGTGTGGGG + Intronic
1059741881 9:117159466-117159488 CTGGCCAGAGCCCATGTGTGGGG + Intronic
1060230631 9:121822683-121822705 CTGGGGAGGGCCACGGTGTGGGG + Exonic
1060513132 9:124248803-124248825 CTCTGGGGAGCCGAGGTGGGAGG - Intergenic
1060615122 9:125006270-125006292 CTTTGGAGGGCCAAGGTGGGAGG + Intronic
1061266870 9:129511306-129511328 GTCTGGAGAGGCCAGATGTGGGG + Intergenic
1061464602 9:130767574-130767596 CTTTGGAGGGCCCAGGCGGGTGG - Intronic
1061801951 9:133117545-133117567 CCGTGGGCAGCCAAGGTGTGCGG + Intronic
1062395591 9:136351368-136351390 CTGTGGACAGGGCAGGTGTCTGG - Intronic
1062416864 9:136455583-136455605 CTCAGGTGAGCCCAGGTGCGCGG - Exonic
1062475410 9:136724292-136724314 TTGTGCACAGCCCAGGTTTGGGG - Intergenic
1062541778 9:137044747-137044769 CTGTGCTGAGCCCGGGTGGGTGG - Intronic
1062695331 9:137872822-137872844 CTTTGGGAAGCCCAGGTGGGCGG + Intergenic
1062727346 9:138083109-138083131 CTGGAGGGAGCACAGGTGTGTGG - Intronic
1062753051 9:138270645-138270667 CTGTGGGGGGCCAAGGTGAGAGG - Intergenic
1203575567 Un_KI270745v1:5422-5444 CTGTGGGGGGCCAAGGTGAGAGG - Intergenic
1185719710 X:2371936-2371958 CTGTGGACAGCACAGTTGTCTGG - Intronic
1185813935 X:3136504-3136526 CTGTGCAGAGCCCACAGGTGAGG - Intergenic
1186169123 X:6858561-6858583 CTTTGGAAAGCCAAGGTGAGAGG - Intergenic
1186963502 X:14762388-14762410 CTGTGGGAGGCCGAGGTGTGAGG - Intergenic
1187850929 X:23591104-23591126 CTTTGGGGAGCCAAGGTGGGTGG + Intergenic
1187925117 X:24242768-24242790 CTTTGGAAAGCCGAGGTGGGCGG - Intergenic
1188034946 X:25306911-25306933 CTGTGGGAGGCCCAGGTGGGTGG + Intergenic
1188091410 X:25969046-25969068 CTGTGGAGACCCAAGGAGTGTGG + Intergenic
1189479239 X:41380501-41380523 CTTTGGGGAGCCAAGGTGGGTGG - Intergenic
1189873481 X:45409142-45409164 GTGTGGAGAGGCAAGATGTGGGG + Intergenic
1189895192 X:45648106-45648128 CTTTGGGAGGCCCAGGTGTGCGG + Intergenic
1190935727 X:54997615-54997637 TTGTGGAGAGTGAAGGTGTGAGG + Intronic
1193572649 X:83162462-83162484 CTTTGGCAAGCCCAGGTGGGTGG - Intergenic
1195364236 X:104112252-104112274 CGGAGGAGAGCCGAGGTGTAAGG + Intronic
1195383450 X:104291868-104291890 CTGTGGAAGGCCCAGGCGGGTGG + Intergenic
1196635999 X:118003271-118003293 CTTTGGAGGGCCAAGGTGGGAGG + Intronic
1196922776 X:120601711-120601733 CTGGGGAGAGACCTGGTGGGAGG + Intronic
1197725689 X:129774922-129774944 CTTTGGGAAGCCCAGGTGAGTGG - Intergenic
1199477744 X:148264343-148264365 CTTTGGAGGGCCGAGGTGGGTGG + Intergenic
1200073215 X:153539020-153539042 CAGTGGAGACCCCAGGTGTCTGG + Intronic
1201168682 Y:11235617-11235639 CTGTGGGAAGCCGAGGTGCGCGG - Intergenic
1202577832 Y:26346298-26346320 CTTTGGAAAGCCTAGGTGGGTGG + Intergenic