ID: 1103478182

View in Genome Browser
Species Human (GRCh38)
Location 12:121233557-121233579
Sequence GCTGTGGAGAGCCCAGGTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 274}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103478182_1103478189 0 Left 1103478182 12:121233557-121233579 CCCACACCTGGGCTCTCCACAGC 0: 1
1: 0
2: 3
3: 27
4: 274
Right 1103478189 12:121233580-121233602 CCCATCAAAGAACAGAGAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 275
1103478182_1103478192 6 Left 1103478182 12:121233557-121233579 CCCACACCTGGGCTCTCCACAGC 0: 1
1: 0
2: 3
3: 27
4: 274
Right 1103478192 12:121233586-121233608 AAAGAACAGAGAGGAGGAGGAGG 0: 1
1: 0
2: 45
3: 498
4: 3211
1103478182_1103478186 -3 Left 1103478182 12:121233557-121233579 CCCACACCTGGGCTCTCCACAGC 0: 1
1: 0
2: 3
3: 27
4: 274
Right 1103478186 12:121233577-121233599 AGCCCCATCAAAGAACAGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 166
1103478182_1103478193 7 Left 1103478182 12:121233557-121233579 CCCACACCTGGGCTCTCCACAGC 0: 1
1: 0
2: 3
3: 27
4: 274
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528
1103478182_1103478194 15 Left 1103478182 12:121233557-121233579 CCCACACCTGGGCTCTCCACAGC 0: 1
1: 0
2: 3
3: 27
4: 274
Right 1103478194 12:121233595-121233617 AGAGGAGGAGGAGGGAGAAATGG 0: 1
1: 12
2: 219
3: 1639
4: 8255
1103478182_1103478191 3 Left 1103478182 12:121233557-121233579 CCCACACCTGGGCTCTCCACAGC 0: 1
1: 0
2: 3
3: 27
4: 274
Right 1103478191 12:121233583-121233605 ATCAAAGAACAGAGAGGAGGAGG 0: 1
1: 0
2: 2
3: 56
4: 669

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103478182 Original CRISPR GCTGTGGAGAGCCCAGGTGT GGG (reversed) Exonic
900143493 1:1148242-1148264 GGGGTGGAGAGCCGAGGTGCCGG + Intergenic
900207470 1:1437761-1437783 GGAGTGCAGAGCCCGGGTGTAGG + Intronic
900399173 1:2466026-2466048 GACATGCAGAGCCCAGGTGTGGG + Intronic
901323715 1:8355043-8355065 GCTGTGGAAACCCCAGTTCTTGG - Exonic
901416540 1:9120476-9120498 GCTGGGGGAAGCCCAGCTGTAGG + Intronic
902287146 1:15414027-15414049 GCTGTTGTCAGCCCAGGGGTGGG - Intronic
902602526 1:17550029-17550051 GCTGTAGAGAGCCAGGGTGGAGG + Intronic
903266604 1:22161565-22161587 GCTGGGGAGAACCCAGGAGCGGG - Intergenic
903319126 1:22531485-22531507 GCTGTAGAGAGCAGAGGAGTTGG + Intergenic
903499441 1:23793360-23793382 CCTGTGGAGCCCCCAGGAGTGGG + Intronic
903699666 1:25237454-25237476 CCAATGGAGAGGCCAGGTGTGGG - Intergenic
903762307 1:25707326-25707348 TCTGTGCAGAGCCCAGGTAGGGG + Intronic
903832519 1:26183561-26183583 CCTCTGCAGAGCCCAGGTGATGG + Intronic
904215535 1:28915424-28915446 CCTGTGGAGAGGCCGGGTCTGGG + Intronic
906530790 1:46522853-46522875 GCTGTGCAGAGGCCAGGAGATGG - Intergenic
907241669 1:53084418-53084440 GCTGTGGGGAGCCCTGCTGGAGG - Intronic
907527569 1:55062911-55062933 GCGGTGGAGGGTCCAGGCGTTGG + Intronic
910665776 1:89724828-89724850 AATGTGGAGAGACCAGGGGTGGG + Intronic
910932837 1:92459579-92459601 GCTGATGGGAGCCCATGTGTTGG - Intergenic
912732046 1:112115797-112115819 GCAGAGGAGAGCACAGATGTTGG - Intergenic
915015378 1:152728119-152728141 GCTCTGGAAAGCCCAGGTTGAGG + Intergenic
915145505 1:153794013-153794035 GCTTTGGGGAGCCCAGGTTCTGG - Intergenic
915577081 1:156786588-156786610 TCCCTGGTGAGCCCAGGTGTGGG - Exonic
917725769 1:177825746-177825768 GCAGTGATGAGCCCAGGTCTGGG + Intergenic
920703818 1:208237245-208237267 GGAGTGGACAGCCAAGGTGTAGG + Intronic
921260738 1:213383350-213383372 GCTGTGGAGATCCAAGGTAAAGG - Intergenic
922194923 1:223351615-223351637 GCTGTGGAAAGGCCAGCTGGAGG + Intronic
922818683 1:228469720-228469742 GCTGGGGAGCTCCCAGGTGCTGG - Intergenic
923010332 1:230083269-230083291 GGAGTGGGGAGCCCAGATGTTGG + Intronic
923243488 1:232108817-232108839 GCTGTGGAGGCCCCAGGGTTGGG + Intergenic
1063175223 10:3544718-3544740 GCAGGGGAGAGCCCAGAGGTGGG - Intergenic
1067293730 10:44962535-44962557 GCAGTGGACAGCACAGGTGAGGG + Intronic
1067320752 10:45218613-45218635 GCTGTGGATAGCCCAGGGGGTGG - Intergenic
1069575896 10:69528337-69528359 GCTGGGGAGCTCCCAGGTCTGGG + Intergenic
1069789790 10:71012252-71012274 GCTGTGGAGAGCCCTGAGGTTGG + Intergenic
1070380743 10:75878421-75878443 TCTGAGGAGAGTCCAGCTGTTGG - Intronic
1070648364 10:78217477-78217499 GCTGTGGAGGGCTGCGGTGTAGG + Intergenic
1073124222 10:101139923-101139945 GGGGTGGAGAGCCCAGGCTTGGG - Intergenic
1073546502 10:104353843-104353865 GCTGTGGAGATCGCAGGAGCTGG - Exonic
1074061525 10:109970435-109970457 GCTGCTGAGAGCCCAGGCTTTGG + Intergenic
1075410719 10:122225981-122226003 GCTATGGTCAGCCCAGGTCTAGG + Intronic
1075655257 10:124156861-124156883 GCAGCTGAGAGCCCAGGTGTGGG + Intergenic
1076135760 10:128045044-128045066 GGTGTGGGGAGGCCAGGTGGGGG - Intronic
1076138804 10:128063818-128063840 GCTGTGGGGAGCCTGGGTGCGGG + Intronic
1076479970 10:130778451-130778473 ACTGTGGGGAGGCCAGGTGGGGG + Intergenic
1076536084 10:131178620-131178642 GCTGGGGAGACCTCAGGTCTGGG - Intronic
1076687910 10:132206417-132206439 GCTGTGCAGATCCCAGGCGAAGG + Intergenic
1077093720 11:790684-790706 TCTGTGGAGGGCCCCGGTTTTGG + Exonic
1077117840 11:893375-893397 GCTGTGGAGGGCTCTGGGGTCGG - Intronic
1077141315 11:1026141-1026163 GCTGTGGAGACAGCAGGTGTGGG + Exonic
1077302069 11:1852022-1852044 GCTGGAGAGAGGCCAGGGGTTGG - Intergenic
1078096094 11:8298179-8298201 GGTCTGGGGAGTCCAGGTGTGGG + Intergenic
1078902525 11:15654661-15654683 GCTGTGCAGAGGCCCGGTTTTGG + Intergenic
1079004776 11:16783833-16783855 GCTGGGGAGAGGCCAGGAGGTGG + Intronic
1080399144 11:31917953-31917975 TGAGTGGAGAGGCCAGGTGTGGG - Intronic
1081572125 11:44298320-44298342 GCTGGGAAGAGCCCAGGCCTTGG + Intronic
1081594095 11:44447250-44447272 GCTGTGCAGAGCTCAGGCGGAGG - Intergenic
1081665193 11:44912514-44912536 CCTGTGGATAGCCCTGGTCTGGG - Intronic
1081747330 11:45482383-45482405 TCTCTGGAAAGCCCAGGTGAGGG + Intergenic
1083921428 11:65782988-65783010 CCAGTCGAGGGCCCAGGTGTGGG + Intergenic
1084169963 11:67396344-67396366 GCTCTGGGGAGCCCAGGTCCTGG - Exonic
1084521569 11:69666374-69666396 GGTGTGGAGAGCCAGCGTGTGGG + Exonic
1084998456 11:73006620-73006642 AATGTGCAGAGCACAGGTGTTGG - Intronic
1085718794 11:78895684-78895706 GCTGCTGAGAGCTCAAGTGTGGG + Intronic
1086848277 11:91778734-91778756 GCTGTGGATAGAGCAGGGGTTGG - Intergenic
1089064216 11:115650167-115650189 GCAGTGGACAGCCAAGGTGCTGG - Intergenic
1089065936 11:115662092-115662114 GCTGTTCTGGGCCCAGGTGTGGG - Intergenic
1089549859 11:119265527-119265549 GGTGTGAGGAGCCCAGGAGTTGG + Intronic
1091582748 12:1799011-1799033 GCTGGGGACAGCCCAGGTGGTGG + Intronic
1091718032 12:2794090-2794112 GCTGTGGAGCGCGCAGGTGCCGG - Intergenic
1091787603 12:3252458-3252480 GCTGGGGGGAGCCCAGGGGCTGG - Intronic
1092295086 12:7190627-7190649 GAGGTGGAAAGCCCAGGTGGTGG + Intronic
1094452478 12:30597177-30597199 GCTGGAGAGAGACCGGGTGTGGG + Intergenic
1094495619 12:30987620-30987642 GCTGCGGGGAGCCCAGGCCTGGG - Intronic
1095618157 12:44217299-44217321 GATGTGGAGAGTGCAGGTGAGGG + Intronic
1096539316 12:52296055-52296077 GCAGAGTAGAGACCAGGTGTCGG + Intronic
1096551889 12:52378411-52378433 GAGGTGGAGGGCCCTGGTGTCGG - Intronic
1097061393 12:56286996-56287018 GCTGTCGAAAGACCAGGTGCAGG - Intronic
1100934503 12:99647913-99647935 GCTGTCAGGAGCACAGGTGTTGG - Exonic
1102260087 12:111438194-111438216 GCTGGAGGGAGACCAGGTGTTGG + Intronic
1103332593 12:120164531-120164553 GCTGTGGAAAGCCCTGCTCTTGG - Intronic
1103478182 12:121233557-121233579 GCTGTGGAGAGCCCAGGTGTGGG - Exonic
1104712269 12:130995253-130995275 CCTCTGCGGAGCCCAGGTGTGGG + Intronic
1104804236 12:131574758-131574780 CCTGTGCAGAGCCCAGGAGCTGG + Intergenic
1104878971 12:132056015-132056037 AACGTGGAGACCCCAGGTGTGGG + Intronic
1104886437 12:132111998-132112020 GCTGAGGAGAGGCCAGCAGTAGG + Intronic
1107286751 13:38802186-38802208 CCAGTGGAGTGCTCAGGTGTGGG + Intronic
1107393563 13:39992734-39992756 GCTGTGGACAGCCCATTTCTCGG - Intergenic
1109289641 13:60458061-60458083 GAGGTGGAGAGGCCAGGAGTTGG + Intronic
1112533504 13:100227275-100227297 GCAGTTAAGAGCTCAGGTGTGGG - Intronic
1113605056 13:111599074-111599096 GCTGTGGAGAGCAAAGCTGGAGG - Intronic
1113630123 13:111876654-111876676 GCTATTGAGAGCCCAGGCGAGGG + Intergenic
1115448353 14:33517917-33517939 GCTGGGGAGAGCCGAGGATTTGG - Intronic
1117831101 14:59751820-59751842 GCAGTGCAGAGCCCAGGGGCTGG - Intronic
1118336336 14:64856303-64856325 GCTGTGAAGAGTCCTGGTGAGGG - Intronic
1119438162 14:74611497-74611519 GCTGTGGGGTCCCCAGGCGTGGG + Exonic
1119441352 14:74630899-74630921 CCTGTGGAGGGGCCAGGTGTAGG + Intergenic
1119448185 14:74684382-74684404 GCTTTCCAGAGCCCAGGTGCTGG - Intronic
1119525704 14:75320751-75320773 TCTGTGGTTACCCCAGGTGTGGG - Intergenic
1122016892 14:98803894-98803916 GCTGTGAGGAGCCAAGGGGTTGG - Intergenic
1122318485 14:100839558-100839580 CCTGTGGGCAGCCCAGGTGTGGG - Intergenic
1122342795 14:101039215-101039237 GATGTGAAGAGGCCAGGGGTGGG + Intergenic
1122717679 14:103705412-103705434 GCTGTGGACAGCCCAGCGGTGGG + Intronic
1122759491 14:104011939-104011961 GCCCTGGAGAGACCAGGTGCAGG + Intronic
1123027390 14:105433151-105433173 GCTCAGGAGAGACCAGGGGTGGG + Intronic
1123973370 15:25529582-25529604 CCTGTGGCAAGGCCAGGTGTGGG + Intergenic
1124067188 15:26355177-26355199 GCTGGGGAGGACCCAGGTGAGGG - Intergenic
1124515937 15:30367527-30367549 GCTGTGGAGAGAACAGATGCAGG + Exonic
1124726983 15:32163204-32163226 GCTGTGGAGAGAACAGATGCAGG - Exonic
1129656458 15:77528180-77528202 GCTCTGCAGTGCCCAGGTCTGGG + Intergenic
1130202143 15:81842002-81842024 GGTGTGGGAAGCACAGGTGTTGG + Intergenic
1130696881 15:86140013-86140035 GATGTGGAGAGCCCCTGTCTGGG + Intergenic
1130911839 15:88276211-88276233 GCTTTGGAGAGCCAGGGTTTTGG - Intergenic
1132553330 16:562123-562145 GCGGTGGACAGCCCAGGTGGCGG + Intronic
1133554925 16:6897031-6897053 GGTGTGGAGAGCTCAGGTCTGGG - Intronic
1137404050 16:48176260-48176282 GCTCTGGGGTGCCCAGGAGTGGG + Intronic
1138192711 16:55029166-55029188 GCTATGATGTGCCCAGGTGTGGG + Intergenic
1138560581 16:57798537-57798559 GCTGGGAAGGGCTCAGGTGTGGG - Intronic
1139587779 16:67915397-67915419 GCTGTGGAGAGCTCTGGGTTGGG + Intronic
1139590402 16:67929922-67929944 CCTGTGGTGAGCTCAGTTGTAGG + Exonic
1142008967 16:87704234-87704256 CCTGTGGAGAGCCCTGGGGAGGG + Intronic
1144017514 17:11210033-11210055 GCAGTGGAGGGACCATGTGTAGG - Intergenic
1144386084 17:14750525-14750547 ACTGTCCAGAGCCCAGGTGTGGG - Intergenic
1146480025 17:33197629-33197651 GATGTGGAGTGTCCAGGGGTTGG + Intronic
1146728867 17:35177032-35177054 GCTTTGGAGGGCACAGATGTGGG + Exonic
1147948212 17:44092389-44092411 GCTGTTGAGATCACAGGTGCCGG - Exonic
1150529256 17:65959551-65959573 GCTCGGGAGCGCCCAGGTCTGGG - Intronic
1152294546 17:79459100-79459122 GCTGTGGAGTGCCTAGGGGAGGG - Intronic
1152363353 17:79842356-79842378 GCTCTGGGAATCCCAGGTGTAGG - Intergenic
1152718640 17:81911678-81911700 GGTGCGGAGAGGCCAGGTGTGGG - Intergenic
1152911898 17:83009982-83010004 GCTGTGGAGGCCCCTGGTGTTGG + Intronic
1152911912 17:83010008-83010030 GCTGTGGGGGCCCCTGGTGTGGG + Intronic
1154165395 18:12010764-12010786 GGTGAGCAGAGCCCGGGTGTGGG + Intronic
1154356581 18:13626435-13626457 TGTGTGGACAGCCCAGGGGTAGG + Intronic
1155332732 18:24734193-24734215 GCTGAGGGGAGCCCAGGTCCCGG + Intergenic
1156511406 18:37640010-37640032 GCTGCAGAGAGCCTGGGTGTAGG - Intergenic
1158606607 18:58901570-58901592 TCTTTGGAGAGCACTGGTGTGGG + Intronic
1160107005 18:75987582-75987604 GCCGTGAAAAGCCCAGCTGTGGG - Intergenic
1160123585 18:76151189-76151211 GCTGTGGGTACCCCAGGGGTGGG + Intergenic
1160399824 18:78602045-78602067 GCTGGGGTGAGCACTGGTGTGGG - Intergenic
1160663903 19:313949-313971 GCTGTGGACAGCCTAGATCTGGG + Intronic
1160822648 19:1065750-1065772 TCTGTGGCCAGCCCAGGAGTTGG + Intergenic
1161066491 19:2241020-2241042 GCTGTGGAGAGTGCAGGCTTGGG + Intronic
1161183515 19:2901017-2901039 GCCTTGGAGAGCCCAGGAGCAGG + Exonic
1161810348 19:6467793-6467815 GCAGTGGAGAGCCAGGGAGTGGG + Exonic
1164992219 19:32692526-32692548 GTTGTGCAGCGCCCAGATGTCGG - Exonic
1165331531 19:35143223-35143245 GCTGGGGGGAGCCCTGGCGTGGG - Intergenic
1166072970 19:40397486-40397508 GCTGTGGAGGCCCCAGCCGTGGG - Exonic
925144241 2:1570266-1570288 GATGGGGAGAGCACAGGTGGTGG + Intergenic
925499929 2:4491180-4491202 GCTCAGCAGAGCCCAGCTGTTGG + Intergenic
925887041 2:8402017-8402039 AATGTGCAGACCCCAGGTGTTGG + Intergenic
926043198 2:9691183-9691205 GCTGTGGAAAGCACAGGCTTCGG + Intergenic
926239366 2:11073255-11073277 GCTGTGGAAAGGACAGGTTTAGG + Intergenic
927743100 2:25590171-25590193 CCTCTGGGGAGCCCAGATGTAGG - Intronic
930013877 2:46957649-46957671 GCTGTGGACAGCCCAGCTGGGGG + Intronic
930051474 2:47219352-47219374 GCTGGGGAGAGCCAAGGGGCTGG + Intergenic
933967488 2:87442021-87442043 GGTGGGGGGAGCACAGGTGTAGG + Intergenic
936251372 2:110870686-110870708 GCAGGTGAGAGTCCAGGTGTGGG - Intronic
936326307 2:111508475-111508497 GGTGGGGGGAGCACAGGTGTAGG - Intergenic
937890226 2:126933171-126933193 GCTGGGGGGAGTCCATGTGTGGG - Intergenic
938308600 2:130270221-130270243 AGTGTGGGGAGCCCAGGAGTGGG + Intergenic
938446732 2:131386616-131386638 AGTGTGGGGAGCCCAGGAGTTGG - Intergenic
941651684 2:168099006-168099028 CATGTGGAGAGGTCAGGTGTAGG + Intronic
944669657 2:201984371-201984393 GAAGTGGAGAGCACAGGTTTAGG + Intergenic
945469157 2:210207174-210207196 GCTGTAGAGAGATCAGTTGTAGG - Intronic
945987325 2:216365425-216365447 GCTGTGGAGTGCCTAGCAGTGGG - Intronic
946154761 2:217800255-217800277 GCTGGCAAGAGCCCAGGCGTGGG + Exonic
946218955 2:218209943-218209965 TCCGTGAAGAGCCCAGATGTTGG - Intergenic
1172664854 20:36591965-36591987 GCAGTAGTTAGCCCAGGTGTGGG + Exonic
1173579007 20:44132944-44132966 GCTGTGGAGGGGCCCGGTGGGGG - Intronic
1174561108 20:51431464-51431486 GCTGTGGTGAGCCCAGCTGATGG - Intronic
1174817030 20:53696067-53696089 GGTTTGGAAAGGCCAGGTGTAGG + Intergenic
1175285624 20:57834815-57834837 GCTGTGGAGCACACAGCTGTGGG - Intergenic
1175968249 20:62670706-62670728 GCTGTGCTGAGCCCAGGGGATGG - Intronic
1176192458 20:63818502-63818524 GATGGCGAGTGCCCAGGTGTTGG - Intronic
1179138221 21:38699248-38699270 GCTGTCCAGGGACCAGGTGTGGG + Intergenic
1179444140 21:41419880-41419902 GCTTTGGAGAGCCAAGCTGGGGG - Intergenic
1179569225 21:42268227-42268249 GCTGAGCAGAGCTCAGGGGTGGG + Intronic
1179783656 21:43718306-43718328 GCTGTGGAGAGCGTAGGGGTGGG + Intergenic
1179792593 21:43764232-43764254 GCTGTGGCGTGTCCAGGGGTGGG + Intergenic
1180608700 22:17081689-17081711 GCTGTGAAGATGTCAGGTGTGGG + Intergenic
1180831766 22:18910354-18910376 GGTGTGGGGGGCTCAGGTGTGGG + Intronic
1181117439 22:20641588-20641610 GTGGTTGAGAGCCCAGGTTTTGG - Intergenic
1181135814 22:20765578-20765600 GCTGTGGAGGGCTCAGGTAGGGG - Exonic
1181150898 22:20882533-20882555 GCTGAGGAGAGCCCAGATGGAGG + Intronic
1181403022 22:22663039-22663061 GCTGTGGAGTGACCTGGTGCAGG + Intergenic
1181407631 22:22696031-22696053 GCTGTGGAGTGACCTGGTGCAGG + Intergenic
1181412328 22:22733045-22733067 GCTGTGGAGTGACCTGGTGCAGG + Intergenic
1181419966 22:22790966-22790988 GCTGTGGAGTGACCTGGTGCAGG + Intronic
1181424005 22:22821239-22821261 GCTGTGGAGTGACCTGGTGCAGG + Intronic
1181434446 22:22902021-22902043 TCTCTGGGGAGCCCAGATGTGGG + Intergenic
1183361292 22:37384641-37384663 GGTGGGGAGAGGCCAGGGGTCGG - Intronic
1183901570 22:41009797-41009819 GCTGAGCAGAGCCCAGCAGTAGG + Intergenic
1184003676 22:41693624-41693646 GCTGTGGAGAGAGCAGGTTCTGG - Exonic
1184519815 22:44986779-44986801 GCTGGGGAGAGGGCAGGTGAAGG + Intronic
1184519830 22:44986824-44986846 GCTGGGGAGAGGGCAGGTGCAGG + Intronic
1203281846 22_KI270734v1_random:135625-135647 GGTGTGGGGGGCTCAGGTGTGGG + Intergenic
950520577 3:13495459-13495481 GGGGTAGAGGGCCCAGGTGTCGG - Intronic
950570062 3:13794168-13794190 TCTGTAGAGAGCCCAGGTCCTGG + Intergenic
952338336 3:32424217-32424239 GCACTGGAGAGGCCATGTGTAGG - Intronic
953468477 3:43146337-43146359 ACTGTTGAGTGCCCTGGTGTAGG - Intergenic
954988196 3:54814290-54814312 GCTGGGGAAAGGCCAGGTCTTGG - Intronic
955106112 3:55900119-55900141 GGTGGGGAGAGCCCAATTGTTGG + Intronic
955679553 3:61486296-61486318 GCTTTGGAAAGCCAAGGTGGGGG - Intergenic
955692911 3:61607673-61607695 TCTGTGGAGAGGCCAGGAGGGGG + Intronic
956403042 3:68900113-68900135 GCTGTGGTGATCCCAGGTACTGG + Intronic
960661908 3:120069502-120069524 GCTGTGGACAACCCAGTTGGGGG + Intronic
961328230 3:126124242-126124264 CCTGGGGAGAGCCCAGGCGGGGG - Intronic
961332102 3:126148439-126148461 GCTGTGCAGCTCCCCGGTGTTGG - Intronic
961366488 3:126402840-126402862 GCTGTGGGGAGTCCAGGTGGGGG + Intronic
961513548 3:127419270-127419292 TCTGTGGGGGGCCCAGGTGGGGG + Intergenic
961531319 3:127542144-127542166 GCTGTGGAAGGGCCAGGTGCTGG - Intergenic
962354357 3:134681068-134681090 GCTGGGGAGAGCCAAGGGGGAGG + Intronic
963806416 3:149727486-149727508 GCTTTGGAAGGCCCAGGTGGGGG + Intronic
964382747 3:156114304-156114326 GCTTTGAAGAGGCCAGGAGTGGG - Intronic
964647905 3:158978073-158978095 CCCGTGGAGAGCCCAGCTGTTGG - Intronic
965206240 3:165721181-165721203 GGTGGGGAGAGGCCAGGCGTGGG + Intergenic
966804892 3:183799422-183799444 GCTGTGGGGAGTCAAGGGGTAGG + Intronic
967224351 3:187276560-187276582 GCTGGGAAGGTCCCAGGTGTGGG - Intronic
968219475 3:196925530-196925552 GCAGAGGAGAGCAGAGGTGTTGG + Intronic
968284061 3:197497997-197498019 GCTGTGGTGGGCCCAGGAGTTGG - Intergenic
968539112 4:1154124-1154146 GCGGTGGGGAGGCTAGGTGTGGG + Intergenic
968827543 4:2910601-2910623 CCTGTGTAGAGCCCACGTGAGGG + Intronic
969499231 4:7543070-7543092 GCAGTGGACAGCCCAGGTTTTGG + Intronic
973345119 4:49046960-49046982 AATGTGGGGAGCCCTGGTGTGGG + Intronic
974969872 4:68809764-68809786 GCTTTGGAGTGCCCAGCTGGTGG + Intergenic
977875785 4:102148543-102148565 AGTGTGGAGAGCTCAGATGTTGG - Intergenic
979099416 4:116597299-116597321 GCTGTGGAGAGACAAGCTCTTGG + Intergenic
981190936 4:141861913-141861935 GCTGTGGCGAGACCAGGTGTTGG - Intergenic
983938786 4:173521477-173521499 GGAGTGGAAAGTCCAGGTGTTGG + Intergenic
984169535 4:176343723-176343745 GCTCTGGAGAGCACAGGTGTTGG + Intergenic
985501507 5:250544-250566 GCTGAGCAGAGCCCTGGTGATGG - Intronic
985613672 5:906148-906170 GCTGTGGTGAGCCTGGGTGACGG + Intronic
985735372 5:1577087-1577109 GCTGAGCAGAGCCCTGGTGATGG + Intergenic
986003869 5:3651364-3651386 TCTGTTGAGGGCCCAGGTGCTGG - Intergenic
986737424 5:10678480-10678502 GATGTGGAGAGCCCTGGGGGTGG + Intergenic
986872393 5:12064524-12064546 GCCGTGGAGAGCCCAGATGTAGG + Intergenic
994529340 5:100947900-100947922 GTTGTGGAGAGCACAGGTCACGG - Intergenic
994762747 5:103877656-103877678 GCTGTTGAGAGCCCAAAAGTGGG - Intergenic
996254672 5:121384608-121384630 GCCGGGGAGAGACCAGGTGGAGG - Intergenic
997199514 5:132001355-132001377 TGTGTGGAGAGGGCAGGTGTTGG - Intronic
997647665 5:135491779-135491801 GCTGCGGAGAGCGCAGCTGCGGG + Intergenic
999796918 5:154997384-154997406 GCTGTTGAGAGACAAGGTGGTGG - Intergenic
1000366274 5:160494253-160494275 CCTGTGGAGTCCCCAAGTGTTGG - Intergenic
1000526966 5:162370089-162370111 GCTGGGGAGGCCTCAGGTGTAGG + Intergenic
1003002813 6:2351706-2351728 GCTGTGGAGAGCCGGGGGTTCGG - Intergenic
1006427920 6:33977724-33977746 GCTGGAGAGAGACCAGGTGAGGG - Intergenic
1006455148 6:34127607-34127629 GCTGTGGAGAGGCCATTTGGAGG + Intronic
1007365543 6:41389326-41389348 CCTGTGGGGAGCCCAGCTGCTGG - Intergenic
1010195956 6:73240567-73240589 GCTGAGAAGGGCTCAGGTGTTGG - Intronic
1015147248 6:130000933-130000955 GCTGAGGAGAGCCGAGGAGCAGG + Intergenic
1015681278 6:135811488-135811510 GCTGCGGAGATCCCAAGTTTGGG - Intergenic
1015938349 6:138424701-138424723 GCTTTGGAGAGGCCAGGCTTGGG + Exonic
1018482062 6:164201024-164201046 GCCCTGGAGAGCCCACCTGTAGG - Intergenic
1018703146 6:166443568-166443590 GCTGTAGTAAGCTCAGGTGTTGG - Intronic
1018769239 6:166957063-166957085 GCAGTGGAGCGCCGAGGTGGCGG - Intronic
1018939485 6:168299714-168299736 GCTGGGCAGTGCCCAGGAGTTGG - Intronic
1020099562 7:5387643-5387665 CCTGGGCAGAGCCCAGGTGCGGG - Intronic
1020668785 7:11080214-11080236 GATGTGGAGTACCTAGGTGTAGG + Intronic
1021301294 7:18976059-18976081 GCTTTGGAGAGGACAGGTGGTGG - Intronic
1021800040 7:24295888-24295910 GCTGAGGAGAGTGCAGGAGTAGG + Intergenic
1024621243 7:51159215-51159237 GCTTTGGAGACCACAGGTGCTGG + Intronic
1029258935 7:99288218-99288240 GCTTTTGAGAGGCCAGGAGTTGG + Intergenic
1032642041 7:133780773-133780795 GCTTTGGGGAGCACAGCTGTTGG - Intronic
1033422895 7:141218654-141218676 GCACCGGAGAGTCCAGGTGTGGG - Intronic
1033456168 7:141505932-141505954 GCAGTGGAGAGCCTGAGTGTTGG - Intergenic
1034925179 7:155115468-155115490 GCCTTGCAGAGCCCAGGCGTGGG + Intergenic
1035125602 7:156606748-156606770 GCAGTGGGGTGTCCAGGTGTGGG - Intergenic
1035282074 7:157784772-157784794 GCTGCAGAGAGGCCGGGTGTGGG - Intronic
1035341762 7:158166826-158166848 GGTGTGCAGACCCCACGTGTGGG + Intronic
1035647026 8:1232336-1232358 GCTGTGAAGAGCCCACTTTTTGG + Intergenic
1036133266 8:6135843-6135865 GCGTGGGAGAGCCCAGGTCTCGG + Intergenic
1037703315 8:21295223-21295245 GCTGTGCAGAGCCCAGCAGGAGG - Intergenic
1037833314 8:22201582-22201604 GCTGAGCAGGGCCCAGCTGTGGG - Intronic
1037879573 8:22566203-22566225 CCTGTGGAGAGCCCAGGACCCGG + Intronic
1044685784 8:94823934-94823956 GCTGGGGAGAAACCAGCTGTTGG + Intronic
1045480417 8:102587084-102587106 GCAGAGGAGAGCCCAGGCCTGGG + Intergenic
1048922513 8:139244233-139244255 CCTGTGGAGACCCCAGGACTGGG + Intergenic
1049332230 8:142060710-142060732 GCTGAGGAGAGACCAGGTATGGG - Intergenic
1049542207 8:143213723-143213745 GCTGGGGAGGGCCAAGGAGTTGG + Intergenic
1049693880 8:143974317-143974339 GCTGAAGAAAGCCCAGGCGTGGG + Intronic
1050562593 9:6849679-6849701 ACTTTGGAGAGCCCAAGTCTTGG + Exonic
1052707218 9:32008572-32008594 ACTTTTGGGAGCCCAGGTGTTGG + Intergenic
1052821200 9:33139001-33139023 GCTGTGGACAGCCCCGGCATGGG - Intronic
1052892295 9:33713128-33713150 GCTGTCCAGAGGCCAGCTGTTGG - Intergenic
1053122081 9:35555168-35555190 GCTGTGGAGGGCCCGGGCCTTGG - Exonic
1054930184 9:70627764-70627786 GCTGTGGAGGGCCAAGGTCAAGG - Intronic
1056033774 9:82582841-82582863 GCAGTGGTGATCCCAGGTGGTGG + Intergenic
1057832785 9:98419610-98419632 GCTGCGGAGGGCCCAGGTCAGGG + Intronic
1057872356 9:98727913-98727935 GCTGTGCAGAGCCCAGGGCTCGG - Intergenic
1058133368 9:101278618-101278640 GCTGTGGTGGGCCCAGGGTTGGG - Intronic
1058696625 9:107564479-107564501 CCTTTGAAGAGCCCAGGTCTTGG - Intergenic
1061203398 9:129149893-129149915 GCTGTGGAGAGCTCAGGCCTGGG + Intergenic
1061404216 9:130384701-130384723 GCTGGGGAGAGCACGGCTGTCGG + Intronic
1061778874 9:132984315-132984337 GGTGTGGGGAGCCCTGGTGAGGG + Intronic
1062475411 9:136724293-136724315 GTTGTGCACAGCCCAGGTTTGGG - Intergenic
1062535550 9:137019708-137019730 GGAGTGGAGAGCCCGGGCGTGGG - Intronic
1186733953 X:12441119-12441141 GCTGTTGAAAGCCCAGCTGGAGG + Intronic
1186907339 X:14125849-14125871 GCTTTGGAGAGCACAGGGCTTGG + Intergenic
1187322741 X:18255437-18255459 GGCATGGAGAGCACAGGTGTTGG - Intronic
1189003611 X:36971968-36971990 GGTGTGGAGGGCCCAGGTGGAGG + Intergenic
1189046025 X:37591927-37591949 GGTGTGGAGGGCCCAGGTGGAGG - Intronic
1190291631 X:48996946-48996968 GCTGTGGTGCTCCAAGGTGTTGG - Intronic
1190960331 X:55240693-55240715 GCTGTGGAGATGCAAGGTGGTGG + Intronic
1200357339 X:155565698-155565720 GCTCTGCTGAGCACAGGTGTTGG + Intronic