ID: 1103478183

View in Genome Browser
Species Human (GRCh38)
Location 12:121233558-121233580
Sequence GGCTGTGGAGAGCCCAGGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 495}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103478183_1103478191 2 Left 1103478183 12:121233558-121233580 CCACACCTGGGCTCTCCACAGCC 0: 1
1: 0
2: 6
3: 54
4: 495
Right 1103478191 12:121233583-121233605 ATCAAAGAACAGAGAGGAGGAGG 0: 1
1: 0
2: 2
3: 56
4: 669
1103478183_1103478194 14 Left 1103478183 12:121233558-121233580 CCACACCTGGGCTCTCCACAGCC 0: 1
1: 0
2: 6
3: 54
4: 495
Right 1103478194 12:121233595-121233617 AGAGGAGGAGGAGGGAGAAATGG 0: 1
1: 12
2: 219
3: 1639
4: 8255
1103478183_1103478192 5 Left 1103478183 12:121233558-121233580 CCACACCTGGGCTCTCCACAGCC 0: 1
1: 0
2: 6
3: 54
4: 495
Right 1103478192 12:121233586-121233608 AAAGAACAGAGAGGAGGAGGAGG 0: 1
1: 0
2: 45
3: 498
4: 3211
1103478183_1103478189 -1 Left 1103478183 12:121233558-121233580 CCACACCTGGGCTCTCCACAGCC 0: 1
1: 0
2: 6
3: 54
4: 495
Right 1103478189 12:121233580-121233602 CCCATCAAAGAACAGAGAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 275
1103478183_1103478186 -4 Left 1103478183 12:121233558-121233580 CCACACCTGGGCTCTCCACAGCC 0: 1
1: 0
2: 6
3: 54
4: 495
Right 1103478186 12:121233577-121233599 AGCCCCATCAAAGAACAGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 166
1103478183_1103478193 6 Left 1103478183 12:121233558-121233580 CCACACCTGGGCTCTCCACAGCC 0: 1
1: 0
2: 6
3: 54
4: 495
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103478183 Original CRISPR GGCTGTGGAGAGCCCAGGTG TGG (reversed) Exonic
900155813 1:1202894-1202916 GAGTGTGGAGAGCCCAAGGGTGG - Intergenic
900313102 1:2043873-2043895 GGGTCTGGAGAGGCCAGGGGAGG - Intergenic
900399172 1:2466025-2466047 GGACATGCAGAGCCCAGGTGTGG + Intronic
900402198 1:2477165-2477187 GCCTGTGGAGGGCCCCGGTCCGG + Intronic
900622388 1:3593412-3593434 GGGGGTGGAGAGCCCGGGCGGGG - Intronic
900689442 1:3971453-3971475 GGGACTGGACAGCCCAGGTGTGG + Intergenic
901020514 1:6252903-6252925 GGCTGGGGAAGGCCAAGGTGAGG - Intronic
901050149 1:6421903-6421925 GGCTGGGGTGAGCCCAGCAGAGG + Intronic
901635984 1:10670382-10670404 GGCTGTGGGGGACACAGGTGGGG - Intronic
901775643 1:11558881-11558903 TGCTGTGGATAGCCCAGGCTGGG - Intergenic
901857802 1:12055426-12055448 GGCTGAGAAGGCCCCAGGTGGGG - Intergenic
902287147 1:15414028-15414050 GGCTGTTGTCAGCCCAGGGGTGG - Intronic
902526399 1:17060731-17060753 GGTAGTGGAGAGCCCAGCTGGGG + Intergenic
902530514 1:17087794-17087816 GGCTGTGATGAGGCCGGGTGTGG - Intronic
902675633 1:18006679-18006701 GGCTCTGCAGAGCCCAACTGGGG - Intergenic
903134908 1:21302973-21302995 GGCTGGGTAGAGCCCAGGCCCGG - Intronic
903266605 1:22161566-22161588 GGCTGGGGAGAACCCAGGAGCGG - Intergenic
903699668 1:25237455-25237477 GCCAATGGAGAGGCCAGGTGTGG - Intergenic
903762306 1:25707325-25707347 CTCTGTGCAGAGCCCAGGTAGGG + Intronic
904124024 1:28223416-28223438 GGGAGTTCAGAGCCCAGGTGTGG + Intronic
904377907 1:30093448-30093470 GGCAGTGGAGAGGCCAGAAGGGG + Intergenic
904380384 1:30106869-30106891 GGCTTTGGAGAGGCGAGGAGAGG - Intergenic
904654810 1:32036796-32036818 AGCTCTTGAGAGCCCAGATGAGG - Intronic
905016292 1:34781250-34781272 GGCTTTGGAGAGCTGGGGTGGGG - Exonic
905117730 1:35656913-35656935 GGCTGTGCAGGGCCCAGGGTAGG + Intergenic
905714032 1:40132855-40132877 GGCTGAGGAGCGGCCTGGTGCGG - Intergenic
906227432 1:44133369-44133391 GGCTGTGGAGACCCATGGTGAGG + Exonic
906344518 1:45006812-45006834 GGCTCTTGAGTGCCCAGCTGAGG - Intronic
911188642 1:94927125-94927147 GCCTGTGGGGAACCGAGGTGCGG - Exonic
912548010 1:110465297-110465319 GGCTTTCCAGAGTCCAGGTGGGG - Intergenic
915173009 1:153991207-153991229 GGATGTGAAATGCCCAGGTGAGG + Exonic
915300397 1:154948226-154948248 GGCTGTGGAGAACCAGGCTGGGG - Exonic
915447777 1:155983927-155983949 GGCTGTGGAGCTCCCAGCAGAGG - Intronic
915600148 1:156917685-156917707 GGCTGTAGTGAGGCCAGGTGCGG + Intergenic
915930395 1:160057322-160057344 GGGTGTGGAGAGGCAACGTGAGG - Intronic
916044751 1:160991065-160991087 GGTTGTGGTGAGCCGAGGTCTGG + Intergenic
916303219 1:163299282-163299304 GGCTGTAGAGAAGCCAGTTGAGG + Intronic
917597399 1:176543209-176543231 GGCTTTGGGGAGTCCATGTGTGG + Intronic
918060966 1:181060949-181060971 GACTGTGGAGACCCCTGCTGAGG + Exonic
920551712 1:206867097-206867119 GGTTGTGGGGAGGCCAGATGGGG + Intronic
920565376 1:206968855-206968877 GGCTGGGCAGAGCCAAGCTGAGG - Intronic
922536265 1:226383073-226383095 GGCTGTGGAGGGCGGAGGCGTGG + Exonic
922721696 1:227903154-227903176 GTCTGTGAACGGCCCAGGTGGGG - Intergenic
922726363 1:227924825-227924847 GGCAGTGGAGAGCCCCTGGGAGG + Intronic
922807261 1:228396922-228396944 AGGTGTGGAGGCCCCAGGTGGGG - Intronic
922955347 1:229594693-229594715 GGCTGTGGAGCGCTCAGCAGGGG - Exonic
923243487 1:232108816-232108838 GGCTGTGGAGGCCCCAGGGTTGG + Intergenic
923329515 1:232909615-232909637 GCCTATGGAAAGCCCAGGTTGGG - Intergenic
923472884 1:234307926-234307948 GGCCGTGGGGAGCTCGGGTGTGG - Intronic
923781860 1:237031992-237032014 GGCTGGGGAGAGGTGAGGTGCGG - Intergenic
924015044 1:239711959-239711981 GGCTCTGGGGAGCCCTGGTATGG - Intronic
924743571 1:246812492-246812514 GGCTCTCCATAGCCCAGGTGAGG - Intergenic
1062837617 10:646309-646331 GGGTGTGGAGAGCCTGGGGGAGG - Intronic
1063141021 10:3256758-3256780 GCCTGTGGAGAGACCAGGCCAGG + Intergenic
1063210155 10:3872924-3872946 GGCTCTGGAGAGCGCAGGTGAGG + Intergenic
1063969313 10:11370441-11370463 GCTTGTGGTGAGCCGAGGTGGGG + Intergenic
1066395921 10:35021798-35021820 GGGTGAGGAGAGGCGAGGTGGGG + Intronic
1067066503 10:43106837-43106859 GTCGGTGGTGAGCCCTGGTGAGG - Intronic
1067268249 10:44766302-44766324 GGCTGTGGAGAAACCAGGCCTGG - Intergenic
1067293729 10:44962534-44962556 GGCAGTGGACAGCACAGGTGAGG + Intronic
1067540108 10:47144818-47144840 GGCTGTGATGAGCCCTGGTGAGG + Intergenic
1068582074 10:58753085-58753107 GGCTTTGGGGAGCCCAGCAGAGG - Intronic
1069567598 10:69474163-69474185 GGCGGTGGGGAGAGCAGGTGGGG - Intronic
1069575895 10:69528336-69528358 GGCTGGGGAGCTCCCAGGTCTGG + Intergenic
1069787974 10:71001526-71001548 GGCTCAAGAGAGCTCAGGTGTGG - Intergenic
1069989507 10:72306253-72306275 TGCTTTGGGGAGGCCAGGTGTGG - Intergenic
1070440328 10:76436644-76436666 GGGTGTGAAGAGCACAGGGGTGG - Intronic
1071475133 10:86019290-86019312 GCCTGTGCAGAGCACAGCTGGGG - Intronic
1071872451 10:89810193-89810215 GGCTGAGGGAAGCCCAGGTAAGG + Intergenic
1073124223 10:101139924-101139946 GGGGGTGGAGAGCCCAGGCTTGG - Intergenic
1073673987 10:105624330-105624352 GGCTCTGGAGCACCTAGGTGAGG + Intergenic
1074059434 10:109951419-109951441 GCCTTTGGAGAGCCCATCTGGGG - Intronic
1075655256 10:124156860-124156882 TGCAGCTGAGAGCCCAGGTGTGG + Intergenic
1075737368 10:124672296-124672318 GGCTGTTGAGAGCCCAGTGAGGG - Intronic
1075949028 10:126461500-126461522 TGCTGGGGAGGGCTCAGGTGTGG + Exonic
1076135761 10:128045045-128045067 TGGTGTGGGGAGGCCAGGTGGGG - Intronic
1076138803 10:128063817-128063839 GGCTGTGGGGAGCCTGGGTGCGG + Intronic
1076451278 10:130558497-130558519 GGATGGAGAGAGCACAGGTGTGG + Intergenic
1076479969 10:130778450-130778472 GACTGTGGGGAGGCCAGGTGGGG + Intergenic
1076785093 10:132745697-132745719 GGGTGTGGTGGGCCCAGGCGTGG + Intronic
1076785154 10:132745865-132745887 GGGTGTGGTGGGCCCGGGTGTGG + Intronic
1076825027 10:132962629-132962651 GGCAGGGGAGCCCCCAGGTGGGG - Intergenic
1076852048 10:133098100-133098122 GGCTGTGGCCAGCACAGGTATGG - Intronic
1076875678 10:133214501-133214523 GTGTGTGGTGAGCACAGGTGGGG - Intronic
1077042834 11:532144-532166 GGCTATGGAGAGCCCAGGGCTGG + Intergenic
1077141314 11:1026140-1026162 AGCTGTGGAGACAGCAGGTGTGG + Exonic
1077425276 11:2473164-2473186 GGCTGAGGAGAGGCCAGGACGGG + Intronic
1077477425 11:2797079-2797101 TGCTGGAGACAGCCCAGGTGAGG - Intronic
1078151544 11:8763931-8763953 AGCAGTAGAGAGGCCAGGTGTGG + Intronic
1079110355 11:17601906-17601928 GGCTGTGGAGAGACAATGGGGGG + Intronic
1079379462 11:19924801-19924823 CGCTGTGGAGAGATCTGGTGTGG + Intronic
1080791529 11:35525961-35525983 GGCTGCGGGGCGCTCAGGTGAGG + Intronic
1081630785 11:44688281-44688303 GGCAATGGAGAGTCCAGGTTTGG - Intergenic
1081665195 11:44912515-44912537 GCCTGTGGATAGCCCTGGTCTGG - Intronic
1081722702 11:45301970-45301992 GCCTTTGGAGGCCCCAGGTGGGG - Intergenic
1081747329 11:45482382-45482404 CTCTCTGGAAAGCCCAGGTGAGG + Intergenic
1083222006 11:61258750-61258772 GGCTGTGGAGAGTCTAGAGGTGG + Exonic
1083269801 11:61566282-61566304 GGCTGTGGTGAGGTGAGGTGAGG - Intronic
1083669490 11:64292097-64292119 GTCTGCGGAGAGTGCAGGTGGGG + Intronic
1083755941 11:64791806-64791828 GGCTGTGGGGAGCCTAGTTTGGG + Intronic
1083993792 11:66262176-66262198 GGATGAGCAGAGCCCAGGTGCGG + Exonic
1084117830 11:67052274-67052296 GGCAGTGGGGAGCCATGGTGGGG + Intergenic
1084238235 11:67801874-67801896 GGCTGTGGTGAGCCAAGATCGGG - Intergenic
1084485450 11:69445230-69445252 GCCTGTGGAGGGACCAGCTGTGG - Intergenic
1084498912 11:69523120-69523142 GGCTGTTGTGAGGACAGGTGAGG + Intergenic
1084521568 11:69666373-69666395 GGGTGTGGAGAGCCAGCGTGTGG + Exonic
1085637161 11:78167750-78167772 GGCTCTGGAGAGCCAGGGTGAGG - Intergenic
1086351811 11:85949907-85949929 GCCTGTGGAGATCCCATGAGTGG - Intergenic
1086966431 11:93032793-93032815 GGATGTGGAGAGCACAGGCCAGG + Intergenic
1088770977 11:113036102-113036124 GGCTTGGAAGAGCCCGGGTGGGG - Intronic
1088826394 11:113497867-113497889 GCCTGTGGAGAGCCCACATTGGG + Intergenic
1089408543 11:118219405-118219427 AGCTGGGGAGGACCCAGGTGAGG + Intronic
1089587262 11:119518184-119518206 GGGCGTGGTGAGGCCAGGTGTGG - Intergenic
1089675554 11:120086266-120086288 GGCTGTGGAGATGCCAGCTCTGG - Intergenic
1090715576 11:129427623-129427645 GGGTGTGGAGAGTCAATGTGGGG + Intronic
1092149588 12:6238404-6238426 GGCTGTGGTGAGCCAAGATCGGG - Intergenic
1094452477 12:30597176-30597198 GGCTGGAGAGAGACCGGGTGTGG + Intergenic
1095618156 12:44217298-44217320 GGATGTGGAGAGTGCAGGTGAGG + Intronic
1096106341 12:48998637-48998659 GGCTGTGGGGATCCCGGGCGCGG + Exonic
1096114850 12:49049893-49049915 GGGTCTGGAGAGCCCAGGAGGGG + Exonic
1096707240 12:53430001-53430023 GGCGGGGGGGAGCCCAGGAGAGG - Intronic
1099262463 12:80400421-80400443 GGCTGTGAATAGCCCAGTTTTGG - Intergenic
1099889911 12:88578925-88578947 CGCTGTGGTGATTCCAGGTGCGG + Intronic
1101897324 12:108766614-108766636 GGCTCTGGGGAGCCAAGGAGGGG - Intergenic
1102245520 12:111353350-111353372 GAGAGTGGAGAGCCCAGCTGGGG + Intergenic
1103474397 12:121208075-121208097 GGCTATGGAGTGGACAGGTGAGG - Intergenic
1103478183 12:121233558-121233580 GGCTGTGGAGAGCCCAGGTGTGG - Exonic
1103620532 12:122184581-122184603 GGATGTGGTGAGCCCCGGAGAGG + Exonic
1103811522 12:123617993-123618015 GGCAGTGGGGGGCCCTGGTGGGG + Intronic
1104024208 12:125014260-125014282 GGCTGGAAAGAGCCCAGCTGGGG - Intronic
1104479075 12:129091582-129091604 GGGTCTCCAGAGCCCAGGTGAGG - Intronic
1104646123 12:130498677-130498699 GCCTGTGGAGAGGCCACATGAGG + Intronic
1104878970 12:132056014-132056036 GAACGTGGAGACCCCAGGTGTGG + Intronic
1104884780 12:132100417-132100439 GGCTCTGGGGAGGCCAGATGAGG - Intronic
1104939863 12:132390012-132390034 GGCTGGACTGAGCCCAGGTGGGG - Intergenic
1106172404 13:27299250-27299272 TTCTGTGAAGGGCCCAGGTGAGG - Intergenic
1106504754 13:30361308-30361330 GACTGAGGAGAGATCAGGTGGGG - Intergenic
1107293185 13:38880568-38880590 GGCTGTTGAGCTCCCAGGGGAGG - Exonic
1107851805 13:44577982-44578004 GCCGGGGGCGAGCCCAGGTGCGG - Intergenic
1107887323 13:44884632-44884654 AGCTGTGGAGAGGCCACGTGGGG - Intergenic
1113255399 13:108499911-108499933 GGCTGAGGAGAGCTCAGGAATGG - Intergenic
1113630122 13:111876653-111876675 AGCTATTGAGAGCCCAGGCGAGG + Intergenic
1113871469 13:113562435-113562457 GGCTGGAGAGGGCCCCGGTGTGG + Intergenic
1114474629 14:22985160-22985182 GACTGTGGAGAGGCCACCTGAGG - Intergenic
1117326169 14:54671005-54671027 GGATGTGCAGAGCTCAGGCGTGG + Intronic
1117532577 14:56673983-56674005 GGCAGAGGTGAGGCCAGGTGCGG + Intronic
1118336337 14:64856304-64856326 AGCTGTGAAGAGTCCTGGTGAGG - Intronic
1118594179 14:67423348-67423370 GGCTGTGGAGGGTGGAGGTGAGG - Intergenic
1119189439 14:72670385-72670407 GGCTGGTCAGGGCCCAGGTGTGG + Exonic
1119420497 14:74505306-74505328 GGTTGTGGAGAGCCTCAGTGAGG - Intronic
1119787994 14:77327117-77327139 GGCACTGGAGAGCCCAGGCTAGG - Intronic
1120646617 14:87082049-87082071 GGCTGTAGTGAGCCCAGATCGGG - Intergenic
1121173056 14:91870442-91870464 GGCAAGGGAGCGCCCAGGTGGGG - Intronic
1121361082 14:93260614-93260636 GGTTGTGGTGAGCCGAGATGGGG - Intronic
1121688144 14:95855079-95855101 GGATGTGGACTGCCCAGGTGGGG + Intergenic
1122016361 14:98800186-98800208 GGCAGTGGTGAGCCAACGTGAGG - Intergenic
1122290478 14:100678085-100678107 GGCTGTGGCGAGCCAAGGGGCGG - Intergenic
1122318487 14:100839559-100839581 ACCTGTGGGCAGCCCAGGTGTGG - Intergenic
1122342794 14:101039214-101039236 GGATGTGAAGAGGCCAGGGGTGG + Intergenic
1122399750 14:101459406-101459428 GGCTGTGGAGAGACCCGGCCGGG - Intergenic
1122574346 14:102732278-102732300 GGCTCGGGAGAGGCCTGGTGAGG + Intergenic
1122669329 14:103358157-103358179 GGCTGTGGTGAACCAAGATGGGG + Intergenic
1122717678 14:103705411-103705433 GGCTGTGGACAGCCCAGCGGTGG + Intronic
1122874948 14:104659671-104659693 GGCTGTGGAGCACCCTGGGGGGG - Intergenic
1123027389 14:105433150-105433172 GGCTCAGGAGAGACCAGGGGTGG + Intronic
1123973368 15:25529581-25529603 GCCTGTGGCAAGGCCAGGTGTGG + Intergenic
1124067189 15:26355178-26355200 TGCTGGGGAGGACCCAGGTGAGG - Intergenic
1125336618 15:38632606-38632628 GGCTGCGGAGAGCTGGGGTGGGG + Intergenic
1126309352 15:47298246-47298268 CCCTGTGGAGCTCCCAGGTGTGG + Intronic
1127187336 15:56493181-56493203 TGCTGGGGCGAGACCAGGTGGGG + Intergenic
1128308163 15:66613648-66613670 AATTGTGGAGAGCCCCGGTGGGG + Intronic
1128314183 15:66649933-66649955 GCCTGGGCAGAGCCCAGGTGTGG - Intronic
1129238784 15:74239775-74239797 GGGTGTGGTGAGCCCTGGGGAGG - Intronic
1129413739 15:75363384-75363406 GGCACTGGAGAGCACAGGAGAGG - Intronic
1129656457 15:77528179-77528201 GGCTCTGCAGTGCCCAGGTCTGG + Intergenic
1131395650 15:92083811-92083833 CGCTGTGGAAAGCCCTTGTGAGG + Intronic
1131590311 15:93741097-93741119 GGCTTTGAAGAGTCCAAGTGAGG - Intergenic
1132431668 15:101766243-101766265 GGGTGGGGAGGGCACAGGTGCGG - Intergenic
1132643787 16:989687-989709 GGCTGTGGGGAGCAGAGGTGGGG - Intergenic
1132648248 16:1008912-1008934 GACTGTGGAGATCTCAGGGGTGG + Intergenic
1132696840 16:1205799-1205821 GGCTGTGGAAGGCCCAGGATAGG + Intronic
1132728000 16:1347063-1347085 CGCTGTGGACAGCCCTGGAGTGG - Intronic
1132991872 16:2799574-2799596 GGCTGGGGATAGACCGGGTGGGG + Intergenic
1133554926 16:6897032-6897054 AGGTGTGGAGAGCTCAGGTCTGG - Intronic
1134201884 16:12205978-12206000 AGCTGTGGAGAGCCTAGTAGTGG + Intronic
1134416028 16:14044211-14044233 GCTTGTGGAGAACCTAGGTGAGG - Intergenic
1135119753 16:19755636-19755658 GGCTGTTCAGGGCACAGGTGAGG - Intronic
1135504643 16:23025873-23025895 AGCAGTGGAGAGCTCTGGTGGGG - Intergenic
1135705390 16:24670636-24670658 GGCTGGGCAGGGCACAGGTGGGG - Intergenic
1135957745 16:26970514-26970536 GGCTGGGGCCAGCCCATGTGTGG - Intergenic
1136044132 16:27602147-27602169 GCCTGAGGACAGCCCAGGAGGGG - Intronic
1136620893 16:31427856-31427878 GGCTGTGGAGAGAGCGGGGGAGG + Exonic
1136907977 16:34119804-34119826 GACTCTGGACTGCCCAGGTGTGG - Intergenic
1138192710 16:55029165-55029187 GGCTATGATGTGCCCAGGTGTGG + Intergenic
1139156365 16:64447596-64447618 GCCTGTGGAAAGGCCAGGAGAGG + Intergenic
1139588530 16:67919835-67919857 GGCTCTGGGGAGCCCAGTGGTGG - Intronic
1139778129 16:69329991-69330013 GGCGGTGCAGATCTCAGGTGCGG - Exonic
1140294467 16:73694973-73694995 GGCAGTTGAGAGCCACGGTGTGG + Intergenic
1141599074 16:85114364-85114386 GGCTCTGGAGAGACCCTGTGGGG - Intergenic
1141658429 16:85428682-85428704 GGCTGTGGACAGTCCAGTTCAGG - Intergenic
1141901411 16:86993592-86993614 GGCTGCGGCGAGGCCAGCTGAGG - Intergenic
1141950560 16:87336521-87336543 GGCTACAGGGAGCCCAGGTGAGG + Intronic
1141997909 16:87646989-87647011 GGCTGGGGGCAGCACAGGTGAGG + Intronic
1142008965 16:87704233-87704255 GCCTGTGGAGAGCCCTGGGGAGG + Intronic
1142149408 16:88506075-88506097 GCCAGTGGAGAGCCCAGGGTGGG - Intronic
1142181347 16:88672368-88672390 TGCTGGGCAGAGCCCAGCTGGGG + Intergenic
1142238714 16:88935402-88935424 GGCTCTGGAGGGCCCAAGTCAGG + Intronic
1142278161 16:89133688-89133710 GGATGTGGAGGGCACAAGTGTGG - Intronic
1143053001 17:4142444-4142466 TGCTTTGGAGAGGCCAGGCGGGG - Intronic
1143322299 17:6075957-6075979 GGCTGGGGAGACACCATGTGTGG + Intronic
1143520514 17:7441711-7441733 GGATGAGGGGAGCTCAGGTGAGG + Intronic
1144386085 17:14750526-14750548 TACTGTCCAGAGCCCAGGTGTGG - Intergenic
1144647748 17:16987115-16987137 GGCAGTGGAGGGCTCAGCTGTGG - Intergenic
1144729709 17:17519389-17519411 GGCTGGGCAGATGCCAGGTGAGG + Intronic
1145747073 17:27328301-27328323 AGCTGTGCAGGGGCCAGGTGCGG + Intergenic
1146052529 17:29565388-29565410 GGCTGCAGAGAGCCCTGGTCAGG - Intronic
1146357064 17:32142939-32142961 ATCTCTGGAGGGCCCAGGTGAGG - Intronic
1146728866 17:35177031-35177053 GGCTTTGGAGGGCACAGATGTGG + Exonic
1147453587 17:40520929-40520951 GGCTGCACAGAACCCAGGTGTGG - Intergenic
1148236129 17:45970462-45970484 CCCTGTGGACAGCCCAGGTGGGG + Intronic
1148428242 17:47619489-47619511 GGTTGTGGTGAGCCGAGATGAGG + Intronic
1148480300 17:47955684-47955706 GGCTGTGCTAAGCCCAGGTGGGG - Intronic
1148539701 17:48470578-48470600 GGATGGAGAGAGGCCAGGTGTGG - Intergenic
1149446303 17:56715901-56715923 GGCTGTTTAGAGCCCAAATGAGG + Intergenic
1149657491 17:58318054-58318076 GGCTGGGGTGGCCCCAGGTGGGG + Intronic
1150136535 17:62698508-62698530 GGCAGTGATGAGGCCAGGTGCGG - Intergenic
1150529257 17:65959552-65959574 GGCTCGGGAGCGCCCAGGTCTGG - Intronic
1150625640 17:66839496-66839518 GGGTTTAGAGAGCACAGGTGAGG + Intronic
1150791221 17:68201273-68201295 TGCTGAGGAGGGCGCAGGTGCGG + Intergenic
1151671575 17:75574163-75574185 GGCCGAGGAGGGCCCAGGCGGGG + Intronic
1151751971 17:76044387-76044409 GGCTCTGCTGAGCCCAGGAGAGG - Intronic
1152294547 17:79459101-79459123 GGCTGTGGAGTGCCTAGGGGAGG - Intronic
1152407290 17:80104933-80104955 GGCTGCAGGGAGCCCAGATGGGG + Intergenic
1152537745 17:80960349-80960371 GGCTTTGGGGAGCCCAGGACTGG - Intronic
1152567960 17:81108548-81108570 GGGTGTGAAGAGGCCGGGTGGGG + Intronic
1152624574 17:81382339-81382361 GGACGTGGAGAGCCCTGGTGAGG - Intergenic
1152718641 17:81911679-81911701 CGGTGCGGAGAGGCCAGGTGTGG - Intergenic
1152862424 17:82703858-82703880 GGGTGTGAAGAGGTCAGGTGAGG - Intergenic
1152862468 17:82704012-82704034 GGGTGTGAAGAGGTCAGGTGAGG - Intergenic
1152911911 17:83010007-83010029 GGCTGTGGGGGCCCCTGGTGTGG + Intronic
1154051354 18:10962333-10962355 GGCTGTGGGGAGCCGAGGGAGGG - Intronic
1154165394 18:12010763-12010785 GGGTGAGCAGAGCCCGGGTGTGG + Intronic
1155442897 18:25880732-25880754 GTATCTGGAGAGCCCAGCTGAGG + Intergenic
1157294303 18:46431518-46431540 GGCTGTGGAGGGTGCAGGGGAGG + Intronic
1157442290 18:47720116-47720138 GGCTGTGGAGAAGCCATGTTGGG - Intergenic
1158542557 18:58369989-58370011 GGCAGTGCAGAGCCCACATGGGG - Intronic
1158630698 18:59111759-59111781 GGCTGCAGAGAGCCCCTGTGGGG + Intergenic
1159076238 18:63684935-63684957 GGCTGAGTGGGGCCCAGGTGGGG - Intronic
1160014054 18:75127466-75127488 GGCGGTGAGGGGCCCAGGTGGGG - Intergenic
1160123584 18:76151188-76151210 GGCTGTGGGTACCCCAGGGGTGG + Intergenic
1160207959 18:76852395-76852417 GCCTGTGGAGCTCCCAGGAGTGG - Intronic
1160373259 18:78391432-78391454 GGCTGTGCAGGGCCGTGGTGTGG + Intergenic
1160511252 18:79454748-79454770 GGCTGTGGGGAGCCGAGGGCCGG + Intronic
1160695785 19:483671-483693 CCCTGTGGACATCCCAGGTGGGG - Intergenic
1160825090 19:1076037-1076059 GGCTGTGCAGGGCTCAGCTGAGG + Intronic
1160948476 19:1654438-1654460 GACTGTGGACAGCCCAGTTTGGG - Intergenic
1161451216 19:4346478-4346500 GGCTGTAGTGAGCCAAGATGGGG - Intronic
1162041080 19:7971431-7971453 GGCTGTGCAGGGCCCAGGGCCGG - Intronic
1163335988 19:16671949-16671971 GCCTGTGCAGAGGCCAGGTCGGG - Intronic
1163692327 19:18744557-18744579 GGACGTGGCGAGCCCGGGTGTGG + Intronic
1163702209 19:18791502-18791524 GTCTGTGGAGAGAGCTGGTGGGG + Intergenic
1164537653 19:29098328-29098350 GGCTGTGGATACCCCACGTGTGG + Intergenic
1164615969 19:29666913-29666935 GGCTGGACAGAGCCCAGGGGCGG + Intronic
1165045270 19:33099831-33099853 GGCTGTGGTGAGCCAAGATCAGG - Intronic
1165144951 19:33724881-33724903 GGCTGGGGTGTGCCGAGGTGTGG - Intronic
1165166898 19:33863309-33863331 GGGTGGAGAGAGCCCAGGAGGGG + Intergenic
1165230506 19:34383637-34383659 GGGTCTGCAGAGCCCAGATGCGG + Intronic
1165905597 19:39192749-39192771 GGCTTTGCAGGGCCCAGCTGTGG + Intergenic
1166323797 19:42036820-42036842 GGGTGTGGAGGCCACAGGTGAGG + Intronic
1166514127 19:43433063-43433085 GGCTGTAGAGAGCTGAGGTGGGG - Intergenic
1167117836 19:47498332-47498354 GGCTGTGGGGAGCCCAGGGCAGG + Intronic
1167147964 19:47694196-47694218 GGGTGTGGGGAGGGCAGGTGGGG - Exonic
1168265984 19:55224373-55224395 GCCTGGGGAGGGCCCAGATGGGG + Intergenic
925596924 2:5564266-5564288 GGTGGTGGAGTGCCCGGGTGTGG - Intergenic
925596945 2:5564347-5564369 GGTGGTGGAGTGCCCGGGTGTGG - Intergenic
927467709 2:23349752-23349774 GGACCTGGAGAGGCCAGGTGGGG - Intergenic
928070336 2:28208804-28208826 GGCTCTGGAGTTGCCAGGTGGGG + Intronic
928114076 2:28533384-28533406 GGCTGTGGAGAGAACAAATGAGG - Intronic
928193295 2:29193798-29193820 GCCTGTTGAGAGACCAGGAGAGG + Exonic
928757887 2:34547550-34547572 GGCTGTGGTAAGCACAGATGGGG + Intergenic
930013876 2:46957648-46957670 GGCTGTGGACAGCCCAGCTGGGG + Intronic
930894410 2:56428572-56428594 GGTTGTGGTGAGCCCAGGTCGGG - Intergenic
932593271 2:73079749-73079771 GGCAGGGGAGCCCCCAGGTGGGG + Intronic
932909474 2:75790900-75790922 GGCCTTGGGGTGCCCAGGTGAGG + Intergenic
932944854 2:76216254-76216276 GGCAGTGGATAGCACAGGAGAGG - Intergenic
933820872 2:86111065-86111087 GGCTATGAAGAGCCCTGATGAGG + Intronic
936155478 2:110043937-110043959 AGCTGGGGAGAGGCCAGGTTGGG - Intergenic
936189208 2:110327497-110327519 AGCTGGGGAGAGGCCAGGTTGGG + Intergenic
936251373 2:110870687-110870709 GGCAGGTGAGAGTCCAGGTGTGG - Intronic
936343322 2:111656686-111656708 GGGAGTGGAGAGCCCACTTGAGG - Intergenic
936410552 2:112254657-112254679 GGCTGTCGAGAGCCTGGGCGGGG - Intronic
936510243 2:113139368-113139390 GGAGGTGGAGCGCTCAGGTGGGG - Intergenic
937238472 2:120444918-120444940 CCCTGTGGAGAGGCCAAGTGGGG - Intergenic
937890227 2:126933172-126933194 GGCTGGGGGGAGTCCATGTGTGG - Intergenic
938308599 2:130270220-130270242 GAGTGTGGGGAGCCCAGGAGTGG + Intergenic
938368610 2:130755395-130755417 GGCCGTGGTGTGCCCAGGCGGGG - Intergenic
940013831 2:149082768-149082790 GGCAGTGGAGGGCCCAGGCTGGG + Intronic
940796830 2:158089281-158089303 GGCTGCAGAGAAGCCAGGTGAGG - Intronic
940984424 2:160038483-160038505 GGCGCTCCAGAGCCCAGGTGGGG + Intronic
941079276 2:161041287-161041309 GGCTGTGGAGAGCTGAGATCTGG - Intergenic
942089075 2:172471197-172471219 GGCTGAGAAGAGGCCAGGTGGGG + Intronic
942548570 2:177091007-177091029 GGGTGTGGAGTGCCCAGGTGTGG - Intergenic
943360366 2:186911752-186911774 GGCTGAGGAGGGACAAGGTGAGG - Intergenic
944662658 2:201934190-201934212 GGCTGTGGGGGGCCCAGGGCTGG + Intergenic
947745653 2:232506180-232506202 GGCTGTGAAGAGCCCAGAGAGGG + Intergenic
947866569 2:233402023-233402045 GGCTGGGGAGAGGCCAGGCTGGG - Intronic
948086787 2:235257033-235257055 GACTGAGGAGAGCCCAGCAGGGG - Intergenic
948163586 2:235844354-235844376 GGCTGAGGAGGGCGCAAGTGAGG - Intronic
948564418 2:238874762-238874784 TGCTGTGGGGAGCCCAGGGCAGG - Intronic
948795909 2:240402003-240402025 GGACCTGGAGAGCCCAGGTCAGG - Intergenic
948834784 2:240620653-240620675 GGCTGTGGGGACCCCCTGTGGGG + Intronic
949014818 2:241702906-241702928 GGCTCTGGAGGGCCCTTGTGGGG + Intronic
1168830756 20:844154-844176 CCCTGTGGGGAGTCCAGGTGGGG + Intronic
1168968329 20:1913564-1913586 GTCAGTGGAGAGCCCAACTGGGG + Intronic
1171043380 20:21788035-21788057 GGAGGTGTAAAGCCCAGGTGTGG - Intergenic
1171365040 20:24617715-24617737 GGCCAAGGAGAGCCCAGGGGAGG + Intronic
1171815022 20:29778352-29778374 GACTCTGGACTGCCCAGGTGCGG + Intergenic
1171903414 20:30878368-30878390 GACTCTGGACTGCCCAGGTGCGG - Intergenic
1172131967 20:32661853-32661875 GTCTGTGGGGAGCACAGGTGTGG - Intergenic
1172641077 20:36440815-36440837 GGCAGTGGGGCGGCCAGGTGCGG + Intronic
1172664853 20:36591964-36591986 GGCAGTAGTTAGCCCAGGTGTGG + Exonic
1172800613 20:37573783-37573805 GGCTGGGGTGAGCTGAGGTGGGG + Intergenic
1172995139 20:39064832-39064854 GGGGGTGGGGAGGCCAGGTGGGG - Intergenic
1173579008 20:44132945-44132967 AGCTGTGGAGGGGCCCGGTGGGG - Intronic
1175197019 20:57251201-57251223 TGCTGTGAAGATCCCATGTGGGG - Intronic
1176044838 20:63087178-63087200 GGCCGGGGTGAGCCCAGCTGTGG + Intergenic
1176052353 20:63126604-63126626 GACAGTGGAGAGACCAGGAGTGG + Intergenic
1176160143 20:63643569-63643591 GGATGGGGAGAGGCCGGGTGTGG - Intronic
1176229999 20:64027730-64027752 GGCTGTGGTGAGTCCTGGAGGGG + Exonic
1176388901 21:6153649-6153671 GTGTGTGGTGAGCTCAGGTGAGG + Intergenic
1176870151 21:14077549-14077571 GGCTGTGGTGAGCCAGGGTCAGG + Intergenic
1178530096 21:33368874-33368896 GGCTGAGCAAAGCCCAGGTGAGG + Intergenic
1179295703 21:40060480-40060502 GGTTGTGCAGAGCACAGTTGAGG + Intronic
1179444141 21:41419881-41419903 AGCTTTGGAGAGCCAAGCTGGGG - Intergenic
1179569224 21:42268226-42268248 GGCTGAGCAGAGCTCAGGGGTGG + Intronic
1179639577 21:42738506-42738528 GGGTGGGGAGAGCCGAGCTGGGG - Intronic
1179734571 21:43384599-43384621 GTGTGTGGTGAGCTCAGGTGAGG - Intergenic
1179783655 21:43718305-43718327 AGCTGTGGAGAGCGTAGGGGTGG + Intergenic
1180046674 21:45309607-45309629 CGCTGAGCAGAGCCGAGGTGGGG + Intergenic
1180154748 21:45972499-45972521 GGCAGTGGGGAGCTCAGCTGCGG - Intergenic
1180169904 21:46052636-46052658 GGCTGTGGAGAAACCAGGTGTGG - Intergenic
1180336809 22:11584327-11584349 GACTCTGGACTGCCCAGGTGCGG - Intergenic
1180353945 22:11824073-11824095 GGCGGTGGAAAGCCCATGAGAGG - Intergenic
1180384302 22:12168252-12168274 GGCGGTGGAAAGCCCATGAGAGG + Intergenic
1180831765 22:18910353-18910375 GGGTGTGGGGGGCTCAGGTGTGG + Intronic
1181084937 22:20435565-20435587 GGCTGGGCAGAGTCCAGGAGGGG - Intronic
1181135815 22:20765579-20765601 CGCTGTGGAGGGCTCAGGTAGGG - Exonic
1181434445 22:22902020-22902042 GTCTCTGGGGAGCCCAGATGTGG + Intergenic
1181496338 22:23289307-23289329 GGCCCTGGAGAGCCCAGGCCTGG - Intronic
1182360014 22:29740782-29740804 GGCTGAGGGGTGCCCAGATGAGG + Intronic
1182471293 22:30549894-30549916 TGCTGGAGAGAGGCCAGGTGGGG + Intergenic
1182764892 22:32751445-32751467 GGATCTGGGGAGTCCAGGTGCGG + Intronic
1182792905 22:32967799-32967821 GGCTGGGGTGAGCCCAGTGGGGG + Intronic
1183341473 22:37284120-37284142 GGCTATGGAGAGGGCAGGGGAGG + Intronic
1183425023 22:37734717-37734739 GGATGTGGAGAGCCCAGCCTGGG + Exonic
1183434504 22:37785800-37785822 GGCTGAGGTGAGGCCAGGCGCGG + Intergenic
1183780897 22:39998204-39998226 GGCTGCTGTGAGGCCAGGTGGGG + Intronic
1184159127 22:42687644-42687666 GGCTGGGCTGAGGCCAGGTGTGG - Intergenic
1184363078 22:44030440-44030462 GGCTGTGGCCAGCCCTGGTCGGG + Intronic
1184518590 22:44978902-44978924 GCATCTGGAGATCCCAGGTGAGG + Intronic
1184847878 22:47100240-47100262 GGCTGTGGAGTGCAAGGGTGAGG + Intronic
1184847887 22:47100282-47100304 GGCTGTGGAGTGCAGGGGTGAGG + Intronic
1185072509 22:48664618-48664640 GGCTCTGGTGAGCCAAGGGGAGG - Intronic
1185153172 22:49178125-49178147 GGCTGTGGAGAGTCCACATGGGG - Intergenic
1203281845 22_KI270734v1_random:135624-135646 GGGTGTGGGGGGCTCAGGTGTGG + Intergenic
950635665 3:14312563-14312585 GGCGGTGTAGGGCACAGGTGAGG + Intergenic
951024790 3:17817662-17817684 GGCTGAGGAGTGCCCAGGAATGG - Intronic
952845272 3:37682942-37682964 GTCTGTGGAGTGGCCAGGAGAGG - Intronic
953640285 3:44700803-44700825 GGCAGTGGAGTGGCCGGGTGCGG - Intergenic
953755554 3:45643024-45643046 GTCTGTGGAGAGGACAGGAGTGG + Intronic
954671687 3:52294421-52294443 GGCTGCCCAGAGCCCAGGTGGGG - Intergenic
954715809 3:52526248-52526270 GGCTGTGGAGAGTTTGGGTGCGG + Intronic
955025680 3:55165149-55165171 GGCTGAGGAAGGGCCAGGTGTGG + Intergenic
955515920 3:59726287-59726309 GGCTGTGGAGGCTGCAGGTGGGG - Intergenic
955679554 3:61486297-61486319 TGCTTTGGAAAGCCAAGGTGGGG - Intergenic
955692910 3:61607672-61607694 CTCTGTGGAGAGGCCAGGAGGGG + Intronic
958259551 3:91364524-91364546 GCCTGTGCAGAGCCCAGATTTGG + Intergenic
959509100 3:107189516-107189538 GGCTCTGGAGGGCCCTGGTGTGG - Intergenic
959537193 3:107499894-107499916 GGTTGTGGTGAGCCCAGATCAGG - Intergenic
960124424 3:113982999-113983021 GGCTGAGGAGAGAATAGGTGAGG - Intronic
960661907 3:120069501-120069523 AGCTGTGGACAACCCAGTTGGGG + Intronic
961328232 3:126124243-126124265 GCCTGGGGAGAGCCCAGGCGGGG - Intronic
961366487 3:126402839-126402861 TGCTGTGGGGAGTCCAGGTGGGG + Intronic
961454007 3:127015409-127015431 GGCTATGGAGAGCCTGGCTGGGG + Intronic
961480298 3:127175100-127175122 GGCTATGGAGGGCCCATGGGAGG + Intergenic
961513547 3:127419269-127419291 CTCTGTGGGGGGCCCAGGTGGGG + Intergenic
961999188 3:131277415-131277437 GGCTGTGGAGGGGGCAGATGTGG - Intronic
962522227 3:136208059-136208081 TGTAGTGCAGAGCCCAGGTGAGG - Intergenic
963806415 3:149727485-149727507 TGCTTTGGAAGGCCCAGGTGGGG + Intronic
964382748 3:156114305-156114327 GGCTTTGAAGAGGCCAGGAGTGG - Intronic
965206239 3:165721180-165721202 GGGTGGGGAGAGGCCAGGCGTGG + Intergenic
965681402 3:171255754-171255776 GCCTTTAGAGACCCCAGGTGTGG + Intronic
965684135 3:171283654-171283676 GGCTGTGGAGAGGTCGGGTGAGG + Intronic
965919591 3:173895978-173896000 AGGTGTGGGGAGGCCAGGTGCGG - Intronic
966773384 3:183523426-183523448 GCCTGAGAAGAGCCCAGGAGGGG - Intronic
967816644 3:193804713-193804735 GGCTGTGCAGATCCATGGTGGGG + Intergenic
967930250 3:194685954-194685976 GACCGTGGAGAGCCCGGGAGCGG + Intergenic
968516794 4:1018875-1018897 GGGTCCGGGGAGCCCAGGTGGGG + Intronic
968827541 4:2910600-2910622 TCCTGTGTAGAGCCCACGTGAGG + Intronic
968911663 4:3479590-3479612 GGCTGTGGCGGGGCCAAGTGAGG - Intronic
969240177 4:5892454-5892476 GGCTGGGGAGAGCCACGGCGCGG - Intronic
970003342 4:11386617-11386639 GGCTCAGGTGAGTCCAGGTGTGG + Intergenic
970365544 4:15354438-15354460 GGATGTGGGGAGGCCAGATGGGG + Intronic
971451505 4:26805627-26805649 GGAGGTGGGGAGCCCAGATGGGG - Intergenic
971600288 4:28582903-28582925 AGATTTGGAGAGCCCAGGGGAGG + Intergenic
972381456 4:38523941-38523963 GATCGTGGAGAGCCCAAGTGTGG + Intergenic
975683480 4:76897889-76897911 GGCTGGGGAGAGCCCCGGGAGGG - Exonic
977243899 4:94606470-94606492 GACTGTGCAGAGGCCAGGAGGGG + Intronic
977708822 4:100101073-100101095 GCGTGTGGAGAGCCCTGCTGGGG + Intergenic
979810012 4:125025702-125025724 GCCTGAGCAGGGCCCAGGTGGGG - Intergenic
983537699 4:168876005-168876027 GGCCATTGTGAGCCCAGGTGGGG + Intronic
985521272 5:374913-374935 GGCCGTGGTGAGCACAGGTGGGG - Intronic
985670558 5:1204505-1204527 GGATGTGGTGCTCCCAGGTGGGG - Intronic
985857453 5:2441284-2441306 GGCTGTGGAAGGAGCAGGTGGGG + Intergenic
987894754 5:23930040-23930062 GGCTGTTGAGACTTCAGGTGTGG - Intergenic
988686521 5:33530517-33530539 GGCTGGAGAGGGCACAGGTGGGG + Intronic
989255854 5:39364961-39364983 GGTTGCGGTGAGCCGAGGTGGGG + Intronic
991001051 5:61783605-61783627 GGCTGAGGAGAGGAAAGGTGGGG - Intergenic
991176155 5:63689559-63689581 GGCTGGGGAGTCCCCAGGTCTGG - Intergenic
991366172 5:65870308-65870330 GGTTGTGGTGAGCCAAGGTTGGG + Intronic
991932401 5:71766544-71766566 GGCTCTGGACATTCCAGGTGGGG - Intergenic
995145889 5:108786953-108786975 TGCTGTGGAGACGCCAGCTGTGG + Intronic
995968445 5:117938360-117938382 GTCAGTGGAGAGCCAAGTTGCGG - Intergenic
995981026 5:118104512-118104534 TTCTGTAGAGAGGCCAGGTGGGG - Intergenic
996197063 5:120621589-120621611 GTCAGGGGAGAGACCAGGTGGGG + Intronic
996797602 5:127366315-127366337 GGATGTGGAGAGCCCAGAGATGG + Intronic
997647664 5:135491778-135491800 GGCTGCGGAGAGCGCAGCTGCGG + Intergenic
997657986 5:135569355-135569377 GGGTGTGGAGAACCCAGGGAAGG + Intergenic
997884234 5:137616097-137616119 GGCCTTGGAGAGGCCCGGTGAGG - Intergenic
998096245 5:139396954-139396976 GGCTGTGGACAGCCAAGGGTAGG + Intronic
998147839 5:139740370-139740392 GGCTGAGCAGAGCCCTGGGGAGG - Intergenic
998186163 5:139981546-139981568 GGCTGTGCAGAGCCAGGCTGAGG + Intronic
999328285 5:150656773-150656795 GGCTGTGGCGAGCGCATGCGCGG - Intronic
999370220 5:151050694-151050716 GGCTGTGGTGAGCCGAGATTGGG - Intronic
1001091988 5:168748433-168748455 GCCTGTGGAGAGCCCCAGAGAGG + Exonic
1001713908 5:173799081-173799103 GGCTTTGAAGTGCCCAGGTCTGG + Intergenic
1002407958 5:179051152-179051174 GGCTGTGGTGAACCCAGGCCGGG + Intergenic
1002441559 5:179267065-179267087 GGGTGTGCAGAGCCCAGGGCTGG - Intronic
1003150041 6:3540605-3540627 GGATGTGGGGATTCCAGGTGAGG - Intergenic
1003327405 6:5102738-5102760 CGCTGTGGTCAGCACAGGTGTGG + Intronic
1004129838 6:12909042-12909064 GGAGGTGGAGAGGCAAGGTGAGG + Intronic
1004541386 6:16553718-16553740 GGCTGTTGAGGGCCATGGTGAGG - Intronic
1005915697 6:30348701-30348723 GGCAGTGGAGAGACCAAGTCAGG - Intergenic
1006427921 6:33977725-33977747 AGCTGGAGAGAGACCAGGTGAGG - Intergenic
1006448524 6:34092829-34092851 GCCTGGGGAGGGTCCAGGTGGGG - Intronic
1006733190 6:36252045-36252067 GGGTGGGGAGACCCCAGGTAAGG + Intronic
1006757169 6:36426431-36426453 GGTTGTGGTGAGCCGAGATGGGG - Intronic
1007400782 6:41601109-41601131 GTGTGTGTAGTGCCCAGGTGTGG + Exonic
1007479542 6:42141378-42141400 GGCTCTGGAACGCCCAGGTTGGG - Intronic
1007623670 6:43229893-43229915 GGCTGTGGAGAGCCCAGAGGAGG - Intergenic
1008933528 6:56964784-56964806 GACTGAGAAGAGGCCAGGTGAGG - Intronic
1008995682 6:57655842-57655864 GCCTGTGAAGAGCCCAGATTTGG - Intergenic
1009184210 6:60554611-60554633 GCCTGTGCAGAGCCCAGATTTGG - Intergenic
1016937024 6:149455139-149455161 GGCTTTGGAGAGGGCAGGTGAGG - Intronic
1017962218 6:159232712-159232734 GAAAGTGGAGAGCTCAGGTGTGG - Exonic
1018707143 6:166471201-166471223 TGCTGTGGTCAGCACAGGTGTGG + Intronic
1018793705 6:167170101-167170123 GCCTGTGGAGAGCACACCTGGGG - Intronic
1018822628 6:167384980-167385002 GCCTGTGGAGAGCACACCTGGGG + Intergenic
1018937683 6:168284254-168284276 GGCTGGGGAGAGCCAGGGTGAGG + Intergenic
1019147153 6:169982837-169982859 GACTGTGGAGAGGCCAGGGTGGG - Intergenic
1019314579 7:378666-378688 GTCTGTTGAGACCCCAGGTGTGG - Intergenic
1019496132 7:1341448-1341470 AGCTGTGGACACGCCAGGTGGGG - Intergenic
1019601519 7:1886022-1886044 GGCTGGTGAGGGCCCAGGTGGGG - Intronic
1019729325 7:2621895-2621917 AGGTGTGGAGAACCCAAGTGGGG + Intergenic
1020099564 7:5387644-5387666 TCCTGGGCAGAGCCCAGGTGCGG - Intronic
1020214599 7:6180071-6180093 GCCGGTGGAGAAGCCAGGTGAGG + Intronic
1021100640 7:16584124-16584146 GGCTGTCCACTGCCCAGGTGTGG + Intergenic
1021645853 7:22788820-22788842 GCCAGTGGAGAGGCCAGGTAAGG + Intergenic
1022438701 7:30414117-30414139 GGCTGAGCAAGGCCCAGGTGGGG + Intergenic
1023818322 7:43966478-43966500 GGCTGTGGGGAACCCAGGGGAGG - Intergenic
1024201112 7:47106644-47106666 GGCTGTGGAGAGGCCTTTTGGGG - Intergenic
1025175924 7:56802433-56802455 GGCCCTGGAGAGGCCAGGAGAGG + Intergenic
1025695869 7:63773989-63774011 GGCCCTGGAGAGGCCAGGAGAGG - Intergenic
1027195816 7:76029435-76029457 AGCTGTTAAGAGGCCAGGTGTGG - Intronic
1027267155 7:76500747-76500769 GGCTATGGAGAGGCCAGGGCCGG - Intronic
1027318967 7:77000615-77000637 GGCTATGGAGAGGCCAGGGCCGG - Intergenic
1027530369 7:79323503-79323525 GGATCTGGAGAGACCAGTTGTGG + Intronic
1028519980 7:91719306-91719328 GGCTGTGGAGAAACAAGGTATGG + Intronic
1029461402 7:100695715-100695737 GGCTTTTGAGAGGCCAGGCGTGG - Intergenic
1029512549 7:101005319-101005341 GGCTGTGGAGCGGGCAGGTAAGG - Exonic
1029646059 7:101856865-101856887 GGCGTGGGAGAGCCAAGGTGGGG - Intronic
1029704680 7:102270013-102270035 CGCTGTACAGAACCCAGGTGGGG - Intronic
1029712175 7:102305771-102305793 GGCAGAGGGCAGCCCAGGTGGGG + Intronic
1029742952 7:102501310-102501332 GGCTGTGGGGAACCCAGGGGAGG - Intronic
1029760942 7:102600471-102600493 GGCTGTGGGGAACCCAGGGGAGG - Intronic
1029991872 7:104969886-104969908 GGCTGCAGTGAGCCCAGGTCAGG - Intergenic
1030678522 7:112409503-112409525 GGACGAGGAGACCCCAGGTGAGG - Intergenic
1033170460 7:139079255-139079277 GGCAGTGGATTCCCCAGGTGTGG + Intronic
1033422896 7:141218655-141218677 GGCACCGGAGAGTCCAGGTGTGG - Intronic
1034508746 7:151518299-151518321 GGCGGTGGAAAGCGCAGTTGGGG + Intronic
1034518476 7:151600630-151600652 GGCTGCGGAGAAGCCAGATGTGG - Intronic
1034830230 7:154302555-154302577 GGAGGTGGGGAGCCCCGGTGGGG + Intronic
1034846885 7:154454587-154454609 AGTTGTGGAGGGGCCAGGTGTGG + Intronic
1034940840 7:155229150-155229172 GGCAGAGGAAAGGCCAGGTGAGG - Intergenic
1035245521 7:157560123-157560145 AGCGGAGGACAGCCCAGGTGAGG + Intronic
1035528991 8:336633-336655 GCCTCAGGAGAGCCCAGCTGTGG + Intergenic
1035726044 8:1824979-1825001 GGGTGTGGGGAGGACAGGTGGGG - Intronic
1035814886 8:2528350-2528372 GGCCATGGAGAGCCCTGGTTGGG - Intergenic
1036808987 8:11854222-11854244 GGCTGGGGAGAGCCGCGGCGCGG + Intronic
1038018672 8:23535172-23535194 GGCTGTCCAGGACCCAGGTGGGG - Intronic
1038144978 8:24887259-24887281 GGGGGTGGAGAGTGCAGGTGAGG - Intergenic
1038554794 8:28501507-28501529 TGTTGTGGAGAGCCTAGGTTAGG - Intronic
1038667962 8:29557632-29557654 GGCTGTTCAGAGACCAGATGAGG - Intergenic
1040495585 8:47962163-47962185 TTCTGTGCAGAGCCCAGGTCAGG - Exonic
1040599374 8:48869372-48869394 GGCTGTGGAGACAGCTGGTGGGG + Intergenic
1041115457 8:54531479-54531501 GGAGGTGGATAACCCAGGTGGGG + Intergenic
1041928756 8:63265440-63265462 GGTTGTGGGGAGAGCAGGTGAGG - Intergenic
1044598337 8:93979888-93979910 GGCTCTGGAGAGCGCAGGGTTGG - Intergenic
1045480416 8:102587083-102587105 GGCAGAGGAGAGCCCAGGCCTGG + Intergenic
1045675014 8:104597901-104597923 GACTGAGGAGTGCCCAGGAGCGG + Intronic
1047430257 8:124785006-124785028 AGCATTGGAGAGCTCAGGTGAGG - Intergenic
1049221880 8:141432162-141432184 GGGTGTGGAGAGCCTGGGAGTGG + Exonic
1049332231 8:142060711-142060733 GGCTGAGGAGAGACCAGGTATGG - Intergenic
1049353899 8:142178372-142178394 GGTGGTGGGGTGCCCAGGTGAGG - Intergenic
1049730264 8:144173765-144173787 GGCTGGGCAAGGCCCAGGTGGGG - Intronic
1053005432 9:34601129-34601151 GGCTGGCCAGGGCCCAGGTGTGG - Intergenic
1053506986 9:38651505-38651527 GGCTGCTGAGAGGCCAGGTCAGG + Intergenic
1054996348 9:71395133-71395155 GGCTGGGAAGAGCACTGGTGAGG - Intronic
1055445486 9:76377960-76377982 TGCTATGGAGAGTCCAGGTGTGG + Intergenic
1056335419 9:85563880-85563902 GGCTCTGGAAGGCCCAGGTGTGG + Intronic
1056376720 9:86021417-86021439 CGCTGTGGAGAGGCCAGCCGCGG + Intronic
1056964725 9:91156111-91156133 GCCTGGGGAGAGGCCAGGTGTGG - Intergenic
1057832784 9:98419609-98419631 GGCTGCGGAGGGCCCAGGTCAGG + Intronic
1058283821 9:103151101-103151123 AGATGTGGAGGGGCCAGGTGTGG + Intergenic
1059318101 9:113444505-113444527 GGCTGATGAGAGCCCATTTGGGG + Intergenic
1060219043 9:121754814-121754836 GGCTGTGGAGAGGAGAGGCGAGG - Intronic
1061075851 9:128340904-128340926 GGCGGTGCGGACCCCAGGTGGGG + Intronic
1061119896 9:128636038-128636060 GGCTGTGGAGAGGCCAGAAGAGG - Intronic
1061203397 9:129149892-129149914 CGCTGTGGAGAGCTCAGGCCTGG + Intergenic
1061631302 9:131874000-131874022 GGCTGTGGAGTGGCCAGCGGGGG - Intronic
1061778873 9:132984314-132984336 GGGTGTGGGGAGCCCTGGTGAGG + Intronic
1062550884 9:137086077-137086099 GGCTGGGGAGAACCCAGGCAGGG + Intergenic
1062572042 9:137190230-137190252 GGCTGAGGAGGGACAAGGTGAGG - Exonic
1062582957 9:137236461-137236483 GGCTCTGGAGGGCCCTGGAGGGG + Exonic
1062597594 9:137306175-137306197 GGCAGTGGCCAGCCCTGGTGTGG + Intergenic
1062657496 9:137611854-137611876 TGCTGGGGAGACCACAGGTGAGG + Intronic
1062688615 9:137829023-137829045 GTCTGTACAGAGCCCGGGTGGGG + Intronic
1203366690 Un_KI270442v1:264664-264686 GACTCTGGACTGCCCAGGTGCGG + Intergenic
1186509742 X:10121724-10121746 GACGGTGGAGTGCCCAGCTGGGG + Intronic
1186525153 X:10241573-10241595 AGCTAGGGAGAGGCCAGGTGTGG + Intergenic
1187612275 X:20955539-20955561 GGCTCAGGTGGGCCCAGGTGGGG - Intergenic
1187673862 X:21696363-21696385 GCCTGTTGAGAGACCAGGTATGG - Intergenic
1189100060 X:38179745-38179767 GGGTGTGCAGAGACAAGGTGAGG - Intronic
1189411512 X:40776764-40776786 ATCTGTGGATAGGCCAGGTGGGG - Intergenic
1192466185 X:71357974-71357996 GGCTGTGGAGAGTCCAGGTTGGG + Intergenic
1195466850 X:105188987-105189009 GCCTGTGGAGTGCCCATTTGAGG + Intronic
1196762158 X:119209810-119209832 GGCTGTGGAGAACCTGTGTGTGG - Intergenic
1197929637 X:131680868-131680890 TGCTATGGAAAGCCCAGGAGAGG - Intergenic
1197945826 X:131839529-131839551 TGCTATGGAAAGCCCAGGAGAGG + Intergenic
1198099805 X:133414372-133414394 GGGTGAGGAGAGGCCGGGTGGGG - Intronic
1198108954 X:133485743-133485765 GGCTGTGGACAGCCCAGCACAGG + Intergenic
1198263477 X:134987636-134987658 GGCTGTGGAAACCCCAGGGGCGG - Intergenic
1198741895 X:139851255-139851277 GGCTCAAGGGAGCCCAGGTGAGG + Intronic
1198933363 X:141882199-141882221 GGTAGTGGAGGGCCCGGGTGGGG + Intronic
1199694155 X:150331728-150331750 GGCTGTGGTGAGCCAAGATTGGG - Intergenic
1201071995 Y:10155561-10155583 GACTCTGGACTGCCCAGGTGCGG - Intergenic