ID: 1103478184

View in Genome Browser
Species Human (GRCh38)
Location 12:121233563-121233585
Sequence GATGGGGCTGTGGAGAGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 9, 3: 49, 4: 503}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103478184_1103478193 1 Left 1103478184 12:121233563-121233585 CCTGGGCTCTCCACAGCCCCATC 0: 1
1: 0
2: 9
3: 49
4: 503
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528
1103478184_1103478191 -3 Left 1103478184 12:121233563-121233585 CCTGGGCTCTCCACAGCCCCATC 0: 1
1: 0
2: 9
3: 49
4: 503
Right 1103478191 12:121233583-121233605 ATCAAAGAACAGAGAGGAGGAGG 0: 1
1: 0
2: 2
3: 56
4: 669
1103478184_1103478192 0 Left 1103478184 12:121233563-121233585 CCTGGGCTCTCCACAGCCCCATC 0: 1
1: 0
2: 9
3: 49
4: 503
Right 1103478192 12:121233586-121233608 AAAGAACAGAGAGGAGGAGGAGG 0: 1
1: 0
2: 45
3: 498
4: 3211
1103478184_1103478194 9 Left 1103478184 12:121233563-121233585 CCTGGGCTCTCCACAGCCCCATC 0: 1
1: 0
2: 9
3: 49
4: 503
Right 1103478194 12:121233595-121233617 AGAGGAGGAGGAGGGAGAAATGG 0: 1
1: 12
2: 219
3: 1639
4: 8255
1103478184_1103478189 -6 Left 1103478184 12:121233563-121233585 CCTGGGCTCTCCACAGCCCCATC 0: 1
1: 0
2: 9
3: 49
4: 503
Right 1103478189 12:121233580-121233602 CCCATCAAAGAACAGAGAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 275
1103478184_1103478186 -9 Left 1103478184 12:121233563-121233585 CCTGGGCTCTCCACAGCCCCATC 0: 1
1: 0
2: 9
3: 49
4: 503
Right 1103478186 12:121233577-121233599 AGCCCCATCAAAGAACAGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103478184 Original CRISPR GATGGGGCTGTGGAGAGCCC AGG (reversed) Exonic
900311016 1:2033156-2033178 GATGGGGGTGTACGGAGCCCTGG - Intergenic
900438204 1:2641238-2641260 GAAGGGGGTGTGGAGAGGGCAGG + Intronic
900477847 1:2884292-2884314 GATGGGGCTGGGGAGAGATTAGG - Intergenic
900490342 1:2945858-2945880 GCTTGGGCTGTGGGGAGGCCTGG + Intergenic
900971197 1:5993170-5993192 GGTGGGGCTGCGCAGAGGCCGGG - Intronic
901625988 1:10625366-10625388 GATGGGACTCTCCAGAGCCCAGG - Intronic
901775645 1:11558886-11558908 CCTGGTGCTGTGGATAGCCCAGG - Intergenic
903447276 1:23430714-23430736 GGTGAAGCTGAGGAGAGCCCAGG - Intronic
903544859 1:24117730-24117752 GGTGGGGCTGTGGAGATTCCTGG + Intergenic
903742384 1:25565761-25565783 GCTGTGGCTGAGGAGAGGCCTGG + Intronic
903929632 1:26854903-26854925 GATGGGGCAGGGGGCAGCCCAGG - Exonic
904931263 1:34089139-34089161 AATGGGACAGTTGAGAGCCCAGG - Exonic
905037425 1:34927253-34927275 GATGGGGGTGGGGAGAGTTCAGG + Intronic
905630171 1:39514181-39514203 GCTGGGGCTGGAGAGAACCCGGG + Intronic
905667589 1:39772009-39772031 GCTGGGGCTGGAGAGAACCCGGG - Intronic
905690062 1:39936511-39936533 GAAGAGGCTTAGGAGAGCCCTGG + Intergenic
906706157 1:47896337-47896359 GATGGGGCTGTGGAGGCTCAAGG + Intronic
906717413 1:47980441-47980463 GCTGGGGCTTTGCAGAGCTCAGG - Intronic
907241661 1:53084399-53084421 GAGGGGGCTCTGGAAAGGCCAGG - Intronic
907241857 1:53085309-53085331 GATGGGGCTGGGCTGAGCCAGGG + Exonic
907587456 1:55633940-55633962 AATGGGGCTGGGGAGAGGCCAGG + Intergenic
907739512 1:57151033-57151055 GATGGGTCTGCGGTGAGCCAGGG + Intronic
907821773 1:57977068-57977090 GATAGGGCAGTGGGGAGCCATGG - Intronic
911587170 1:99704599-99704621 GATGGGGGCGTGGTGAGCCAGGG - Intergenic
913454765 1:119019585-119019607 GATGGGCATGTGCAGGGCCCAGG - Intergenic
914244386 1:145874911-145874933 GCGGGGGCTGTGGACAGCACAGG - Exonic
915339141 1:155166884-155166906 GATGGGGCTGCGGGGAGTGCGGG - Intergenic
915447467 1:155982090-155982112 GGTGGGGCTGGGAGGAGCCCAGG + Intronic
915447734 1:155983647-155983669 GATGGGGCTGATGAAATCCCAGG - Intronic
916179315 1:162070111-162070133 GAAGGGGCTGGCGAGACCCCGGG - Exonic
916785246 1:168082404-168082426 GGTGTGGCTGTGCAGAGCCAAGG - Exonic
918309083 1:183272759-183272781 GAAGGGGCTGTGGAGCAGCCCGG - Intronic
920066273 1:203272208-203272230 GATGGGAGTGGGGACAGCCCTGG + Intronic
920756901 1:208741103-208741125 GATGGGGGTGTGGTGGGCCAGGG + Intergenic
921815917 1:219563265-219563287 GATGGAGCTGGGGAGAGTACGGG + Intergenic
922241171 1:223756277-223756299 GAAGGGAGTGGGGAGAGCCCAGG - Intronic
922757662 1:228105515-228105537 GGAGGGGCAGTGGAGATCCCAGG + Intergenic
923107492 1:230865947-230865969 GAAAGGGCTGTGGAGGCCCCAGG + Intronic
924603265 1:245509995-245510017 GCTGGGTCTGTGGAGGGTCCTGG + Intronic
924778343 1:247126626-247126648 GAAGGGGCTGTGGCGGCCCCGGG + Intronic
924783315 1:247171794-247171816 GAAGGGGCTGTGGCGGCCCCGGG - Intronic
1063129771 10:3168166-3168188 GATTGGGCTGAGGAGACCCGAGG - Intronic
1063150586 10:3332916-3332938 GAGGGGGCTGTGGGGAGACCCGG + Intergenic
1063357797 10:5417293-5417315 GATGGGGGTGTGGTGAGCCAGGG + Intronic
1064012078 10:11742988-11743010 GCTGGGCCTGCGGAGAGGCCTGG + Intronic
1064209491 10:13350331-13350353 AATGGGGTTCTGGTGAGCCCGGG - Intergenic
1064262527 10:13797511-13797533 CATGAGGCTAGGGAGAGCCCTGG + Intronic
1066265715 10:33774128-33774150 GATGGGGGTGTGGCGGGCCAGGG - Intergenic
1067030598 10:42876964-42876986 GATGGGGCCCTGGGGTGCCCAGG + Intergenic
1067043173 10:42969321-42969343 GCTGGGGCCTTGCAGAGCCCGGG - Intergenic
1067540107 10:47144813-47144835 GATGAGGCTGTGATGAGCCCTGG + Intergenic
1067661543 10:48239648-48239670 AATGGGGCTCTGGTGAGCTCTGG + Exonic
1067689930 10:48495217-48495239 GAGGGGGATGTGGAGGGCTCTGG + Intronic
1067705509 10:48604167-48604189 GATGGGGGTCAGGAGAGTCCAGG - Intronic
1067768154 10:49104450-49104472 GCTGGGGCTGTGCAGAGCCTTGG - Intronic
1069782571 10:70966024-70966046 GATAGTGCTCTGCAGAGCCCTGG + Intergenic
1070540538 10:77412365-77412387 GATGGGGCAATGGAGTGGCCAGG - Intronic
1070983272 10:80667098-80667120 GATGGGGCTGCCTGGAGCCCAGG + Intergenic
1071532496 10:86400704-86400726 GAAGGGGCGGTGGAGAGCCCTGG - Intergenic
1072717811 10:97763102-97763124 GCTGGGGCTGTGAAGAACACAGG - Intergenic
1075389083 10:122079353-122079375 GATGGGCCCATGGAGAGCCCTGG - Intronic
1075589919 10:123684002-123684024 GATGGAGCTGGGGAGAGGCCGGG - Intronic
1075706198 10:124503132-124503154 GAGGGGGTTGTGGTGAGCCCAGG - Intronic
1075961839 10:126573599-126573621 GTGGGGGCTGTGGAAGGCCCTGG - Intronic
1076021383 10:127076741-127076763 GATGGGGCTGAGGCCAGGCCTGG - Intronic
1076126630 10:127979122-127979144 TCTCGGGCTGTGGAGTGCCCTGG - Intronic
1077160420 11:1110055-1110077 GAGGGGGTGGTGGAGACCCCAGG + Intergenic
1077508152 11:2941602-2941624 GATGGGGCTGGGGGCAGCCTAGG + Intergenic
1077520392 11:3029891-3029913 GATGGGGCTTTTGAGACCTCTGG - Intronic
1079230208 11:18643214-18643236 GAGGGGGCAGTGCAGAGCCCAGG + Intergenic
1079333217 11:19550293-19550315 GATGGGGCATTGGGGAGCTCTGG - Intronic
1080483154 11:32674043-32674065 GCTGGGCCAGTGGAGAGCCTAGG - Intronic
1081870490 11:46380801-46380823 GGTGGGGCGGGGGCGAGCCCGGG + Exonic
1083189716 11:61041200-61041222 GCTGGTGCTGTGGGGAGCCCAGG + Intergenic
1083300568 11:61737808-61737830 GCTGGGGGTGGGGAGAGGCCTGG - Intronic
1083440314 11:62671894-62671916 GGTGGGCGGGTGGAGAGCCCCGG + Intronic
1083600507 11:63944605-63944627 GAAGAGGCTTTGGACAGCCCTGG + Intronic
1083783084 11:64928155-64928177 GATGGTGAAGTGGGGAGCCCAGG + Exonic
1084151778 11:67290908-67290930 CATGAGCCTGTGCAGAGCCCTGG - Intronic
1084480591 11:69417675-69417697 GAAGGGGCTCTGGGCAGCCCTGG + Intergenic
1085055016 11:73398334-73398356 GCTGGGGCTGTCGGGAGGCCTGG + Intergenic
1085391752 11:76185728-76185750 CATGGGGGTGGGGAGAGGCCTGG - Intergenic
1085519547 11:77130058-77130080 GATGGCTCTGTGCAGAGCACTGG - Intronic
1085757319 11:79212679-79212701 ATGGGGACTGTGGAGAGCCCTGG - Intronic
1087146886 11:94821650-94821672 GCGGGGGCTGTGGAGCACCCAGG - Exonic
1087261097 11:96013567-96013589 GATGGGGTTGTGGCAGGCCCAGG - Intronic
1087788828 11:102385489-102385511 GATGGGGCTGTGGCAGGCCAGGG + Intergenic
1088367154 11:109051688-109051710 GATAGGACTGAGGAGAGGCCTGG - Intergenic
1090918978 11:131191828-131191850 GAGGTGGCAGTGGAGAGGCCTGG - Intergenic
1091787606 12:3252464-3252486 CATGGGGCTGGGGGGAGCCCAGG - Intronic
1091969137 12:4771388-4771410 GTTGGGGCTGGGGGGAGTCCAGG + Intronic
1092059808 12:5539183-5539205 GATGGGACCGTGGAGAGGACAGG + Intronic
1092255020 12:6922143-6922165 GGTGGGGCTGTGCACAGGCCAGG + Exonic
1093253096 12:16832528-16832550 TCTGGGGCTGGGGACAGCCCTGG + Intergenic
1094523791 12:31218787-31218809 GGTGGGGCTGAAGAGAGCCTGGG + Intergenic
1095744767 12:45645253-45645275 GATGGGTCTGGGAAGAACCCAGG + Intergenic
1097233482 12:57525691-57525713 GAGGGGCCGGAGGAGAGCCCAGG - Exonic
1100260419 12:92928516-92928538 GAGGGTGGTGTGGTGAGCCCCGG - Intronic
1101897151 12:108765511-108765533 GAAGGGGCGGGGGAGGGCCCTGG - Intergenic
1102558111 12:113742239-113742261 GATGGGGCTGTGGTGGGCGCTGG + Intergenic
1103202250 12:119097251-119097273 GGTGGGGCTGTGGAGGGCTGAGG + Intronic
1103447096 12:121001526-121001548 CCTGGGCCTATGGAGAGCCCTGG + Exonic
1103478184 12:121233563-121233585 GATGGGGCTGTGGAGAGCCCAGG - Exonic
1103620531 12:122184576-122184598 GAGGAGGATGTGGTGAGCCCCGG + Exonic
1103688706 12:122753040-122753062 GGCGGGGGTGTGGAGAGGCCCGG - Intronic
1103883648 12:124185402-124185424 GGTGGGGCTCTGAATAGCCCAGG - Intronic
1104373116 12:128240988-128241010 GATAGGGCTGTGGGGACCCTGGG + Intergenic
1104729808 12:131098480-131098502 GCTGGTGCTGTGGGGAGACCAGG + Intronic
1104983724 12:132585366-132585388 GAGGGGGCTGGGCAGAGCCGGGG - Intergenic
1105068470 12:133219341-133219363 GATGGGGCTGGGGCCAGCTCTGG + Exonic
1105304970 13:19161806-19161828 GAGGGGGCTCTGGAGAGTCCAGG + Intergenic
1105682644 13:22745097-22745119 GCTGGGGCAGAGGAGAGCCCGGG - Intergenic
1106410139 13:29505813-29505835 GATGGGGGTGGGGGCAGCCCTGG + Exonic
1106414439 13:29534638-29534660 GATAGGGCTGTGGGGAGCCCAGG + Intronic
1107293188 13:38880573-38880595 GCTGGGGCTGTTGAGCTCCCAGG - Exonic
1107456534 13:40560625-40560647 GAGGGTGCTGGGGACAGCCCTGG - Exonic
1108522715 13:51259949-51259971 GAGGGAGCAGTGGAGAGCCTCGG + Intronic
1111584621 13:90268478-90268500 GATGGGGATGTGGCAAGCCAGGG + Intergenic
1111597219 13:90427622-90427644 GCTGGGAGTGGGGAGAGCCCTGG - Intergenic
1111938570 13:94584400-94584422 GATGGTGCTGTTGAGAACCAAGG + Intronic
1112884111 13:104147643-104147665 GATGGGGTTGTGCAAAGCCACGG - Intergenic
1113607474 13:111620704-111620726 CGTGGGGCTGTGAAGGGCCCCGG + Intronic
1113782603 13:112985325-112985347 GAGAGGGTTGTGGCGAGCCCAGG + Intronic
1113952586 13:114080166-114080188 CATGGTGCCCTGGAGAGCCCTGG - Intronic
1114369528 14:22070713-22070735 GCTGGGGCTCTTGAGTGCCCAGG + Intergenic
1114493004 14:23114828-23114850 GGAGGGACTGTGGAGAGCGCCGG + Intergenic
1114531978 14:23402181-23402203 GATGGTGATGTGCAGAGCTCAGG + Intronic
1114622163 14:24102795-24102817 GATGGGGCACTGGCGAGCCGGGG - Exonic
1115341293 14:32295395-32295417 CCTGGGGCTGAGGAGGGCCCAGG + Intergenic
1115448354 14:33517923-33517945 GAGGGTGCTGGGGAGAGCCGAGG - Intronic
1118686575 14:68297517-68297539 GATTGGGCTGTGAAGGGCCTTGG - Intronic
1119408088 14:74411122-74411144 GATGGGGCTGTGTCTTGCCCTGG + Intronic
1119421535 14:74510398-74510420 GATAGGGCTGAAGTGAGCCCGGG - Intronic
1119750996 14:77077210-77077232 GCTGGGGCTGCGGAGAGTCCGGG + Intergenic
1119751956 14:77085062-77085084 AATGGGGCTGTGAAGAGCTAGGG + Intergenic
1119777533 14:77258187-77258209 GAGGGGGCTGAAGAGGGCCCTGG - Exonic
1120836117 14:89039843-89039865 GATGGGGGTATCGAGAGCCATGG - Intergenic
1120981982 14:90298339-90298361 TTTGGGACAGTGGAGAGCCCCGG - Exonic
1121738172 14:96233371-96233393 CATGGGGCTGTGGTGGGACCAGG + Intronic
1122033242 14:98928806-98928828 GATGGGGCTGTGGAAAAGTCAGG - Intergenic
1122273009 14:100576734-100576756 GATGGAGCTGTGCAGAGCGTCGG - Intronic
1122352577 14:101104539-101104561 TATGGGCAAGTGGAGAGCCCCGG + Intergenic
1122778681 14:104134527-104134549 GATGGCGGTATGGAGGGCCCTGG + Intergenic
1122874953 14:104659676-104659698 GCAGGGGCTGTGGAGCACCCTGG - Intergenic
1123404735 15:20012935-20012957 GATGGGGCTGGGGTCAGCCTAGG + Intergenic
1123514068 15:21019582-21019604 GATGGGGCTGGGGTCAGCCTAGG + Intergenic
1124141934 15:27084842-27084864 CAGGGGGCTCTGAAGAGCCCAGG - Intronic
1124253895 15:28125415-28125437 ACAGGGGCTGTGGAGAGTCCTGG - Intronic
1124395244 15:29294984-29295006 GAGGGGGATGTGCAGAGCCCAGG + Intronic
1125999343 15:44194848-44194870 GCTGGGGCTGGGGCGACCCCTGG + Intronic
1127828986 15:62733165-62733187 CATGGAGCTGTGGAGAGGGCAGG + Intronic
1127831669 15:62756489-62756511 GCTGGGGCTGTGGAGGGAGCTGG - Intronic
1127838050 15:62806641-62806663 GAGGGAGCTGTGGAGACCCAGGG + Intronic
1127991165 15:64118888-64118910 GATGTGGCTGTGGAAAGCATAGG + Intronic
1128155447 15:65388960-65388982 GATGGGGGTGTGGAGGGCCCTGG + Exonic
1128636311 15:69304718-69304740 GAAGGGGCTGTGGTGTGTCCAGG - Intronic
1128733092 15:70034093-70034115 AATGGGGCTGTGGGGAGGCCAGG + Intergenic
1128996968 15:72304546-72304568 GCTGGGGTTCTGGGGAGCCCAGG - Intronic
1129166715 15:73782671-73782693 GGTGGAGGTGTGGAGAGCTCAGG - Intergenic
1129603737 15:77014697-77014719 CGTGGGGGTGTGGAGGGCCCTGG + Intronic
1129663146 15:77564623-77564645 TATGGGGCTGTGGGGAGTCTAGG - Intergenic
1129769111 15:78192476-78192498 GGTGAGGCTGTGGGCAGCCCAGG - Intronic
1129822882 15:78616687-78616709 GATGGAGCAGAGGAGGGCCCGGG - Intronic
1130039886 15:80397682-80397704 GATGGGGCTATGGACAGGCTAGG - Intronic
1130308136 15:82728971-82728993 GATGGGGCTGTGGAGAGAGCAGG + Intergenic
1131582438 15:93657936-93657958 ATTGGGGCTGTGGAGAGCGTGGG + Intergenic
1131587847 15:93715601-93715623 GCTGGGGAGGTGCAGAGCCCTGG + Intergenic
1131590262 15:93740841-93740863 CTTTGGGCTTTGGAGAGCCCAGG - Intergenic
1132285627 15:100660147-100660169 GCTGGGGCTGTGCGGAGCCGGGG + Intergenic
1132498041 16:273110-273132 GCTGGGGCTGTGGGGAGGCCCGG - Intronic
1132553328 16:562117-562139 GCTGGGGCGGTGGACAGCCCAGG + Intronic
1132728001 16:1347068-1347090 GGAGGCGCTGTGGACAGCCCTGG - Intronic
1133035457 16:3031535-3031557 GAGGGGGCTGGGCAGAGTCCAGG - Intronic
1133286146 16:4691820-4691842 GCGGGGGCTGTGCAGAGGCCTGG - Intergenic
1135357569 16:21782237-21782259 GATGGGTCTGTGGAGGGCTCTGG + Intergenic
1135456073 16:22598353-22598375 GATGGGTCTGTGGAGGGCTCTGG + Intergenic
1135539830 16:23321347-23321369 GATGATGCTGTTGAGAGTCCAGG - Intronic
1136233973 16:28903468-28903490 GAAGGGGCTGTGGTGGGGCCAGG - Intronic
1136479356 16:30532297-30532319 AAGGGGGCCTTGGAGAGCCCAGG + Exonic
1136483061 16:30554991-30555013 GAGGGGGCCTTGGAGAGCCCTGG + Exonic
1136620890 16:31427851-31427873 GGTAGGGCTGTGGAGAGAGCGGG + Exonic
1137585842 16:49663806-49663828 CATGGGGATGGGGAGGGCCCTGG - Intronic
1137926424 16:52546415-52546437 GGAGGGGCTGAGGAGAGCGCCGG + Intronic
1138519493 16:57563013-57563035 GAGGGGGCTGTAGACAGCCTGGG - Intronic
1139597612 16:67967607-67967629 GAAAGGGCTGTGGAGAGACGCGG + Intronic
1142008962 16:87704228-87704250 GAGGCGCCTGTGGAGAGCCCTGG + Intronic
1142259507 16:89036236-89036258 GAGGGGGATGGGGAGAGCCAGGG - Intergenic
1142291268 16:89194600-89194622 GCTGGGGCAGGGCAGAGCCCCGG + Intronic
1142754803 17:2009868-2009890 GCTGGGGCTGTGGACAGGGCCGG - Intronic
1143088970 17:4437238-4437260 CATGGGGCTGAGAGGAGCCCAGG + Intronic
1143091968 17:4454251-4454273 GCTGGGGCTTTGGGGAGCCAGGG - Intronic
1143106485 17:4532961-4532983 GCTGCGGCTGGGGAGAGGCCAGG - Exonic
1143152554 17:4816557-4816579 CATGGGGCTGTACAGAGCCAGGG - Intronic
1143229581 17:5341211-5341233 GTTGAGGCTGTGGTGAGCCATGG + Intronic
1143585618 17:7848859-7848881 CAGAGGGCTGTGGGGAGCCCTGG - Exonic
1144185429 17:12791036-12791058 GATGGGGGTGGGGACATCCCTGG + Intronic
1144892136 17:18500238-18500260 GAGGGGCCTGTGGGGACCCCGGG + Intergenic
1145140080 17:20444050-20444072 GAGGGGCCTGTGGGGACCCCGGG - Intergenic
1145262091 17:21360629-21360651 GATGGGGAAGTGGAGGACCCTGG - Intergenic
1145830133 17:27909441-27909463 TATGGGGCTGTGGAGAGGGCAGG - Intergenic
1145973125 17:28968586-28968608 GATGGGGCTGTAGAGTGGCTTGG - Intronic
1146062491 17:29614510-29614532 GGTGGGGCAGGGGAGAGCCGGGG - Exonic
1146548965 17:33763738-33763760 GATGGTGCTGAGAAGATCCCAGG + Intronic
1146661236 17:34666364-34666386 GATGAGGCTGCTGAGACCCCTGG + Intergenic
1147536579 17:41326053-41326075 GAAGGTGTTGTGGGGAGCCCTGG + Intergenic
1148191454 17:45681439-45681461 GATGGTGCGGTGTAGGGCCCAGG - Intergenic
1148208780 17:45795680-45795702 AATAGGCCTGTGGGGAGCCCAGG - Intronic
1148386458 17:47238168-47238190 GACAGGGCGGGGGAGAGCCCTGG - Intergenic
1148496381 17:48055550-48055572 GATGGGGATTTGGTGAGTCCTGG + Intronic
1148539774 17:48471132-48471154 GTTGAGGCTGTGGTGAGCCATGG + Intergenic
1148987124 17:51632722-51632744 GATGGGGTCTTGGAGAGCCCTGG - Intronic
1150488620 17:65560404-65560426 GATGGGGCGGAGGAGAGGCGGGG + Intronic
1151388971 17:73772827-73772849 AGTGGGGCAGTGGAGAGCTCAGG - Intergenic
1151873229 17:76850720-76850742 GGTGGGGCTGAGCACAGCCCAGG + Intergenic
1151889650 17:76944570-76944592 GACAGGGCTGTGCAGAGCACGGG + Intronic
1152049306 17:77959467-77959489 GACGGGGCTGTGCAGACGCCCGG + Intergenic
1152160518 17:78665687-78665709 GAAGGGGCTGGGGAGAGCTGCGG + Intergenic
1152249273 17:79203191-79203213 GATGGGGCTGTGACAACCCCTGG + Intronic
1152347158 17:79760230-79760252 AAAGGGGCTCTGGGGAGCCCTGG + Intergenic
1152433923 17:80263804-80263826 GCTGGGGCAGTGGGGACCCCTGG + Intronic
1152509836 17:80779114-80779136 GATGAGGCTGAGGACAGCCATGG - Intronic
1152624575 17:81382344-81382366 GGAGGGGACGTGGAGAGCCCTGG - Intergenic
1152875065 17:82781735-82781757 GCAGGGGCTGTGGAGATCGCAGG + Intronic
1153634828 18:7104603-7104625 GAAGAGGCTGTGGAGAGGTCTGG + Intronic
1154051357 18:10962338-10962360 TATGAGGCTGTGGGGAGCCGAGG - Intronic
1154502066 18:15002015-15002037 TTTGGGGCTGTGCAGAGCACAGG + Intergenic
1155661431 18:28253458-28253480 GTTGAGGCTGTGGCGAGCCAAGG - Intergenic
1155683641 18:28520536-28520558 GATGGGAGTGTGGAGGGCCAGGG - Intergenic
1155683657 18:28520626-28520648 GATGGGAGTGTGGAGGGCCAGGG - Intergenic
1157469986 18:47981788-47981810 AATGGGGTTGTGAAGAGTCCGGG - Intergenic
1158348696 18:56541855-56541877 CAAAGGGCTGTGCAGAGCCCTGG - Intergenic
1158718447 18:59900618-59900640 GAAGGGGCAGGAGAGAGCCCCGG + Intronic
1159102949 18:63975354-63975376 GATGAGGTTGTGGAGGACCCCGG + Intronic
1160163223 18:76491292-76491314 GATGGGGCTGTGGAGGGCCGGGG - Intronic
1160688752 19:450502-450524 GATGGGGCTGGGGAGGGGACGGG - Intronic
1161511525 19:4674935-4674957 GCTGAGGCTCTGGGGAGCCCGGG + Intergenic
1161678941 19:5669367-5669389 GATGGGGCTCTGACCAGCCCAGG + Intergenic
1162861036 19:13506030-13506052 GATGGGGTTGTAGAGTGCCATGG + Exonic
1162907652 19:13833210-13833232 GATGGGGGTGGGGGGCGCCCTGG + Intergenic
1162983433 19:14254060-14254082 AACGGGGCTGCGGAGATCCCCGG + Intergenic
1163695226 19:18760473-18760495 GATGGTGCTTTGGGGAGTCCAGG + Intronic
1164697745 19:30259453-30259475 GATGGGTCTGGGGTGAGGCCCGG - Intronic
1164805346 19:31112067-31112089 GAGGGTGGTGAGGAGAGCCCCGG - Intergenic
1165132523 19:33641650-33641672 GAGGGGGTTCTGGACAGCCCAGG + Intronic
1165166895 19:33863304-33863326 GGTGGGGGTGGAGAGAGCCCAGG + Intergenic
1165196845 19:34110867-34110889 GATGGGACGGTGGGGAGCTCAGG - Intergenic
1165959177 19:39520209-39520231 GCTGGGGCTGGGGTGAGCTCAGG + Exonic
1166228545 19:41412110-41412132 GCTGGGGCTCTGGGCAGCCCTGG - Intronic
1166329468 19:42069841-42069863 GCTGGGGGCGGGGAGAGCCCGGG + Intronic
1166388925 19:42397996-42398018 GAGGGGGTAGTGGAGAGCCATGG + Intergenic
1166896151 19:46022974-46022996 AAGGAGGCTGGGGAGAGCCCAGG + Exonic
1166938642 19:46350033-46350055 GGTGGGGCTCTGGGGAGCCCTGG + Intronic
1166963351 19:46513266-46513288 GCTGGGGGTGGGGTGAGCCCAGG - Intronic
1166981425 19:46634383-46634405 GATGGGGCAGGGGAGGGGCCAGG - Intronic
1166996897 19:46723715-46723737 CAGGGGGCTTTGGAGAGACCAGG - Intronic
1167117834 19:47498327-47498349 GCAGAGGCTGTGGGGAGCCCAGG + Intronic
1167709300 19:51100099-51100121 GATGGGGCCATGGAGCCCCCTGG + Intronic
1168102131 19:54146884-54146906 GATGCTGCTGTGGAGTGCCCTGG + Intronic
1168276816 19:55283525-55283547 GATGGAGCTGTAGAGAGGGCCGG - Intronic
925443261 2:3906481-3906503 GGTGGGGCTGCACAGAGCCCTGG + Intergenic
926113391 2:10196548-10196570 GGTGGGGGTGTGAAGAGTCCAGG + Intronic
926125050 2:10266941-10266963 GGTGGGGATGTGGGGGGCCCAGG - Intergenic
926415369 2:12644220-12644242 GAAGAGGCTGTGGAGTGCCAGGG + Intergenic
927275248 2:21256983-21257005 GAGGAGACTGTAGAGAGCCCCGG + Intergenic
927540295 2:23903968-23903990 GATGGTGGTGTGGGGAGCCAGGG + Intronic
928127790 2:28628252-28628274 GATGGGACTGCCGAGAGCCAAGG + Intronic
930017861 2:46983266-46983288 GATGGGGCTGAGGACGGCCCGGG + Intronic
930748199 2:54906380-54906402 GATGCTGCTGTGGAGGGGCCTGG + Intronic
931668174 2:64624944-64624966 GATGGGGCCGGGGAGACCACCGG - Intergenic
931690555 2:64831594-64831616 GAGGCGGCGGTGGACAGCCCCGG + Intergenic
932212341 2:69943147-69943169 GATGGGGCAGTGGAGAGGGTGGG - Intergenic
932428674 2:71660079-71660101 GCTGGGGCTGCAGAGTGCCCAGG - Intronic
934079209 2:88452780-88452802 GGCGGGGGCGTGGAGAGCCCAGG - Intergenic
934117263 2:88809566-88809588 GATGAGCCTGTGGAGAGCCTCGG + Intergenic
934860958 2:97763323-97763345 GATGGCGGAGTGGAGAGCACGGG - Intronic
935046665 2:99489626-99489648 GAAGGCGCCGTGGACAGCCCAGG + Intronic
936052286 2:109233500-109233522 GATGGGGGTGTGGTGGGCCAGGG + Intronic
936410556 2:112254662-112254684 GCCGGGGCTGTCGAGAGCCTGGG - Intronic
936470967 2:112798234-112798256 GATGGGGCAGATGAGGGCCCCGG + Intergenic
936513474 2:113167245-113167267 GCTGGGGCAGAGGAGAGCCAGGG + Intronic
937311516 2:120905986-120906008 GATGGGGCTGTGCAGTCCCAAGG + Intronic
937375543 2:121333507-121333529 GATGGGGCTGGGGACAGGACGGG - Intergenic
938291711 2:130154213-130154235 CATGGGGCTGAGCAGAACCCGGG - Intronic
938464839 2:131518750-131518772 CATGGGGCTGAGCAGAACCCGGG + Intergenic
938558781 2:132451092-132451114 CATGGGGCTGTGGGAAGCTCTGG + Intronic
938762091 2:134435218-134435240 GATGGGGTTCAGGAGGGCCCTGG - Intronic
940981369 2:160007416-160007438 GATGGGGGTGTGGCAAGCCAGGG - Intronic
940984421 2:160038478-160038500 GATGGGGCGCTCCAGAGCCCAGG + Intronic
942249108 2:174032773-174032795 GCTGTGGCTGTGAAGAGGCCAGG - Intergenic
942314068 2:174682502-174682524 GAAGGGGCCGTGGACAGCCTGGG - Intronic
943404365 2:187461599-187461621 GATGGGGGTGTGGTGGGCCAGGG - Intergenic
944301669 2:198130953-198130975 GAAGGAGCTGTGGGAAGCCCTGG - Intronic
944916910 2:204370254-204370276 GATGGGGCTGTGGGGAGGAGGGG - Intergenic
945812935 2:214570194-214570216 GAGGTGGCTGTGGAGAGCCCAGG - Intronic
946097233 2:217285768-217285790 CATGGGAATGTGGATAGCCCTGG - Intronic
946144319 2:217717641-217717663 GATGGAGATGGGGAGAGACCAGG - Intronic
946188622 2:217995750-217995772 GGTGTGGGTGTGGAGAGACCAGG - Intronic
946861120 2:224001245-224001267 GGGGTGGCTGTGGAGGGCCCAGG - Intronic
947242588 2:228012098-228012120 GTTGGGGCTGCGGTGAGCCATGG + Intronic
947785527 2:232815066-232815088 GCTGGAGCTGTGGAGACCTCTGG - Intronic
948288855 2:236809122-236809144 CATGAGGCTGTGGAGAGGCAGGG + Intergenic
948373411 2:237505031-237505053 GGTGGGGTTGTGGGGAGCTCTGG - Intronic
948505186 2:238423418-238423440 GGTGGGGCTGGGCAGGGCCCAGG - Intergenic
948564804 2:238877963-238877985 AATGGAACTGTGGAGAGCTCAGG + Intronic
948654316 2:239467040-239467062 GATGGGGCTGTGCACATCCATGG + Intergenic
948666134 2:239535893-239535915 GACGGGGGTGTGGAGCTCCCCGG - Intergenic
948933483 2:241147980-241148002 GCTGTGGCTGTGGAGTGCACGGG - Intronic
1169000467 20:2164370-2164392 GATGGGGTGGAGGTGAGCCCTGG - Intronic
1169029112 20:2394567-2394589 GCTGGAGCTGAGCAGAGCCCTGG + Exonic
1169503610 20:6184881-6184903 GATGGGGATGTGGTGAGCCAGGG + Intergenic
1170816886 20:19721283-19721305 GATGGGTCAGGGGAGAGCCTGGG - Exonic
1170979260 20:21195843-21195865 GGTGGGGCTGTGGAGAGCTGGGG - Intronic
1171179462 20:23081806-23081828 GTTGGGGCTGTGGGAAGCCAAGG + Exonic
1172164527 20:32891006-32891028 GATGTTGCAGTGGAAAGCCCAGG - Intronic
1172305116 20:33875235-33875257 GATGGGGTTGTGGTGGGGCCGGG + Intergenic
1173421427 20:42904700-42904722 GATGGGGGTGTGGTGGGCCAGGG - Intronic
1174085855 20:48006754-48006776 GATGGAGCTGCCCAGAGCCCAGG + Intergenic
1175716901 20:61261026-61261048 CAAGTGGCTGTGCAGAGCCCGGG - Intronic
1175785707 20:61710566-61710588 GCAGGGGCTGTGGAGTTCCCTGG - Intronic
1176011179 20:62896771-62896793 GATGGGGTAGCGGAGAGCCATGG + Exonic
1176156626 20:63625466-63625488 GAAGGGGCTGTGGAGAGGCCAGG - Intronic
1176993311 21:15523733-15523755 GATGGGGAGGTGGTGAGCCAGGG - Intergenic
1178808745 21:35861518-35861540 GAGATGGATGTGGAGAGCCCAGG + Intronic
1179474123 21:41632435-41632457 GATGGGGCTGGGTGGAGGCCAGG + Intergenic
1179495110 21:41766647-41766669 GCGGGGGCTTTGGCGAGCCCGGG - Intronic
1179802285 21:43816658-43816680 GCTGGGGCTGTGGCCAGCTCCGG - Intergenic
1179922382 21:44514127-44514149 GAAGGGGCTGGGCAGAGCCTGGG - Intronic
1179993114 21:44958814-44958836 AATGGGGCTGGGGAGCTCCCTGG + Intronic
1180767754 22:18356314-18356336 GTTGGGGCTGTGTTGAGCCGAGG + Intergenic
1180823963 22:18850559-18850581 GTTGGGGCTGTGTTGAGCCGAGG - Intronic
1180969768 22:19809122-19809144 AATGGGGGTGTGGTGAGCCAGGG - Intronic
1181496339 22:23289312-23289334 GGTGTGGCCCTGGAGAGCCCAGG - Intronic
1181631436 22:24153670-24153692 GATGGGGCTTTGGAGAGGGCTGG + Intronic
1181650335 22:24255672-24255694 GTTGGGGCTGTGTTGAGCCGAGG - Intergenic
1181707044 22:24655066-24655088 GTTGGGGCTGTGTTGAGCCGAGG + Intergenic
1182072960 22:27476255-27476277 CATGGGGATGGTGAGAGCCCAGG + Intergenic
1182218838 22:28742095-28742117 GATGTGGCGGGGGAGAGCCGGGG + Exonic
1182358451 22:29733340-29733362 GAGGGGGAGGTGGAGAGCCGGGG + Intronic
1182582304 22:31321517-31321539 CATCGGACTGTGAAGAGCCCCGG - Intergenic
1182994652 22:34801209-34801231 GATGGGGGTGTGGTGGGCCAGGG - Intergenic
1183133792 22:35866881-35866903 GATGGGGATGTTGAGACTCCTGG - Intronic
1183239503 22:36646744-36646766 GGTGGGGTTGTGGGGAGCCCAGG - Intronic
1183303525 22:37070073-37070095 GGTGGGGCTGGGGAGCCCCCAGG - Intronic
1183334237 22:37237500-37237522 GATGGGGCTGCCGAGAGGCCAGG + Intronic
1183343817 22:37296067-37296089 TAGGTGGCTGTGGAGGGCCCGGG + Intronic
1183772486 22:39938819-39938841 GATGGGAGTGGGGAGCGCCCTGG + Intronic
1184117825 22:42432284-42432306 CAGGGGGCTGCGGGGAGCCCAGG + Exonic
1184201171 22:42970951-42970973 GAGAGGGCTGTGGAGAGGCTGGG - Intronic
1184203543 22:42985827-42985849 GATGAGACTGTGGAGAACCTGGG - Intronic
1184477170 22:44728143-44728165 GAAGGGGCAGAGGACAGCCCTGG + Intronic
1184615620 22:45636238-45636260 GATGGGGATGGGGAGAACCCTGG + Intergenic
1184660089 22:45961638-45961660 GACGGGGCTGGGGAGAGCAGAGG + Intronic
1184934227 22:47707209-47707231 GATGGGGGTGTGGTGGGCCAGGG + Intergenic
1185020777 22:48373654-48373676 CACGGGGCTGGGAAGAGCCCAGG + Intergenic
1185369908 22:50456197-50456219 GACGGGGCAGTGCAGAGACCTGG + Exonic
1203216521 22_KI270731v1_random:8926-8948 GTTGGGGCTGTGTTGAGCCGAGG + Intergenic
1203229369 22_KI270731v1_random:97197-97219 GTTGGGGCTGTGTTGAGCCGAGG + Intergenic
949875813 3:8625382-8625404 GATAAGGCTGTGGGGAGCCTGGG - Intronic
949960566 3:9308818-9308840 GATGGGGTGGAGGAGAGGCCAGG - Intronic
950452506 3:13073203-13073225 CAGCGGGCTGTGGAGGGCCCTGG + Intergenic
952277617 3:31892634-31892656 GAGGAGGCTGGGGACAGCCCAGG - Intronic
952661566 3:35856382-35856404 GATCTGGCTGTGGAGTGGCCAGG + Intergenic
952873326 3:37921271-37921293 GATGGGGCAGTGGAAAGATCTGG - Intronic
953452463 3:43016103-43016125 GAAGGGGCTGTGTGAAGCCCCGG + Intronic
953493853 3:43370167-43370189 GATGGGGAAGTGGTGAGCACTGG + Intronic
954553718 3:51502639-51502661 GAAGGGGCTTTGGAGAAGCCAGG + Intergenic
954634691 3:52065116-52065138 GATGGGGCTGGGGGTTGCCCTGG + Intergenic
954873277 3:53784134-53784156 GAGGGGGCAGCGGAGACCCCCGG - Intronic
955578635 3:60394521-60394543 GAAGCGGCAGTGGAGAGCCATGG + Intronic
955755006 3:62217702-62217724 GCTGGGGCTGGGAAGAGCACAGG - Intronic
960047689 3:113212842-113212864 GACGGGGCTGTGGGGAGGGCAGG + Intronic
960901852 3:122561816-122561838 AATGGGGCTCAGGAGAGCCATGG - Intronic
961163445 3:124748708-124748730 GCTGGGGTTGGGGGGAGCCCAGG + Intergenic
961184215 3:124900624-124900646 GATTAGGTTGGGGAGAGCCCTGG - Intronic
962474235 3:135741509-135741531 GATGGGGACCTGGAGAGGCCCGG - Intergenic
963001820 3:140688474-140688496 GATGGCTCTGTGAAGACCCCAGG + Exonic
964382749 3:156114310-156114332 GGTGGGGCTTTGAAGAGGCCAGG - Intronic
964797299 3:160513321-160513343 GTTGAGGCTGTGGTGAGCCATGG - Intronic
964801817 3:160565658-160565680 GAAGGGGCGATGGAGAGCCGGGG + Intergenic
965074051 3:163953754-163953776 GCTGGGGGTGGGGAGAGGCCAGG + Intergenic
965320431 3:167247118-167247140 GATGGGGATGTGGTGGGCCAGGG - Intronic
967627910 3:191707962-191707984 GATGGAGCAGGGCAGAGCCCTGG - Intergenic
967928462 3:194672141-194672163 CATGGGCCGGAGGAGAGCCCCGG - Exonic
967956513 3:194881446-194881468 GATGGAGCAATGGAGAGTCCAGG - Intergenic
968282749 3:197489480-197489502 CCTGGGGCTGAGGAGTGCCCAGG + Intergenic
968284062 3:197498003-197498025 GAGGAGGCTGTGGTGGGCCCAGG - Intergenic
968324299 3:197799133-197799155 GCTGGGGCTGAGGAGTTCCCAGG + Intronic
968491861 4:894269-894291 GTTGGGGCCGTGGGGAGCGCAGG + Intronic
968606339 4:1537488-1537510 GATGGGGCGGTGGAGGGCCAGGG + Intergenic
968631883 4:1656106-1656128 GAAGGGGCCCTGGAGAGTCCTGG - Intronic
968727037 4:2252581-2252603 GGTGGGTCTGTGCAGGGCCCTGG - Intronic
968956043 4:3720126-3720148 GATGAAGCTGGGGAGGGCCCGGG - Intergenic
969078659 4:4601293-4601315 AAAGGGGCTGGGGAGAGACCTGG - Intergenic
969619719 4:8273001-8273023 GACAGGGCTGGGGAGAGGCCGGG - Intronic
970420159 4:15898471-15898493 GAATGGGGTGTAGAGAGCCCAGG - Intergenic
971831463 4:31701405-31701427 GATGGGGGTGTGGTGGGCCAGGG - Intergenic
974752015 4:66154100-66154122 GATGGGGGTGTGGGGGGCCAGGG - Intergenic
980100743 4:128539150-128539172 GATGGGGGTGTGGTGGGCCAGGG + Intergenic
980932113 4:139192116-139192138 GTTGGGGCTGAGGTGAGCCATGG - Intergenic
981906215 4:149924350-149924372 GATGGGGGTGTGGCGGGCCAGGG + Intergenic
982202705 4:152975253-152975275 GAGGGGACTGTGCTGAGCCCAGG - Exonic
982442878 4:155457507-155457529 TATCAGGCTGTGGTGAGCCCAGG + Intergenic
982551380 4:156804514-156804536 GATGGGAATGTGGAGAGCAGAGG - Intronic
982745755 4:159103229-159103251 GAGGGGGCCGCGGACAGCCCGGG - Intergenic
982999219 4:162390844-162390866 GATGGAGCTCTGGAGAATCCAGG - Intergenic
983062353 4:163174107-163174129 GATGGGGCAGTGGAGAGCTTTGG - Intergenic
984620793 4:181949906-181949928 GAGGTGGCTGTGCAGAGGCCTGG - Intergenic
985549329 5:525037-525059 GATGGGGCAGGGGAGACCACGGG - Intergenic
985552786 5:541773-541795 GGTGGGGCTGGGGAGGGGCCGGG + Intergenic
985929646 5:3047092-3047114 GATGCTGCAGTGGAGAGCCCTGG + Intergenic
987076023 5:14382516-14382538 GGTGGGGGTGTGGTGAGCACTGG + Intronic
988455431 5:31383182-31383204 AATGGGGCTGTGGAGAACAGTGG - Intergenic
989531860 5:42516715-42516737 CATGTGGCTTTGGAGAGCCTTGG + Intronic
989558562 5:42825395-42825417 GATGGGGGTGTGGTGGGCCAGGG - Intronic
990560677 5:56980329-56980351 GGTGGGGGTGTGGTGAGCCAGGG + Intergenic
991967840 5:72108889-72108911 GCTGGGGCTGCGGAGGGACCCGG - Intronic
992038146 5:72802243-72802265 GATGGGGGTGTGGTGGGCCAGGG - Intergenic
993297057 5:86153764-86153786 GATGGGGCTGGGCAGAACCATGG + Intergenic
997368217 5:133339207-133339229 GGTGGGGCTGTGCAGAGGGCTGG + Intronic
997882454 5:137602730-137602752 TATGGGTCTGTGGGGTGCCCTGG + Intergenic
998381739 5:141730612-141730634 GATGGGGTTCTGGAAAACCCTGG - Intergenic
1000097753 5:157986364-157986386 AATGGGACAGTGGAGAGGCCAGG + Intergenic
1001396969 5:171424666-171424688 AAGGGGGATGTTGAGAGCCCAGG + Intronic
1001416962 5:171552101-171552123 GATGTGGCAGTGGAGAGCAGTGG + Intergenic
1001679337 5:173544553-173544575 AATGGAGCTGTGGAGCACCCAGG - Intergenic
1001756920 5:174177566-174177588 GATGGGGCTGTGCTAAGCACTGG - Intronic
1001929831 5:175665022-175665044 GGTGGGGCTGAGGAGAGAGCAGG + Intronic
1001934442 5:175694455-175694477 GATAGGGCCAGGGAGAGCCCAGG - Intergenic
1002173944 5:177391022-177391044 AATGGGCCTGTGGACAGCCCTGG - Intronic
1002311900 5:178319997-178320019 GAATGGGCAGAGGAGAGCCCTGG - Intronic
1002342135 5:178524197-178524219 GATGGGGAAGGAGAGAGCCCTGG - Intronic
1002569903 5:180134379-180134401 GGTGGGGCTGGGGTAAGCCCTGG - Intronic
1002614017 5:180439216-180439238 GATGGAGCTGTGGGGAACACTGG - Intergenic
1003179481 6:3779826-3779848 TAGGGGGCTGGGGAGAGGCCGGG + Intergenic
1003491930 6:6630343-6630365 AATGGGGCTGTGGGTATCCCAGG - Intronic
1004440230 6:15642591-15642613 GCTGAGGGTGTGGAGATCCCAGG - Intronic
1006015094 6:31074413-31074435 CAAGGGGCCATGGAGAGCCCTGG - Intergenic
1006516484 6:34548453-34548475 GATGGGGCAATGGGGAGCCATGG - Intronic
1006807861 6:36800123-36800145 GGTGGGGCAGGGGAGAGCACTGG + Intronic
1007355106 6:41309139-41309161 GTGGGGGCTCTGGAAAGCCCTGG - Intergenic
1007652609 6:43432684-43432706 GTGGGGCCTGTGGAGAGCTCCGG + Exonic
1008434121 6:51455161-51455183 GGGGGGGCTGTGTAGAGACCAGG - Intergenic
1008528035 6:52427292-52427314 GATGAGGCTGGGGAGAGAGCAGG - Intronic
1008843699 6:55936253-55936275 GATGAGCATGTGGAGAGCCTTGG - Intergenic
1011310338 6:85973916-85973938 GAAGGAGCTGTGGGGAGGCCTGG + Intergenic
1016937025 6:149455144-149455166 GCTGGGGCTTTGGAGAGGGCAGG - Intronic
1018170231 6:161138708-161138730 TCTGAGGCTTTGGAGAGCCCGGG - Intronic
1018174703 6:161168457-161168479 GATAGGGCTGTGGAGGGTACTGG - Intronic
1018257957 6:161941195-161941217 GATGGGGATGTGGAAGGCCAGGG - Intronic
1018627493 6:165793558-165793580 GCTGGGGGTGTGGAGAGCACAGG - Intronic
1018863422 6:167729869-167729891 GTTGGGGATGTGGATAGCCGGGG + Intergenic
1018906399 6:168078718-168078740 CATGGGGGTGAGGAGGGCCCTGG - Intronic
1019587439 7:1813132-1813154 GAAGGTGCTTTGGAGATCCCTGG + Intergenic
1019587813 7:1814470-1814492 CATGGGGCTGTGGCCACCCCAGG + Intergenic
1019643961 7:2119303-2119325 GAAGGCGCTGCGGAGAGCCATGG - Intronic
1019699667 7:2468534-2468556 GATGGGGGTGTGGGGGGCACTGG + Intergenic
1020135675 7:5586644-5586666 GCCGGGGCCGGGGAGAGCCCTGG + Intergenic
1020460980 7:8429840-8429862 GTTGGGGGAGTGGAGAGGCCAGG + Intergenic
1021716989 7:23469767-23469789 GCCGGAGCTGAGGAGAGCCCCGG + Intronic
1022309649 7:29184772-29184794 GATTGGGCTGTGGGGTGCCCAGG - Intronic
1022539200 7:31120880-31120902 GATGGGGCTGTAGACAGTCCTGG - Intergenic
1023706206 7:42944198-42944220 GATGGGGCTGTGGTGACGGCAGG - Intronic
1023818325 7:43966483-43966505 GAGGAGGCTGTGGGGAACCCAGG - Intergenic
1023870179 7:44259042-44259064 GATCGGGCTGGGTAGGGCCCGGG + Intronic
1023986800 7:45101690-45101712 GATGGGACTGTGGGGAGCCCAGG + Intronic
1024628927 7:51231601-51231623 CATGCTGCTGTGGACAGCCCTGG - Intronic
1024980855 7:55156365-55156387 GAAGGGGCTGGGGAGAGTGCAGG - Intronic
1025000353 7:55310750-55310772 GATGTGGCTGTGGAGAAACCTGG - Intergenic
1025106707 7:56176335-56176357 GATGGGGCTGCCAAGAGCCGGGG + Intergenic
1025840471 7:65141548-65141570 GATGGGGCAGCCGAGAGACCCGG + Intergenic
1025943475 7:66089543-66089565 GGTGGGGCTGTGGGGACCCTGGG + Intronic
1026017351 7:66681925-66681947 GCTGGGGCGCTGGGGAGCCCCGG - Intronic
1026025389 7:66740494-66740516 GGTGGGGCGCTGGGGAGCCCCGG - Intronic
1026111110 7:67459536-67459558 GATGGGGGTGTGGTGGGCCAGGG + Intergenic
1026450012 7:70520351-70520373 CATGTGGCTGAGGAGAGACCAGG - Intronic
1026796074 7:73366927-73366949 GATGGGGCTGTGGGGAGGAGGGG - Intergenic
1027052585 7:75029288-75029310 GCTGGGGCTGGGAAAAGCCCTGG - Intronic
1027175187 7:75898969-75898991 CATGGGGCTGGGCAGGGCCCCGG - Intergenic
1028070214 7:86441250-86441272 GGTGGGGATGTGGAGAACCTTGG + Intergenic
1028849902 7:95526394-95526416 GAAGGGGCTGTGTAGAGGCAGGG - Intronic
1029742955 7:102501315-102501337 GAGGAGGCTGTGGGGAACCCAGG - Intronic
1029760945 7:102600476-102600498 GAGGAGGCTGTGGGGAACCCAGG - Intronic
1030088872 7:105840068-105840090 GAGTGGTCTGTGGAGAGCACAGG + Intronic
1030363025 7:108615211-108615233 GACTGGGATGTGGAGTGCCCAGG - Intergenic
1031794726 7:126157317-126157339 GAGGGGGGCGTGGAGAGCCATGG - Intergenic
1032191967 7:129770664-129770686 GAGGGGGCTGAGGAGGGACCGGG - Intergenic
1032193936 7:129779376-129779398 GAGGGGGCTGCGGAGAGCGCCGG - Intergenic
1032718211 7:134528876-134528898 GCTGGGGCTGCAGAGAGCCTGGG + Intronic
1034192632 7:149223843-149223865 GCTGGGGCTGTGGCGGGGCCGGG - Exonic
1034433958 7:151054286-151054308 GATAGGGCTGTGGAGAGGCAGGG + Exonic
1034501030 7:151451286-151451308 GCTGGTGCTGAGAAGAGCCCTGG - Intergenic
1035287895 7:157817680-157817702 GAGGGGGCCAAGGAGAGCCCTGG + Intronic
1036206467 8:6809097-6809119 GCTGGAGCTGGGGAGGGCCCAGG + Exonic
1037567813 8:20132271-20132293 GTTTGGGCTGCGGAGATCCCTGG - Intergenic
1037624190 8:20593201-20593223 AATGGGCATGGGGAGAGCCCTGG + Intergenic
1037833957 8:22205336-22205358 GATAGTGCTGTGCAGAGCCGGGG + Intronic
1039574291 8:38611195-38611217 GATGGGGTTCCGGGGAGCCCAGG + Intergenic
1040077856 8:43258248-43258270 GATGGGGTGGTGGAGTGCTCAGG + Intergenic
1040555515 8:48474459-48474481 GAGTGGGTTGTGGAGAGCACTGG + Intergenic
1041025898 8:53686565-53686587 GATGAGGATGTGGAGAAACCGGG + Intergenic
1042936109 8:74060052-74060074 CAGGGGGCTGAGGTGAGCCCAGG + Intergenic
1044182906 8:89218036-89218058 GAGTGGGCTGAGGAGAGACCAGG + Intergenic
1044515125 8:93128653-93128675 GATGAGTGAGTGGAGAGCCCTGG - Intergenic
1045610153 8:103830874-103830896 GATGAGGCTGTGGTGAGCCAAGG - Intronic
1045942460 8:107755144-107755166 GATGGGGGTGTGGTGGGCCAGGG - Intergenic
1046236908 8:111436161-111436183 GGTGGGGCTGTGGAGAACAGGGG - Intergenic
1046414019 8:113886828-113886850 GATGGTTCTGTGGAGAGCAAAGG - Intergenic
1048493935 8:134919983-134920005 GATGGGGATGTGGTCAGGCCTGG - Intergenic
1049140410 8:140949503-140949525 GAGTGGGCTGGGGAGAGGCCAGG - Intronic
1049257444 8:141621427-141621449 GCTGGGGCAGTGGCGAGTCCAGG + Intergenic
1049302597 8:141879557-141879579 GATGGGGATGATGAGAGGCCTGG - Intergenic
1049421068 8:142516961-142516983 GCTGGGGCTGTGCAGGGCCATGG + Intronic
1049835203 8:144730820-144730842 GAAGGGGCAGTGGTGAGCACAGG - Intronic
1049879412 8:145052154-145052176 GATGGGGCTGGGGCGGGGCCTGG - Intergenic
1050900888 9:10947374-10947396 GATGGGGGTGTGGTGAGCCAGGG + Intergenic
1051142054 9:13988208-13988230 CAGGGGGCTGTGGAAAGCCAGGG - Intergenic
1051512208 9:17890700-17890722 AATGGGGCTGTGATGAGACCAGG + Intergenic
1051526981 9:18056408-18056430 GCTGCTGCTGTGCAGAGCCCCGG - Intergenic
1051722187 9:20048835-20048857 GATGGGGGTGGGGAAAGGCCTGG - Intergenic
1052033927 9:23659066-23659088 GAAGAGGGTGTGGAGAGCGCCGG + Intergenic
1052980278 9:34443408-34443430 GACAGGGCTGTGGTGAGGCCAGG - Intronic
1053221511 9:36316945-36316967 GATGGAGCTGTGGAGAGGAATGG + Intergenic
1054855264 9:69892669-69892691 GATGGGGTTGTGGCGGGCCAGGG - Intronic
1054930185 9:70627770-70627792 GATTAGGCTGTGGAGGGCCAAGG - Intronic
1055637804 9:78295587-78295609 CATGGGACTGTGTATAGCCCTGG + Intergenic
1055734418 9:79312328-79312350 GATGGGGGTGTGGTGGGCCAGGG - Intergenic
1057294380 9:93826892-93826914 GATGGGGGAGGGGAGAGCCGAGG - Intergenic
1057306695 9:93916529-93916551 GGTGGGGCCCTGGAGAGGCCTGG - Intergenic
1057514550 9:95710508-95710530 GCTGGGGCTGAGGACAGCCCAGG - Intergenic
1057882724 9:98805511-98805533 GATGGGGCTGGGTTGAGCTCAGG + Intergenic
1058649103 9:107158463-107158485 GAGGGGGCTCTGGAGAGAGCAGG + Intergenic
1059339375 9:113589033-113589055 GATGAGGCTGGGCAGGGCCCAGG + Intronic
1059946349 9:119412417-119412439 AATGTGGCTGTGGCCAGCCCTGG - Intergenic
1061397981 9:130353836-130353858 GATGGGTCTGAGCAGGGCCCCGG + Intronic
1061778872 9:132984309-132984331 AAGGGGGGTGTGGGGAGCCCTGG + Intronic
1062023275 9:134329117-134329139 CATGCGCCTGTGGAGAGACCCGG + Intronic
1062432581 9:136532675-136532697 GCTGGGGCTGTCAGGAGCCCTGG + Intronic
1062498414 9:136842331-136842353 TTTGGGGCTGTGCAGAGCACAGG - Intronic
1062618340 9:137407973-137407995 CATGAGGCTGGGGAGACCCCCGG - Intronic
1062694285 9:137865222-137865244 GAGGGGGCTGGGGAGAGGCGAGG + Intronic
1062697258 9:137881725-137881747 GATGGGGCTGTGTGGAGCTTAGG - Intronic
1185530729 X:816376-816398 GAGGAGGCTGTGGTGAGCCAAGG + Intergenic
1186167935 X:6846536-6846558 GGTGGGGCAGTAGAGATCCCAGG - Intergenic
1187959768 X:24557566-24557588 AATGCGGCTGTGGAGGCCCCAGG + Intergenic
1189334893 X:40165079-40165101 GAGGGGAATGGGGAGAGCCCAGG + Intronic
1191110297 X:56799062-56799084 GATGGTGGTGTGGAGCCCCCAGG + Intergenic
1191766632 X:64705426-64705448 GATGGGGGTGTGGTGGGCCAGGG + Intergenic
1192153810 X:68728159-68728181 GCTGGGGCTATGGAGATCCAGGG + Intergenic
1192461478 X:71320926-71320948 GTTGAGGCTGTGGTGAGCCATGG - Intergenic
1192496096 X:71617482-71617504 GAAGGGGCTGTGTAAAGGCCTGG + Exonic
1195687735 X:107601428-107601450 GCTGGGGCTCTGCAGAGCCATGG - Exonic
1197859269 X:130951971-130951993 GATGGGACTGTGGGGTGCACAGG - Intergenic
1198480074 X:137033161-137033183 GATGGGGCTGTGGAGGGTGAGGG - Intergenic
1198765426 X:140075180-140075202 GTGGTGGCTGTGGAGAGTCCAGG - Intergenic
1198771784 X:140138382-140138404 GTGGTGGCTGTGGAGAGTCCAGG - Intergenic
1199041490 X:143119795-143119817 GTTGGGGGTGGGGACAGCCCTGG + Intergenic
1199693563 X:150327763-150327785 GCTGGGGCTGTGGAGGGCTACGG - Intergenic
1199697106 X:150350573-150350595 GAGGGGGCTGTGGTGAGCCCTGG - Intergenic
1200042552 X:153380509-153380531 GATGTGGCTCCAGAGAGCCCAGG - Intergenic
1200227794 X:154428725-154428747 GATGGGGCCGCGGTGCGCCCAGG + Exonic
1200273518 X:154710520-154710542 GAGGGGGCGCTGGAGAGCCATGG + Intronic
1201594166 Y:15648955-15648977 TATGAGGCTGTTGAGAGCCTGGG - Intergenic