ID: 1103478185

View in Genome Browser
Species Human (GRCh38)
Location 12:121233573-121233595
Sequence TCTGTTCTTTGATGGGGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 303}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103478185_1103478197 28 Left 1103478185 12:121233573-121233595 CCACAGCCCCATCAAAGAACAGA 0: 1
1: 0
2: 2
3: 15
4: 303
Right 1103478197 12:121233624-121233646 CATCACCCCAGAGAAATTTCTGG 0: 1
1: 0
2: 3
3: 26
4: 157
1103478185_1103478194 -1 Left 1103478185 12:121233573-121233595 CCACAGCCCCATCAAAGAACAGA 0: 1
1: 0
2: 2
3: 15
4: 303
Right 1103478194 12:121233595-121233617 AGAGGAGGAGGAGGGAGAAATGG 0: 1
1: 12
2: 219
3: 1639
4: 8255
1103478185_1103478192 -10 Left 1103478185 12:121233573-121233595 CCACAGCCCCATCAAAGAACAGA 0: 1
1: 0
2: 2
3: 15
4: 303
Right 1103478192 12:121233586-121233608 AAAGAACAGAGAGGAGGAGGAGG 0: 1
1: 0
2: 45
3: 498
4: 3211
1103478185_1103478193 -9 Left 1103478185 12:121233573-121233595 CCACAGCCCCATCAAAGAACAGA 0: 1
1: 0
2: 2
3: 15
4: 303
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103478185 Original CRISPR TCTGTTCTTTGATGGGGCTG TGG (reversed) Exonic
901004631 1:6165855-6165877 CCTGTTATTTGATGGGGAAGTGG - Intronic
901819618 1:11819280-11819302 TTTGTTCTTTGGAGGGGCAGTGG + Intronic
902441312 1:16431954-16431976 CATGTTCTTAGATGGGGCTAAGG + Intronic
902696532 1:18144230-18144252 TCTGTCCTGGGAAGGGGCTGTGG - Intronic
903600370 1:24533931-24533953 TCTGATACTTGGTGGGGCTGGGG - Intronic
904904719 1:33886581-33886603 TCTGCTCTGTGCTGGGGCAGAGG - Intronic
907865380 1:58394806-58394828 TCTGTTTCTTGATTGTGCTGGGG + Intronic
909750339 1:79152059-79152081 TCTTTTCCTTGATGGGATTGAGG + Intergenic
913616870 1:120569281-120569303 TCTGTTCTTTGAATTGGTTGGGG - Intergenic
914573405 1:148941629-148941651 TCTGTTCTTTGAATTGGTTGGGG + Intronic
915304930 1:154971639-154971661 TGTGCTCTTTGGTGGGGCTTAGG - Intronic
915903069 1:159860140-159860162 TCTGTTCTATCATGTGGCTCAGG + Intronic
916052783 1:161048017-161048039 TCTTTCCTTTGATGCTGCTGTGG - Exonic
917788271 1:178482946-178482968 TCTCTTCTGTGAAGGGGATGTGG - Intergenic
917916413 1:179706829-179706851 TCTATTCTTTGAAGGTGGTGGGG + Intergenic
918773412 1:188594798-188594820 AGTGTTCTTTGTTGAGGCTGTGG + Intergenic
919382515 1:196876258-196876280 TCTGTTCTGTGAAGGGGTTCTGG - Intronic
919706744 1:200683604-200683626 TCTGATCTTTGAGGTGGCTCTGG - Intergenic
920032585 1:203046167-203046189 TCTGCTCTCTGCTGAGGCTGGGG + Intronic
920832973 1:209481905-209481927 TCTGTGCTGGGAAGGGGCTGGGG - Intergenic
920979465 1:210819761-210819783 ACTGTTCTGTGGTGGTGCTGTGG - Intronic
921062595 1:211598289-211598311 TCTGGTCTGAGATGGGGCTCCGG - Intergenic
922563038 1:226582774-226582796 CTTGTTCTCTGATGGAGCTGAGG + Intronic
923234807 1:232022135-232022157 TCTGTTTTTTGATGGTGGAGAGG + Intronic
924072166 1:240291993-240292015 TCAGTTCCTTTATGGGGCAGGGG - Intronic
1062810457 10:459606-459628 ACTGTTCCCTGATGTGGCTGTGG - Intronic
1063954857 10:11256306-11256328 TCTGTGCTGAGAAGGGGCTGGGG - Intronic
1064176708 10:13081361-13081383 TCTGACCTTTGATGAGGATGTGG - Intronic
1064546600 10:16456699-16456721 TCTCTTCTTGGATAGGGCTGTGG + Intronic
1064718477 10:18202734-18202756 TCTCTTCTGTGTTGTGGCTGTGG + Intronic
1065448552 10:25829172-25829194 GCAGTTATTTGAGGGGGCTGAGG - Intergenic
1067732144 10:48820221-48820243 TCTTGTCTTTGAGGGGGTTGGGG + Exonic
1068136088 10:52952362-52952384 TCTGATGATTGATGGGGCCGGGG - Intergenic
1068941405 10:62684628-62684650 GCTGTTCTGTGCTGGGCCTGGGG - Intergenic
1070270223 10:74946786-74946808 TCTGTATTTTGATAGGGGTGTGG + Intronic
1071357952 10:84817561-84817583 TATCTTCTTTGATGTGGTTGGGG + Intergenic
1073244148 10:102077630-102077652 TCTGTTCCCGCATGGGGCTGAGG + Intergenic
1073920561 10:108453354-108453376 TCTATTCTGTGATGGGGATGAGG - Intergenic
1075076027 10:119350902-119350924 CCAGGTCTCTGATGGGGCTGTGG + Intronic
1076609970 10:131718508-131718530 TCTGTTTTTTGTGGGGGCGGGGG + Intergenic
1077868014 11:6239247-6239269 CCTGGCCTTGGATGGGGCTGGGG - Exonic
1078216005 11:9312383-9312405 TCAGCTATTTGAGGGGGCTGAGG + Intronic
1080142423 11:28938539-28938561 TCTGTTCTGTCTAGGGGCTGAGG - Intergenic
1080701877 11:34650864-34650886 TCTTTTCTGCGATGGGGCAGTGG + Intronic
1081148883 11:39601937-39601959 ACTGTTCTGAGAAGGGGCTGAGG + Intergenic
1081232986 11:40608778-40608800 TCTTTTCTTTGATGTAGCTATGG - Intronic
1081276393 11:41154809-41154831 TCTGTTGTTTTCTGGAGCTGTGG - Intronic
1082568244 11:54707190-54707212 CCATTTCTTTGGTGGGGCTGAGG + Exonic
1084063404 11:66689977-66689999 GCTGGGCTGTGATGGGGCTGTGG - Intronic
1084615940 11:70235985-70236007 TCTAGACTTTGATGGGGCAGTGG + Intergenic
1085856812 11:80184538-80184560 TCAGAGCTTTGAAGGGGCTGAGG - Intergenic
1085968073 11:81553283-81553305 TATGTTCTGTTAGGGGGCTGAGG - Intergenic
1088756254 11:112887690-112887712 TCTGCTTTTTGATGGGGATTAGG - Intergenic
1089690185 11:120182385-120182407 TCTGTTGTTTGAAGTGGCTTGGG + Intronic
1089699324 11:120235013-120235035 TCTGGTCTTTGATGGGGAGCAGG + Intergenic
1089878034 11:121744905-121744927 TCTTTTCTTTTATGGTGCTATGG + Intergenic
1089940290 11:122409525-122409547 CCAGTTCCTTGATGGGGGTGTGG + Intergenic
1090794753 11:130125142-130125164 GTTCTTCTTTGAAGGGGCTGAGG + Intronic
1090974624 11:131670947-131670969 TCTGTTTTCAGAAGGGGCTGGGG - Intronic
1091843413 12:3636697-3636719 TCTGTGCATTGAAGGGGATGTGG + Intronic
1092431027 12:8409071-8409093 TCTGTTCTTTGTTGTGGTGGGGG - Intergenic
1094569539 12:31629571-31629593 CCTGTTCTCTGAAGGGGCTCAGG - Intergenic
1096230810 12:49895803-49895825 TCTGTTCCTGGATAGGGCTCTGG - Intronic
1097173357 12:57129237-57129259 TCTGGTCTTTGTTTGTGCTGGGG - Intronic
1097996772 12:65896401-65896423 TCTGCTGTTTGATGGGGCTGAGG + Intronic
1101529721 12:105562975-105562997 TGTCTTTTTTGATGGGGCAGGGG + Intergenic
1103478185 12:121233573-121233595 TCTGTTCTTTGATGGGGCTGTGG - Exonic
1104679186 12:130737345-130737367 CCTGTTCTCTGAGGGGGCCGAGG + Intergenic
1104736710 12:131139642-131139664 TCTGTGCCTTGGTGGGGCTTGGG + Exonic
1105015853 12:132786539-132786561 TCTGTTCCGTGATGGCCCTGGGG + Exonic
1106663235 13:31824478-31824500 GCTCTGCTTTGATGGGTCTGGGG - Intergenic
1107461344 13:40606648-40606670 TATTTTCTATGGTGGGGCTGGGG + Intronic
1111715435 13:91873852-91873874 TTTGTTTTTTGATGGAGATGAGG + Intronic
1112488651 13:99842423-99842445 CCTGTTCATTGATGGGGTTCAGG - Intronic
1113358143 13:109602595-109602617 TCTCTTCTTTGACTGGGGTGTGG - Intergenic
1113409219 13:110069736-110069758 TCTGTGCTTTGGTGGTGGTGTGG + Intergenic
1115578599 14:34736003-34736025 TATTTTCTTTGTTGGCGCTGGGG - Intergenic
1117611899 14:57492221-57492243 TTTGGTATTTGATGGAGCTGGGG + Intronic
1117627290 14:57652803-57652825 TCTCTTCTCTGATGAGGCTCTGG + Intronic
1118694225 14:68368622-68368644 TATGCTCTATGATGGGGCAGTGG + Intronic
1119382758 14:74239536-74239558 CCTGTTCTTTGGAGGGGCTGAGG - Exonic
1119581259 14:75783572-75783594 TCCTTTCTTTATTGGGGCTGGGG - Intronic
1121058739 14:90883880-90883902 TCAGGTCTTTGATGAGCCTGTGG + Intronic
1121823706 14:96993026-96993048 TTTGTACTTAGATGGGGCTGTGG + Intergenic
1123016566 14:105378390-105378412 TCTGTTTTTTTAGGGGGCGGGGG + Intronic
1123826095 15:24083797-24083819 TCTGATCATGGAAGGGGCTGGGG - Intergenic
1125092419 15:35810067-35810089 TCTGTTTATTAATGGGACTGTGG - Intergenic
1125253703 15:37737370-37737392 TTTTTTCCTTGATGTGGCTGAGG - Intergenic
1125539787 15:40463705-40463727 TCCTTTTTTGGATGGGGCTGGGG - Intronic
1126353424 15:47769054-47769076 TTTGTTTTTTGATGTTGCTGCGG - Intronic
1126799160 15:52284504-52284526 TCTGTATCTTGATGGGGCTCGGG + Intronic
1128530850 15:68446524-68446546 TCTGTTCATGGCTGGGGATGGGG + Intergenic
1129227664 15:74179387-74179409 ACTGTGCATTGATGGGGATGGGG - Intergenic
1130236825 15:82142959-82142981 TCTGTTCTTTTATGGCCCTATGG + Intronic
1130985529 15:88842327-88842349 TCTGTTCTTGGACAGAGCTGGGG + Intronic
1132747362 16:1442632-1442654 TCTGTTTTCTGGTGGGGCAGGGG - Intronic
1132750893 16:1457131-1457153 GCTGTCCTCAGATGGGGCTGGGG + Intronic
1133685558 16:8162418-8162440 TTTTTTTTTTGATGGGGGTGGGG - Intergenic
1133727105 16:8547897-8547919 TCATTCCTTTGATGGGCCTGTGG + Intergenic
1135489498 16:22896920-22896942 TCAGCTACTTGATGGGGCTGAGG - Intronic
1136040321 16:27573622-27573644 TCTGTACTCTGAAAGGGCTGAGG - Intronic
1136650157 16:31662265-31662287 TCGGTTCGTTGAGGGGCCTGAGG - Intergenic
1137675848 16:50303593-50303615 TGTGTTCTTGGATCGGGGTGGGG + Intronic
1137747036 16:50830061-50830083 TCTTTTCTTTGGTGGGGTGGGGG - Intergenic
1140332417 16:74070732-74070754 TCTTATGTTTGATGGGGCTCAGG + Intergenic
1140389223 16:74570896-74570918 TCTGTTTTTTGAGGGGCCAGCGG - Intronic
1141358813 16:83375526-83375548 TCAGATCTTTAATGGAGCTGAGG + Intronic
1141798352 16:86289825-86289847 GCTGGGCTTTGATGTGGCTGGGG - Intergenic
1142595247 17:1026700-1026722 TCTGTTCCTCGAAGGTGCTGGGG + Intronic
1142713466 17:1735880-1735902 TCTGGCCTGTGATGGGGGTGGGG + Intronic
1143038000 17:4011227-4011249 TCTGTTTTTTTATGGAGATGGGG - Intronic
1143100430 17:4501570-4501592 TCTGTTGTGTGTTGGGGGTGGGG - Intronic
1143121381 17:4609368-4609390 TGTGGTCTTTGTTGGGGGTGGGG + Intergenic
1143468358 17:7154288-7154310 TGTGGTCTTAGATGGGGGTGAGG - Intergenic
1143863831 17:9909758-9909780 TATGTTCTGTGATGTGGGTGTGG - Intergenic
1144185543 17:12791780-12791802 CCTCTTCTTTGTTGGGGCTCTGG + Intronic
1144343605 17:14331306-14331328 CCTGTTCCTGGAAGGGGCTGGGG - Intronic
1144376108 17:14643704-14643726 TCTGCTCTTTGATGGGCATTTGG - Intergenic
1145898253 17:28473399-28473421 TCTGTTCTTGGAGGCTGCTGAGG - Exonic
1146402504 17:32510999-32511021 TTTGTTTTGTGATGGGGCTTTGG - Intronic
1147255183 17:39177101-39177123 TGTGGTTTTTGATGGGTCTGGGG - Intronic
1149603611 17:57909560-57909582 TTTGATCTTGGATGAGGCTGAGG - Intronic
1150703850 17:67470316-67470338 TCTGTATCTTGATGGGGCAGTGG - Intronic
1151182101 17:72336668-72336690 TCTGTTCTTTGCTGGGCTTCGGG - Intergenic
1151197461 17:72441678-72441700 TCTGTGCTGTGGTGGGACTGTGG + Intergenic
1151216132 17:72577602-72577624 TCTGCCATTTGATGTGGCTGTGG - Intergenic
1151250769 17:72832875-72832897 CCTGTTATTTGCTGGGGCTTTGG + Intronic
1152106552 17:78332685-78332707 TGTGTTCTTTGATCTGGGTGAGG + Intergenic
1154966798 18:21366624-21366646 GATTTTCTTTGATGGGGGTGGGG - Intronic
1156594088 18:38525864-38525886 TCTGTCTTTTGATGAGCCTGTGG - Intergenic
1157064712 18:44334565-44334587 TCTTTTTTTTGGTGGGGCGGGGG + Intergenic
1158200920 18:54939594-54939616 TCTGTGGTTTGAGGTGGCTGAGG + Intronic
1160464703 18:79066885-79066907 TCAGTTCTTGAATGAGGCTGAGG + Intergenic
1160611905 18:80095520-80095542 CCTGTTCTTTCAAGGGGCTCTGG - Exonic
1160771228 19:832027-832049 TCTGTTCATTGGTGGGGGAGGGG + Intergenic
1161577582 19:5063317-5063339 CGTGTTCTTTGTTGGTGCTGGGG + Intronic
1161683625 19:5692654-5692676 GCTGTCCTTTCAAGGGGCTGTGG - Intronic
1162065253 19:8121457-8121479 CCTGTCCTTTGATGGAGGTGTGG + Intronic
1162205684 19:9054584-9054606 TCTTTTTTTTGATGGAGATGGGG + Intergenic
1162552510 19:11365441-11365463 TCTGTTATTTATTAGGGCTGTGG + Exonic
1163645209 19:18485399-18485421 TCTGCTCTGTGGTGAGGCTGAGG - Intronic
1163837550 19:19584253-19584275 TCTATTCTTTGATTTGCCTGTGG - Intronic
1164137221 19:22426532-22426554 TCTGTACCTTTCTGGGGCTGAGG - Intronic
1164160963 19:22625097-22625119 TCTGTACCTTTCTGGGGCTGAGG + Intergenic
1166298742 19:41902526-41902548 GCTGTAGTTTGATGGTGCTGAGG + Exonic
1166663308 19:44661511-44661533 TCTGGTCTGTGATGGGGCCAGGG + Intronic
1166837449 19:45676272-45676294 TCAGTTCTTAGAAGGAGCTGGGG + Intronic
924978262 2:197411-197433 TGTGTTCTGTTACGGGGCTGGGG - Intergenic
925293337 2:2762705-2762727 GTTGTGCTTTGCTGGGGCTGAGG - Intergenic
925439216 2:3869162-3869184 CCTGTTCTGTGTTGGTGCTGGGG + Intergenic
926290863 2:11529150-11529172 TCTTTTCTCTCATGGGGTTGAGG - Intergenic
928317894 2:30259927-30259949 TCTGTTCTTTTTTGAGGCTCAGG + Exonic
929155062 2:38781727-38781749 CCTGTTCAGTGATGGGGATGTGG - Exonic
929185544 2:39090320-39090342 TCTCTTCTTTGTGGGGGCTGGGG + Intronic
929557093 2:42932273-42932295 GCTGCTCTTTGGTGGGGATGGGG - Intergenic
929587571 2:43126055-43126077 GCAGTTCTTTGTTGGGGTTGGGG + Intergenic
930529505 2:52572317-52572339 TCAGTTCTTTAAAGAGGCTGGGG - Intergenic
930591764 2:53335970-53335992 TCTGTACTTTGATAGGGATTTGG - Intergenic
931450122 2:62361614-62361636 TCTGTGCTTGGATATGGCTGTGG + Intergenic
932284209 2:70518826-70518848 TCTGGCCTCTGCTGGGGCTGGGG + Intronic
933794362 2:85907703-85907725 TCTGTGGTTTGAGGAGGCTGTGG + Intergenic
935261838 2:101362496-101362518 TCTGTTCTTAGATGTGGTGGAGG + Intronic
935802945 2:106716678-106716700 TTTGTTTTTTGGTGGGGGTGGGG - Intergenic
937594046 2:123651818-123651840 TGTGTTCTCTGCTGGGGATGGGG - Intergenic
940870941 2:158859679-158859701 TCTGTTCTTGGTTGGGGTGGGGG + Intronic
943284608 2:185981653-185981675 TCTGTTCTGTCAAGGGGCTCTGG + Intergenic
944306189 2:198183043-198183065 TCTTTTCTGGGATGGGGGTGGGG - Intronic
944916916 2:204370264-204370286 TCTCATCTGAGATGGGGCTGTGG - Intergenic
945808463 2:214518921-214518943 TATGCTCTTTGATGGGCATGTGG - Intronic
946229814 2:218284303-218284325 TCTGTTGTTAGAGGGGGCAGTGG - Intronic
946402457 2:219475764-219475786 TCAGGGCTCTGATGGGGCTGGGG + Intronic
947063401 2:226192136-226192158 TCCATTCTTTCATGAGGCTGAGG - Intergenic
947337084 2:229098568-229098590 GCTGCTCTTTCCTGGGGCTGGGG + Intronic
948058918 2:235029459-235029481 CCTGTGCTTTGAGGGGGCTCAGG + Intronic
948135134 2:235630926-235630948 TCTTTGTTTTGATCGGGCTGCGG - Intronic
948331216 2:237167194-237167216 TATGTACTTGCATGGGGCTGGGG + Intergenic
949051086 2:241897696-241897718 GCGTTTCTTGGATGGGGCTGTGG + Intronic
1168770105 20:408980-409002 TCTGTGCTGAGATGGGGCTAGGG + Intronic
1169765048 20:9139909-9139931 GATTTTCTTTGAAGGGGCTGAGG + Intronic
1169969201 20:11250421-11250443 TCTCTTTTTTGATGATGCTGTGG + Intergenic
1170333238 20:15238812-15238834 TCTGTTCTTTTATCAGGCTAGGG + Intronic
1170819301 20:19742814-19742836 TCTGTTCTGTTGTGGGGCAGTGG - Intergenic
1171197792 20:23214628-23214650 TGTGTTCCTTGCTGGGGCTCCGG - Intergenic
1171279426 20:23883422-23883444 TCTGGGCTCTGATGGGGATGAGG + Intergenic
1172305110 20:33875225-33875247 CATGTTCCTTGATGGGGTTGTGG + Intergenic
1175177036 20:57118245-57118267 GCGGTGCTTTGATGGGGCGGGGG - Intergenic
1176108166 20:63399196-63399218 TCTGTCCCTGGAGGGGGCTGTGG + Intergenic
1177782915 21:25639578-25639600 TCTGTTCTGTTTTGGGGGTGTGG - Exonic
1178713445 21:34941400-34941422 TCTGTTCTTTCATGTGGGTTCGG + Intronic
1180981143 22:19878565-19878587 TCTGGTCTGGGATGGGGATGAGG + Intronic
1181109793 22:20595237-20595259 TCTTTTTTTTGGTGGGGGTGGGG + Intergenic
1181515633 22:23410175-23410197 TCTTTTCGTAGCTGGGGCTGTGG - Intergenic
1183109258 22:35637042-35637064 TCTGCCCTTTGCTGGGACTGTGG - Intronic
1184289481 22:43490738-43490760 TCTGTTGGCTGATGGGGCTGGGG + Intronic
1184352617 22:43954684-43954706 TCTTTTCTTTTTTGGGGCAGGGG + Intronic
1185077165 22:48689714-48689736 GCTGTGCTTTCATGGGGCTGGGG + Intronic
949399244 3:3648426-3648448 TCTGTTTTTTGACTGTGCTGTGG - Intergenic
949708844 3:6850790-6850812 TCAGCACTTTGAGGGGGCTGAGG - Intronic
950118923 3:10468856-10468878 TCTGCCCTTTGATTGGGGTGGGG - Intronic
950355400 3:12404076-12404098 TGTGTTGTTCCATGGGGCTGGGG - Intronic
951342261 3:21502564-21502586 TCTGTTCTTTGTTGTGCATGAGG - Intronic
951789560 3:26465001-26465023 TTTGTTCTTTGATGGAGTTTTGG - Intergenic
952083952 3:29795112-29795134 GCTGTTGTTTGATGGGGATTAGG + Intronic
954402516 3:50326452-50326474 TATGTTCTATGATGAGGATGGGG - Exonic
954665680 3:52250357-52250379 GCTGTTCTTTGCTGGAGATGAGG + Exonic
958145786 3:89622893-89622915 TCTCTTTTTTGGTGGGGCAGGGG + Intergenic
961559414 3:127718368-127718390 TCTGTTTGGTGGTGGGGCTGAGG - Intronic
961578851 3:127861191-127861213 TGTATTCTGTGATGAGGCTGTGG + Intergenic
962674772 3:137747126-137747148 TCTGTTCTGGGGTGGGGCTCTGG - Intergenic
963394231 3:144711714-144711736 TCTGTTCATTGTTGAGGGTGGGG - Intergenic
965121728 3:164567695-164567717 GCTGTTTTTTAAAGGGGCTGAGG - Intergenic
965745035 3:171916089-171916111 AGTGTTCTTTGATGAGGCAGTGG + Intronic
966592219 3:181695701-181695723 TCTGTCCTTTCCTGGGTCTGTGG - Intergenic
968726347 4:2249657-2249679 TCTCTTCCTGGCTGGGGCTGGGG - Exonic
969956512 4:10896529-10896551 TCTGTACTATGATGAGACTGGGG + Intergenic
972048404 4:34697397-34697419 TATGCTCTTTGCTTGGGCTGAGG + Intergenic
974094311 4:57345864-57345886 TCTGTCCTGGGATGGGGCAGAGG + Intergenic
974892892 4:67902768-67902790 TCTTTTTTTTGGTGGGGCGGGGG - Intergenic
976524082 4:86066457-86066479 TCTGCTCTTAGAAAGGGCTGGGG + Intronic
978321476 4:107500637-107500659 TTTGTTAATTGATGGGGCTGTGG - Intergenic
980061932 4:128140545-128140567 TTTGTTCATTGTGGGGGCTGGGG + Intronic
982120136 4:152135342-152135364 AGTGTTCTTTGATGGGGGAGAGG - Intergenic
982750213 4:159152069-159152091 TCTGGCCTTTGGTGAGGCTGAGG + Intronic
983860391 4:172698659-172698681 TGTGTGCTTTGATGGAGATGGGG + Intronic
984883314 4:184429161-184429183 TCTCTCCTTTCCTGGGGCTGGGG + Intronic
985804435 5:2031865-2031887 TCTTTCCTCTCATGGGGCTGGGG + Intergenic
985941257 5:3138300-3138322 TCTTTTCTTCCTTGGGGCTGGGG - Intergenic
986577970 5:9232107-9232129 TGTTTTCTCTGCTGGGGCTGGGG - Intronic
988974525 5:36501817-36501839 TCTTTTCTTTGAGGGGGCAGGGG - Intergenic
989007789 5:36834466-36834488 CCAGTTCTGGGATGGGGCTGAGG - Intergenic
989159978 5:38381285-38381307 TCAGTTCTTTGATGGGAGTAGGG + Intronic
991656318 5:68907514-68907536 TATGTTCTTTGGTGAGACTGGGG - Intergenic
992563958 5:77979809-77979831 ACTGTTATTTGATAGGGCTTGGG + Intergenic
992564788 5:77986468-77986490 TTTGTTCTTTGAGGGGTCAGTGG - Intergenic
993880987 5:93360661-93360683 TTTGCCCTTTAATGGGGCTGGGG + Intergenic
994826195 5:104715653-104715675 TCTGTTATTTTGTGGAGCTGTGG - Intergenic
996554619 5:124765421-124765443 TCTGTTCTTTGTTAGCTCTGTGG + Intergenic
997637613 5:135425869-135425891 TTTGTTCTCTGTTGGGTCTGGGG - Intergenic
997904889 5:137806729-137806751 TGTGCTCTATGTTGGGGCTGAGG + Intergenic
998645863 5:144061408-144061430 TCTGTGTTTTGATAGGGGTGTGG + Intergenic
999875974 5:155806151-155806173 TCTTTTCTTTTTTGGGGGTGTGG + Intergenic
1000191973 5:158919933-158919955 TCTGTCCTTTTGTGGGGCTATGG - Intronic
1001570931 5:172730038-172730060 GTTGTTCTTTGGTGGGGTTGAGG - Intergenic
1003796468 6:9610858-9610880 TCTGTTCTTTTCTGGGGCTGGGG - Intronic
1003850010 6:10211774-10211796 TTTGTACTTTGAAGGGGATGAGG + Intergenic
1004879626 6:19994959-19994981 CCTGATCTATGTTGGGGCTGGGG + Intergenic
1005344136 6:24872803-24872825 TCTTTTACTGGATGGGGCTGGGG - Intronic
1005459816 6:26057127-26057149 TCTTTTCATAGATGGGGGTGGGG + Intergenic
1005508124 6:26488015-26488037 TCTGTTCCTTGATTAGGCTGTGG + Intergenic
1006438543 6:34039663-34039685 ATCGTGCTTTGATGGGGCTGGGG + Intronic
1007276117 6:40675352-40675374 TGTCTTCTTTGCTTGGGCTGAGG - Intergenic
1008962648 6:57281447-57281469 TTTGTTGTTAGATGCGGCTGAGG - Intergenic
1009235446 6:61117969-61117991 ATTGTTCTTTGATTGGGGTGGGG + Intergenic
1010003292 6:70969546-70969568 TGTGTTTTTGGATGGGCCTGAGG + Intergenic
1010109844 6:72213865-72213887 TCTGGTCTTTGATATAGCTGTGG + Intronic
1010584015 6:77635315-77635337 TCTGTGAGATGATGGGGCTGGGG + Intergenic
1011759414 6:90544953-90544975 ACTGATCTGTGATGGGGGTGGGG + Intronic
1011771973 6:90683426-90683448 TCTGCTCTTTAATGAGGCTTGGG + Intergenic
1013070129 6:106721561-106721583 TCTCTTCTGTGAAGGGGCTTAGG + Intergenic
1013099084 6:106973392-106973414 TCAATTCTTTGATGGGGGAGGGG - Intronic
1015091408 6:129363344-129363366 TATGATTTTTGATGGGTCTGTGG - Intronic
1015484746 6:133756046-133756068 TCTGCTCTTTAATAGAGCTGAGG + Intergenic
1016893434 6:149030219-149030241 TATGTTTTGTGATGGGCCTGGGG - Intronic
1017037471 6:150279406-150279428 TCTGTACTTGGGTGGGGCTGGGG + Intergenic
1018153386 6:160961850-160961872 TATGTTTTTTGATGGGGAAGGGG - Intergenic
1021464048 7:20921645-20921667 TCTGTTGTTTGAAAGGGCTCAGG + Intergenic
1021759404 7:23888851-23888873 TCTGTTCTTTGAAGATTCTGTGG + Intergenic
1022134854 7:27437548-27437570 TCAGTTCTTAGATCTGGCTGAGG + Intergenic
1022227941 7:28382747-28382769 TATGTGGTTTGATGGGGGTGAGG - Intronic
1022265835 7:28754003-28754025 TCTGTAATTTGATGAGGTTGAGG - Intronic
1022359126 7:29642413-29642435 TCTGATGATTGACGGGGCTGGGG - Intergenic
1022754900 7:33277040-33277062 TCTGTTCTATGATGTAGTTGTGG + Intronic
1024631437 7:51250899-51250921 CCAATTCTTTGATGTGGCTGAGG - Intronic
1024963204 7:54999615-54999637 TCTCTTCTTGGGTGGGGATGGGG - Intergenic
1025258004 7:57398692-57398714 GCCGTTCTTGGCTGGGGCTGAGG + Intergenic
1026719233 7:72816656-72816678 AGTGTTCTCTGTTGGGGCTGGGG - Intronic
1031081809 7:117265266-117265288 CCAGTTCCTTGAGGGGGCTGAGG - Intergenic
1032865322 7:135918965-135918987 TGTGGTTTTTGATGGTGCTGAGG - Intergenic
1033611619 7:142968719-142968741 TCAGTTGCTTGGTGGGGCTGAGG - Intergenic
1035409411 7:158627096-158627118 TCTGTTTTTTGATGTGGTTTTGG - Intergenic
1035447472 7:158952633-158952655 TCTGTCTTATGATGCGGCTGGGG - Intronic
1035820807 8:2589504-2589526 TCTGTTCTGTAGAGGGGCTGGGG + Intergenic
1036443921 8:8805514-8805536 TCTGTTCATTGAGGAGGCTGGGG + Intronic
1036771657 8:11582686-11582708 TCTGCTCTGTGATGGCGATGGGG - Intergenic
1039331572 8:36543193-36543215 TCCCTCCCTTGATGGGGCTGGGG - Intergenic
1040721770 8:50333153-50333175 GCTGTTCTGTGATGGGGCCAGGG - Intronic
1041286565 8:56268512-56268534 TCTGTTCTCTGGTGGGGCCAAGG + Intergenic
1043402339 8:79896313-79896335 GCTTTTCCTTGATGGGACTGAGG - Intergenic
1043629387 8:82309562-82309584 TTCTTTCTTTGATGGTGCTGGGG - Intergenic
1043920465 8:85977130-85977152 TCTCTCCTTTGATGAGACTGTGG - Intergenic
1044849923 8:96418154-96418176 TCTGTACTTTAATGGGGGTAGGG + Intergenic
1044991995 8:97804271-97804293 TATTAACTTTGATGGGGCTGGGG - Intronic
1047624391 8:126641188-126641210 GCTGTTCTGTGATCTGGCTGTGG - Intergenic
1048133919 8:131727167-131727189 TCTGTTTTTTGATGAGCTTGTGG + Intergenic
1048881119 8:138873332-138873354 TCTTTTCTTTGGCGGGGGTGGGG + Intronic
1049915298 9:311636-311658 CTTGTTCTTTCCTGGGGCTGGGG - Intronic
1049949154 9:627520-627542 GCTGCTCTTTGATGGTGTTGAGG + Intronic
1050383589 9:5059159-5059181 TCTGTTTTTTGAGGTGGGTGTGG - Intronic
1055641795 9:78324496-78324518 TCTGTTGTTTGAATGGGTTGAGG - Intronic
1055687721 9:78795337-78795359 TCTGTTCCTAGATGGTGGTGGGG - Intergenic
1056313700 9:85368576-85368598 TCTGCTGGTTGATGGGCCTGGGG - Intergenic
1056471538 9:86909169-86909191 TTTCTTCTTGGATGGGGGTGGGG + Intergenic
1056764490 9:89436481-89436503 TCTGTTATTAGTTGGGGCTCAGG + Intronic
1056800203 9:89685783-89685805 CCTGTTCTTTGGGGGAGCTGGGG + Intergenic
1062353785 9:136152401-136152423 TCTGGTCTGTGATGGGGATCGGG + Intergenic
1186797037 X:13057092-13057114 ACGGTTCTTTGTTGGGGCTGGGG + Intergenic
1188158578 X:26773351-26773373 TTTGTTCTTTCTTGTGGCTGTGG - Intergenic
1189292244 X:39894713-39894735 TATTTTCTTAGATGTGGCTGTGG - Intergenic
1189340111 X:40198442-40198464 TTTGTTGTTTGATGGGGCAAGGG + Intergenic
1190624211 X:52320780-52320802 TCTGTTTTTTTATGGGGGTGGGG + Intergenic
1192212675 X:69137600-69137622 TCAGTTCTCAAATGGGGCTGGGG + Intergenic
1193730498 X:85096850-85096872 TTTTTTTTTTGAGGGGGCTGGGG - Intronic
1195034140 X:100955781-100955803 TCTGTTCTTTGAAGGGCATTTGG - Intergenic
1196346467 X:114665718-114665740 TCTTTTCATTGAGTGGGCTGAGG + Intronic
1196874542 X:120145704-120145726 TCTGTCTTTTGATGAGGATGTGG - Intergenic
1197043216 X:121965195-121965217 TCTGTTTTTTTCTGGGGCTGTGG + Intergenic
1197204850 X:123781018-123781040 TTTGTTGGTTTATGGGGCTGGGG + Intergenic
1198563820 X:137882634-137882656 TCTCTTCTTTGATGGTGCCAAGG + Intergenic
1200659392 Y:5942082-5942104 TCTGTGCTTTTCTGGGGCAGGGG + Intergenic
1201913430 Y:19156898-19156920 TCTGTTCTTTAATGGGTATTTGG - Intergenic
1201945330 Y:19504444-19504466 TCTGTTCTTTGCTGAGGCACAGG - Intergenic