ID: 1103478193

View in Genome Browser
Species Human (GRCh38)
Location 12:121233587-121233609
Sequence AAGAACAGAGAGGAGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2971
Summary {0: 1, 1: 1, 2: 42, 3: 399, 4: 2528}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103478184_1103478193 1 Left 1103478184 12:121233563-121233585 CCTGGGCTCTCCACAGCCCCATC 0: 1
1: 0
2: 9
3: 49
4: 503
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528
1103478185_1103478193 -9 Left 1103478185 12:121233573-121233595 CCACAGCCCCATCAAAGAACAGA 0: 1
1: 0
2: 2
3: 15
4: 303
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528
1103478177_1103478193 21 Left 1103478177 12:121233543-121233565 CCAGTGAGGCCTACCCCACACCT 0: 1
1: 0
2: 0
3: 6
4: 154
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528
1103478181_1103478193 8 Left 1103478181 12:121233556-121233578 CCCCACACCTGGGCTCTCCACAG 0: 1
1: 0
2: 4
3: 53
4: 812
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528
1103478182_1103478193 7 Left 1103478182 12:121233557-121233579 CCCACACCTGGGCTCTCCACAGC 0: 1
1: 0
2: 3
3: 27
4: 274
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528
1103478183_1103478193 6 Left 1103478183 12:121233558-121233580 CCACACCTGGGCTCTCCACAGCC 0: 1
1: 0
2: 6
3: 54
4: 495
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528
1103478180_1103478193 12 Left 1103478180 12:121233552-121233574 CCTACCCCACACCTGGGCTCTCC 0: 1
1: 0
2: 4
3: 61
4: 586
Right 1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG 0: 1
1: 1
2: 42
3: 399
4: 2528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103478193 Original CRISPR AAGAACAGAGAGGAGGAGGA GGG Exonic
Too many off-targets to display for this crispr