ID: 1103479807

View in Genome Browser
Species Human (GRCh38)
Location 12:121243837-121243859
Sequence AAGAAACAGAAGTGACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 408}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103479805_1103479807 28 Left 1103479805 12:121243786-121243808 CCGTGGGTGAATTACATGGTATG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1103479807 12:121243837-121243859 AAGAAACAGAAGTGACTGCCTGG 0: 1
1: 0
2: 1
3: 36
4: 408
1103479804_1103479807 29 Left 1103479804 12:121243785-121243807 CCCGTGGGTGAATTACATGGTAT 0: 1
1: 0
2: 1
3: 11
4: 101
Right 1103479807 12:121243837-121243859 AAGAAACAGAAGTGACTGCCTGG 0: 1
1: 0
2: 1
3: 36
4: 408
1103479806_1103479807 -4 Left 1103479806 12:121243818-121243840 CCTCAGTAAAGCTATGTTTAAGA 0: 1
1: 0
2: 5
3: 35
4: 304
Right 1103479807 12:121243837-121243859 AAGAAACAGAAGTGACTGCCTGG 0: 1
1: 0
2: 1
3: 36
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103479807 Original CRISPR AAGAAACAGAAGTGACTGCC TGG Intronic
900265495 1:1755112-1755134 AAGGCACAGAAGTGTCGGCCGGG - Intronic
900769304 1:4528206-4528228 ATGAAACAGAAATGACTGGAAGG + Intergenic
901159028 1:7160942-7160964 GAGAGAAAGAAGTGACTTCCAGG - Intronic
902177171 1:14659258-14659280 AATAAATAAAAGAGACTGCCAGG + Intronic
902606599 1:17572692-17572714 AAGAAACAAAAGAGAGTTCCGGG - Intronic
903188891 1:21645512-21645534 AATAAAGAGAAGTGGCTGCTAGG + Intronic
903198993 1:21717660-21717682 TAAAAACTGATGTGACTGCCGGG + Intronic
904375710 1:30081030-30081052 CAGACACAGAAGTCACAGCCAGG + Intergenic
905022266 1:34825945-34825967 GAGAAAGAGAAGAGACTGCCAGG + Intronic
906387890 1:45387663-45387685 AAGAAACAAAGGAGAATGCCTGG + Intronic
907113236 1:51946445-51946467 AAGAAAGAGGAGTGACTCACTGG + Intronic
907234490 1:53033052-53033074 AAGAAACCAAAATGACTGTCAGG - Intronic
907550703 1:55302429-55302451 AAGAAAGAGAAATGGATGCCTGG + Intergenic
907736426 1:57117060-57117082 AGGAAACAGAAGTCAAAGCCAGG - Intronic
907934871 1:59033083-59033105 AGGAAACAGAAATGAGTGCCGGG + Intergenic
908455852 1:64304275-64304297 AACTAACAGAAGTGATTTCCCGG + Intergenic
909254341 1:73399851-73399873 AAGGAACAGATGTGCCTTCCAGG - Intergenic
909384872 1:75043050-75043072 AAGAAACAGCAGATACTGCAGGG + Intergenic
911152780 1:94611106-94611128 AAGAAAAAGAAGTGGATGCTGGG - Intergenic
912169443 1:107080716-107080738 AAGACACAGAAGTACCTCCCAGG - Intergenic
912327045 1:108775959-108775981 ATGAAACAGAAATGACTGGAGGG + Intronic
914723736 1:150310231-150310253 AATAATCAGGAGTGACTGCTGGG - Intergenic
915089971 1:153417398-153417420 AAGGAACAGAAATAACTCCCTGG - Intronic
915128955 1:153683984-153684006 AAGAAAGAGAAGGGAATGGCAGG + Intronic
915628297 1:157131234-157131256 AAGATACAGAAGATACTGTCAGG - Intronic
915851995 1:159334170-159334192 AAGAAAGAGAAGTGAACACCAGG - Intergenic
916300245 1:163265893-163265915 AATAAAAATAAGTGAGTGCCAGG - Intronic
917402812 1:174669807-174669829 AAGAAACAGAATAGAGGGCCTGG - Intronic
918493215 1:185105302-185105324 AAGAAACAGAAGTGTCTGTGAGG + Intergenic
918542956 1:185651134-185651156 AAGACTCAGATGTGAGTGCCAGG + Intergenic
919159371 1:193808266-193808288 AAGAAACAGAAGTGATACCAAGG + Intergenic
919646650 1:200101726-200101748 AAGAAACAGAAAAGTCTACCAGG + Intronic
920507193 1:206525006-206525028 AAGTAAGAGGAGTGCCTGCCAGG - Intronic
920577039 1:207069038-207069060 AAGAAAAAGAAATGTCGGCCGGG - Intronic
920746214 1:208631366-208631388 AAGAAACAAAAGTGAGTCCCTGG - Intergenic
921120530 1:212132538-212132560 AAAAAACAGAGGAGACAGCCAGG + Intergenic
921573331 1:216804348-216804370 AAGAACCAGTAGTGACAGCAAGG + Intronic
923271707 1:232360703-232360725 AAGAAAAAGAAGTAACAGGCAGG - Intergenic
923606427 1:235447485-235447507 AACATACACAAGTGACTGCCAGG - Intronic
924054449 1:240111827-240111849 AAGCAACAGAAGCTACTTCCTGG - Intronic
924275552 1:242382556-242382578 AAGAAAGAGAAGTGCCTAACAGG + Intronic
1064115677 10:12575384-12575406 AAGAAACAGGAGTGATGGCTGGG - Intronic
1064134017 10:12735179-12735201 AAGAAACGAAAGTGTCGGCCGGG + Intronic
1064235379 10:13568955-13568977 TAGAAAGATTAGTGACTGCCAGG - Intergenic
1065354579 10:24827409-24827431 AAGAAACAGAAGCCACGACCTGG - Intergenic
1065582525 10:27185792-27185814 AAAAAAAAGATGTGAGTGCCGGG + Intronic
1065684114 10:28266583-28266605 AAGAAAAAAAAGTGAATGCATGG + Intronic
1066615746 10:37292822-37292844 AAGAGACAGAAGTGCCTGTTAGG + Intronic
1066640295 10:37548593-37548615 AGGGAACAGAAGTGTCTGACTGG + Intergenic
1067219569 10:44334233-44334255 AAGAAACAGAGGAGACTCCGTGG - Intergenic
1068787337 10:60990650-60990672 AAGAAACAGAAGGAAATGCAGGG - Intronic
1069071862 10:63997900-63997922 AAGAGACAGAGATGACTGGCAGG + Intergenic
1069389408 10:67917373-67917395 TAGAAACATTAGTGCCTGCCTGG + Exonic
1069552675 10:69375495-69375517 CAGAACCAGACGTGACCGCCTGG - Intronic
1069626663 10:69872208-69872230 AAGAAACAAAAGTGACTTACTGG - Exonic
1070297307 10:75173563-75173585 AATAAACAGAAGAGACTGGTAGG - Intronic
1070458504 10:76641899-76641921 ACAAAACAGAAATGACTCCCGGG + Intergenic
1073856472 10:107680968-107680990 ACGTAACAGAAGTGAGGGCCCGG + Intergenic
1074460487 10:113632381-113632403 AATAAACAGTAGTTATTGCCAGG - Intronic
1074833461 10:117266135-117266157 CAGAAACATAAATGTCTGCCTGG - Intronic
1075283508 10:121162113-121162135 AAGAAGAAGATATGACTGCCAGG - Intergenic
1075495335 10:122914891-122914913 AAGAAACAGCTGTGGCTTCCAGG + Intergenic
1075853416 10:125607381-125607403 ATGAAAGAGAACAGACTGCCTGG + Intronic
1076241240 10:128909518-128909540 AAGAAACAAAAGAGAGTGTCAGG - Intergenic
1076280615 10:129243264-129243286 AGGAAACAGAAATGGCAGCCTGG + Intergenic
1077613402 11:3659003-3659025 AAGGAACATGAGTGACTTCCTGG - Intronic
1078438922 11:11348080-11348102 AAGAAAGAGAAGAGAGGGCCGGG + Intronic
1079640245 11:22796099-22796121 CAGAAACAGAAATGTCTGACTGG - Intronic
1080263990 11:30382031-30382053 AAGAGAGAGCAGTGAATGCCAGG + Intergenic
1080779470 11:35418163-35418185 AAGAGACAGAAGGGGCTGCAGGG - Intronic
1081846195 11:46242194-46242216 AACAAACAACAGTGACTGTCTGG + Intergenic
1081860162 11:46328701-46328723 AAAAAAAAGAACTGACAGCCAGG + Intergenic
1083583692 11:63840858-63840880 AAAACATAGCAGTGACTGCCAGG - Intronic
1083828151 11:65214574-65214596 AAGGCACAGAAGAGTCTGCCGGG + Intergenic
1084359194 11:68658667-68658689 AAGAAAAAAAATTCACTGCCTGG + Intergenic
1085171117 11:74450762-74450784 AAGAAACAGAATAGAATTCCAGG - Intergenic
1087535657 11:99441950-99441972 AAGAATGAGAAGTGAATTCCAGG + Intronic
1090419989 11:126568067-126568089 AAGAAACAGAAATTAATGGCAGG + Intronic
1091025919 11:132141166-132141188 AAGAAGCAAAAGTGTCTGCTTGG - Intronic
1092701934 12:11241558-11241580 AAGGAGCAGAAGGGAGTGCCAGG - Intergenic
1092713661 12:11365411-11365433 AAGAAGCAGAGGGGAGTGCCAGG + Intronic
1093530065 12:20150014-20150036 AAGGAAGAGAAGTGAATGCCAGG - Intergenic
1093614116 12:21200094-21200116 AAAAAACAAAAGTGAAGGCCGGG - Intronic
1094070099 12:26403455-26403477 AAGACACAGAAGTGGAAGCCAGG + Intronic
1095983042 12:47983530-47983552 AAGCAGCAGCAGTGACAGCCAGG + Intronic
1096879700 12:54657845-54657867 AAGAAACAGGGGAGACCGCCAGG - Intergenic
1097525152 12:60724722-60724744 AAGACACAGAAATGACTGACAGG + Intergenic
1098548782 12:71740123-71740145 AAGAAAACCAAGTGACAGCCAGG - Intergenic
1098995193 12:77111029-77111051 AAGAAAGAGAAGAAACTTCCAGG - Intergenic
1099093717 12:78345191-78345213 AAGAAACAAAACATACTGCCAGG + Intergenic
1099257248 12:80329238-80329260 ATGAAGCAAAAGTGACTGCTGGG - Intronic
1099482680 12:83188604-83188626 AAGATGAAGAACTGACTGCCAGG - Intergenic
1100593104 12:96047589-96047611 AAGAAACGGAAGTGAGTGAGAGG - Intergenic
1101141143 12:101797326-101797348 CAGAAACAGAAGGGACAGGCCGG + Intronic
1101993446 12:109506644-109506666 AAGAAACAGATTTGGCAGCCCGG - Intronic
1102311768 12:111850699-111850721 AAGGAAGAGCAGTGAGTGCCAGG + Intronic
1102819765 12:115897859-115897881 AAAAAACAGATGTGGCTGACTGG - Intergenic
1103003692 12:117405515-117405537 AACAAAAAGAATTTACTGCCAGG - Intronic
1103320427 12:120089675-120089697 AAGAAACAGAAGTTGAGGCCGGG - Intronic
1103479807 12:121243837-121243859 AAGAAACAGAAGTGACTGCCTGG + Intronic
1104371009 12:128223933-128223955 AAGAAACAGAAGTTACCTGCTGG + Intergenic
1104646919 12:130504235-130504257 AAGACACTGAAGTGCCAGCCTGG - Intronic
1105214011 13:18273960-18273982 AAGAGACAGACTTGTCTGCCTGG + Intergenic
1105721759 13:23123661-23123683 TAGAAACAGAAGTGTAGGCCAGG - Intergenic
1106578903 13:31000808-31000830 AAGCAGCAGCAGTGACTGCAGGG - Intergenic
1106952860 13:34904535-34904557 AAGCATCAGACGTGACAGCCTGG - Intergenic
1109637009 13:65133564-65133586 AATAAAAAGAAGTGAATGCAAGG - Intergenic
1109678188 13:65708560-65708582 AACATAAAAAAGTGACTGCCAGG - Intergenic
1110144285 13:72170433-72170455 AACAAACAGAAATGAATGCTGGG + Intergenic
1110270642 13:73585726-73585748 AAAAAACAAAAGTGACTGAGAGG + Intergenic
1110286792 13:73759068-73759090 AATAAAAAGAAGTGCCTGCAGGG - Intronic
1111085830 13:83374030-83374052 AAGAAACATGAGTGATAGCCAGG - Intergenic
1111568598 13:90048375-90048397 AATAAACATCAGTGACAGCCAGG - Intergenic
1112457833 13:99577722-99577744 AAGAAAAAGAAATGACTTGCTGG - Intergenic
1112671571 13:101645362-101645384 AAGAAACAGAAGCCACTGAGTGG - Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1115218258 14:31033955-31033977 AAGAAAAAGAAAGGATTGCCTGG + Intronic
1116319568 14:43443397-43443419 AAAGTACATAAGTGACTGCCTGG - Intergenic
1117540872 14:56745518-56745540 AAGAAAGAGGACTGACTCCCTGG - Intergenic
1117868391 14:60172780-60172802 AGGAAACAGAGTGGACTGCCTGG + Intergenic
1117983650 14:61366384-61366406 AAGAAACAGAAAAGGATGCCTGG - Intronic
1119517282 14:75258204-75258226 AAGAAACAGAGGAGAGGGCCAGG - Intronic
1119892779 14:78195492-78195514 TTCAGACAGAAGTGACTGCCAGG + Intergenic
1122680977 14:103462767-103462789 AAGCAGCAGAAATGAATGCCGGG - Intronic
1123852314 15:24371649-24371671 AAGAAAAAGAAGTGAAGGCCAGG - Intergenic
1123857789 15:24431673-24431695 ATGAAAAAGAAGTGAAGGCCAGG - Intergenic
1123862422 15:24482231-24482253 ATGAAAAAGAAGTGAAGGCCAGG - Intergenic
1124197766 15:27647757-27647779 GGGAAACAGATGTGAGTGCCTGG + Intergenic
1124624039 15:31298041-31298063 CAGAAACACAAGTGACAACCTGG - Intergenic
1125973389 15:43930387-43930409 AGGAAACAGAAGGGAGTACCTGG - Intronic
1126221316 15:46217011-46217033 AACAAACAGAAGTCACTGAAGGG - Intergenic
1127677035 15:61249495-61249517 AAGAAACAGAATTAACTTCTAGG - Intergenic
1128437489 15:67668684-67668706 AAGAGACAGCAGTTACTACCAGG - Intronic
1131207614 15:90464478-90464500 CAGTAACAGTAGTGACTACCTGG + Intronic
1131539501 15:93264455-93264477 ATGGAGCAGAAGTGACTGGCTGG - Intergenic
1131588146 15:93718334-93718356 GAGAAACAGCAGTGACCACCAGG - Intergenic
1133979959 16:10625824-10625846 AAGAAATAGATGTGATTGCTGGG - Intergenic
1134085202 16:11352096-11352118 AAGAAAGATCAGTGACTGTCAGG - Intergenic
1134323410 16:13184636-13184658 AAGACAGAGCAGTGGCTGCCAGG - Intronic
1134586977 16:15420081-15420103 AAGATACAGTAGTGACAGCCAGG + Intronic
1134618592 16:15670675-15670697 AAGAAAAAGAAAGGACTGCATGG + Intronic
1134840928 16:17400906-17400928 GAAAAACAGAAGTAACAGCCAGG + Intronic
1135414404 16:22257798-22257820 AAGTAGCAGAAGGGCCTGCCAGG - Intronic
1135907790 16:26529126-26529148 AAGACTCTGAAGTGAGTGCCAGG - Intergenic
1136105402 16:28026531-28026553 AAGAATGAGAAGTAAATGCCTGG - Intronic
1136711432 16:32240327-32240349 AAGAGACAGAGGTGGCTGACTGG - Intergenic
1136756478 16:32689078-32689100 AAGAGACAGAGGTGGCTGACTGG + Intergenic
1136811633 16:33181295-33181317 AAGAGACAGAGGTGGCTGACTGG - Intergenic
1136818109 16:33291375-33291397 AAGAGACAGAGGTGGCTGACTGG - Intronic
1136824673 16:33347904-33347926 AAGAGACAGAGGTGGCTGACTGG - Intergenic
1136829739 16:33446675-33446697 AAGAGACAGAGGTGGCTGACTGG - Intergenic
1137983898 16:53091773-53091795 AAGGGACAGAAATAACTGCCTGG - Intronic
1138469879 16:57225781-57225803 AACAAAAAGAAGAAACTGCCAGG + Intronic
1138592964 16:58012603-58012625 AAGTCACAGGAATGACTGCCTGG + Intronic
1138732764 16:59214099-59214121 CAAAAGCAGAAGTGACAGCCCGG - Intergenic
1140473020 16:75225495-75225517 AAAAAAAAAAAGTCACTGCCAGG - Intergenic
1141354194 16:83328229-83328251 AAGAAACAGAAGTCCATGCTTGG + Intronic
1202990211 16_KI270728v1_random:4264-4286 AAGAGACAGAGGTGGCTGACTGG - Intergenic
1203058622 16_KI270728v1_random:949432-949454 AAGAGACAGAGGTGGCTGACTGG + Intergenic
1142991908 17:3736995-3737017 AGGAAACAGTAGTGGATGCCTGG + Intronic
1143048195 17:4100018-4100040 AAGTGACAGTGGTGACTGCCAGG + Intronic
1143935241 17:10476998-10477020 CAGGAACAGCAGTGACTTCCCGG - Intergenic
1144562179 17:16329840-16329862 CAGAAACAGTAGTGAAAGCCCGG + Intronic
1146949495 17:36895965-36895987 ATGAAACTGAAGAGTCTGCCAGG + Intergenic
1148413114 17:47484773-47484795 AAAAAAAAGAAGTTACGGCCGGG + Intergenic
1149396097 17:56245705-56245727 AAGAAACAGAAGTGGAAGCTAGG + Intronic
1149581638 17:57754709-57754731 AAGGAAGAGAAGTTGCTGCCTGG - Intergenic
1151300434 17:73220729-73220751 ATAAAACAGAAGTGGCTGCCGGG - Intronic
1153386228 18:4500077-4500099 AAGCTACAGAAGTAACTGCTTGG - Intergenic
1153562687 18:6387085-6387107 GAGAAAAAGAAATGACTCCCAGG + Intronic
1154018682 18:10643673-10643695 AAGAAACAAAAGTCACTGTTGGG + Intergenic
1154185546 18:12179749-12179771 AAGAAACAAAAGTCACTGTTGGG - Intergenic
1154219646 18:12440950-12440972 TAGAAAAAGAAGTGACTGGGTGG + Intergenic
1155939393 18:31788698-31788720 AAGGAACAGTAATGACTGCCTGG + Intergenic
1155954657 18:31946897-31946919 AATAAACAGAAAGGAATGCCTGG - Intronic
1156281444 18:35643136-35643158 TACAAACAGAAGTGGCTGCCGGG - Intronic
1157437728 18:47685242-47685264 CAGGAACAGGAGTGACTGCTGGG + Intergenic
1158595378 18:58811168-58811190 AATAAACAGAACTAAGTGCCGGG - Intergenic
1161052606 19:2172483-2172505 AAGAAAGAAAAGTGGCTGGCCGG - Intronic
1161233134 19:3185551-3185573 GAGAAAAGGAAGTGCCTGCCTGG - Intronic
1161828003 19:6582334-6582356 AAAAAAAAGATTTGACTGCCTGG - Intergenic
1162126610 19:8502749-8502771 AAAAAAAAGAAGTGGCTGGCAGG - Exonic
1162255981 19:9489884-9489906 AAGAAATACAAGAGACTGGCCGG - Intronic
1162256419 19:9493717-9493739 AAGAGACAGAAGTGAATGATTGG - Intronic
1162269354 19:9601392-9601414 ATAAAACAGAAGTTACTGCCCGG - Intergenic
1162885049 19:13690795-13690817 CAGAAACAGAAGTAACTCTCTGG + Intergenic
1163789378 19:19297508-19297530 CAGAACCAGCAGTCACTGCCAGG - Intronic
1164591350 19:29509175-29509197 AAAAAACAGAAGCAACTACCAGG + Intergenic
1165611181 19:37154831-37154853 AAGAAATAAAAGTGACTAGCAGG + Intronic
1165984435 19:39755540-39755562 AAGAATCAGGAATGACTACCGGG - Intergenic
1167873808 19:52395206-52395228 AAGAAATAAAAGTGACAGGCTGG - Intergenic
926191647 2:10732675-10732697 AAGAAAAAGAAATGAAGGCCAGG + Intronic
927580375 2:24238502-24238524 AAGAAACAGCAGTGAATGCTTGG - Intronic
928232135 2:29507577-29507599 AAGAGGCAGAAATGACTTCCAGG + Intronic
929034847 2:37680747-37680769 AAAAAACATGAGTGATTGCCAGG - Intronic
929044272 2:37775184-37775206 CAGAATCATAGGTGACTGCCTGG - Intergenic
929091421 2:38221444-38221466 AAGAACCAGAAATGCATGCCTGG + Intergenic
929161311 2:38835238-38835260 AAGGAAGAGAAGTGAGTACCAGG + Intronic
929867016 2:45726855-45726877 AAGAAGCAGAACTGAATTCCAGG + Intronic
931180046 2:59890532-59890554 AAGGAACAGAAAAGTCTGCCTGG + Intergenic
931449700 2:62358297-62358319 AAAAAATAGAAGAGATTGCCAGG - Intergenic
932552198 2:72783293-72783315 AAGAAAAAGAAGTGACCAACAGG - Intronic
933835190 2:86240314-86240336 AAGACACAAAAGTGCATGCCAGG + Intronic
934300312 2:91772789-91772811 AAGAAACAGACTTGTCTGCCTGG - Intergenic
935270815 2:101432883-101432905 ATGACACAGGAGTGACTCCCAGG + Intronic
935339095 2:102043930-102043952 ATGAGACAGAAGTGACTTTCTGG + Intergenic
935883203 2:107587550-107587572 TAAAAACAGAAGAGAATGCCAGG - Intergenic
935885459 2:107614646-107614668 AAGAACCAGGAGTCAGTGCCTGG + Intergenic
936523380 2:113226494-113226516 AAGAAACCCAAATGACTGGCAGG + Intronic
937018182 2:118625588-118625610 AAAAGAAAGAAGTGACTGACTGG - Intergenic
938675802 2:133632697-133632719 AAGAAACAGAAATGACATCTTGG - Intergenic
938983270 2:136547036-136547058 AGGAAATAGAAATTACTGCCTGG - Intergenic
940122910 2:150287586-150287608 AAGAAACAGAAGTTCATGGCTGG - Intergenic
940191968 2:151050598-151050620 AAGAAAAAGAAGTCACGTCCAGG + Intergenic
940782461 2:157947109-157947131 AAAAAACAGAAGTGAGTGCCAGG - Intronic
940841115 2:158583017-158583039 TAGCAACAGAAATGACTCCCAGG + Intronic
941825261 2:169888069-169888091 AAGAAAAAGAAAAAACTGCCGGG - Intronic
941915980 2:170814245-170814267 AACAAACAGCAGTTACTGTCAGG + Intronic
942988262 2:182167108-182167130 ATGAAACAAAAGTTACTTCCAGG + Intronic
944300495 2:198119448-198119470 AAGAAACAGAACTGAGGGCCTGG - Intronic
944964901 2:204919916-204919938 AAAAAAAAAAAGTGACTGTCTGG - Intronic
946551948 2:220811372-220811394 CAGGAACAGAAGTGGCTGTCTGG + Intergenic
947041422 2:225925282-225925304 AAGTAACAGCATAGACTGCCAGG - Intergenic
947640284 2:231703802-231703824 AAGAAACAGAGAGGACGGCCAGG - Intergenic
948305473 2:236944157-236944179 AAGAGCCAGAAGTCACTCCCAGG + Intergenic
948435031 2:237947287-237947309 AAGAAAGAGATGTGAAGGCCGGG - Intergenic
949036534 2:241818184-241818206 AAGAAAGAGAAGTGAGCCCCCGG + Intergenic
1170051819 20:12154564-12154586 AAGAAACAGAAGGGAATGGAAGG + Intergenic
1170261058 20:14408933-14408955 AAGACACAGAAGTGATAGACAGG - Intronic
1171464396 20:25317559-25317581 AGCAAACAGAAGTTAGTGCCAGG - Intronic
1172464200 20:35143641-35143663 AAACCACAGGAGTGACTGCCGGG - Intronic
1173158939 20:40638394-40638416 GAGAGAGAGAGGTGACTGCCAGG + Intergenic
1173377242 20:42497255-42497277 AAGAAAGAGAAGTGAGCACCAGG - Intronic
1173685558 20:44921107-44921129 AAGAAACAAAATTGATGGCCAGG - Intronic
1174590993 20:51644948-51644970 CAGAACCAGAAGTGGCTTCCAGG + Intronic
1174620373 20:51869740-51869762 AAGAAACAGAAAAAACTGGCTGG + Intergenic
1175106426 20:56618241-56618263 AAGCAACAGTAGTGCCAGCCGGG - Intergenic
1175186018 20:57180027-57180049 AAGACACGGAAGTCTCTGCCGGG + Intronic
1175243093 20:57564128-57564150 GAGAAGCAGTAGTGAGTGCCAGG - Intronic
1176018374 20:62950163-62950185 AGGAAGCAGAAGTCACAGCCAGG - Intergenic
1177238451 21:18424010-18424032 AAGAAAGAGAAGTTTCAGCCTGG + Intronic
1177567192 21:22839706-22839728 AAGAAATGGAAAAGACTGCCAGG - Intergenic
1179177646 21:39020851-39020873 AGGAAACAGACGTGTGTGCCGGG + Intergenic
1179812855 21:43883467-43883489 AAGGAACAGAAATGGCTCCCGGG - Intronic
1181182237 22:21076541-21076563 AAAGAACAGAAGTGAATGCAGGG - Intergenic
1181698666 22:24607922-24607944 AAGAGACAGACTTGTCTGCCTGG - Intronic
1182007365 22:26972025-26972047 AAGAACCAGAAATGACTCCCAGG + Intergenic
1182206588 22:28634213-28634235 AAGAAACAGAAATTTCTGGCCGG + Intronic
1182408556 22:30160376-30160398 AAGTAACAGAACTAACTGCAGGG - Intronic
1182882235 22:33743508-33743530 ATGAGGCAGAAGTGGCTGCCTGG - Intronic
1183262502 22:36804637-36804659 AAGAAAAACAAATGACTGGCTGG + Intronic
1183383895 22:37504068-37504090 AATAAAGGGAAGTGACTGCCTGG + Intronic
1184163157 22:42711030-42711052 AAAAAAAAGAAGTGACAACCTGG + Intronic
1185300381 22:50076918-50076940 AAGAAACAGAACTGTCACCCCGG + Intronic
949131894 3:513404-513426 AAGAAAAAAAAGTGAGTGTCAGG - Intergenic
949598137 3:5569215-5569237 AAAACACGTAAGTGACTGCCAGG - Intergenic
949824666 3:8153028-8153050 AGGAAACAGAATTGACAGCGTGG - Intergenic
950109762 3:10411513-10411535 AAGAATCAGAAGCCACTGCCTGG + Intronic
952543853 3:34397158-34397180 AAGAAACAGATGTGAGGGTCTGG + Intergenic
953915688 3:46919544-46919566 TAGAAACAGAAGTGGCTGGCCGG + Intergenic
954257802 3:49418474-49418496 AAGAAACTGAAGATGCTGCCGGG - Intronic
954573939 3:51664438-51664460 AAGGAACAGAAAAGACTACCAGG - Exonic
954990490 3:54836807-54836829 AAGAAACATAAGTGTCTGGGAGG + Intronic
955262225 3:57404418-57404440 AAGAAACAAAAGTTTCGGCCAGG + Intronic
956095819 3:65714861-65714883 GAGGAACAGAAGAAACTGCCAGG - Intronic
956203103 3:66728078-66728100 AAAAAGCAGAAGAGAGTGCCAGG - Intergenic
957220696 3:77378926-77378948 AAGACACAGAAGTGACATCAAGG - Intronic
957418771 3:79941119-79941141 AACAAAGAGAAGTCACTGCAGGG - Intergenic
958836557 3:99151923-99151945 AAGAATCAGAAGTGATTCCAAGG + Intergenic
958906171 3:99944412-99944434 GAGAGACAGACGTGACAGCCTGG - Intronic
960208610 3:114932940-114932962 AAGCAAAAGAAGAGGCTGCCAGG - Intronic
960835053 3:121897234-121897256 ATGACTGAGAAGTGACTGCCAGG - Intronic
962018482 3:131470093-131470115 AAGAAAAAAAATGGACTGCCAGG + Intronic
962694324 3:137932708-137932730 AAAAAAAAGAAATGACTGCGTGG - Intergenic
963411456 3:144932307-144932329 AGAAAACAGAAGTCTCTGCCTGG + Intergenic
963627773 3:147694605-147694627 AAGAAAAAAAAATGACTGGCAGG + Intergenic
964078248 3:152719069-152719091 AAGGCACAGAAGTGACAGCTGGG - Intergenic
964219585 3:154328049-154328071 AAACAACAGAAGGGACTGTCTGG - Intergenic
965181089 3:165404514-165404536 AATAAACAGAAGTGGTAGCCAGG + Intergenic
965768171 3:172153454-172153476 AGGAAACAGCACTGGCTGCCAGG - Intronic
966491204 3:180530194-180530216 AAGAAACAAGACTGTCTGCCCGG + Intergenic
966986297 3:185183325-185183347 AAGAGCCAGAAGTGACTGGGGGG - Intergenic
966988692 3:185206530-185206552 AAGAAAATGAAATGACAGCCAGG + Intronic
968390326 4:187527-187549 AAAAAACCAAGGTGACTGCCAGG - Intergenic
969125048 4:4941032-4941054 AGGAAACAGAACTTACTGCTTGG + Intergenic
969872698 4:10114879-10114901 GAGGAACAGCAGCGACTGCCTGG + Intronic
970597324 4:17612384-17612406 AAGAACCAGAAGAGACCGCCAGG - Intergenic
971277084 4:25208788-25208810 AATAAACAGAAATGAGTGTCTGG + Intronic
971511540 4:27432564-27432586 AAGAAACAAAAGTGAGTTCCAGG + Intergenic
972004284 4:34079077-34079099 AGGAACCATAAGTAACTGCCAGG + Intergenic
972059934 4:34856774-34856796 AACAAACAGAAGTGACTGGTTGG + Intergenic
972666146 4:41167067-41167089 AAGAAACATAAGTGTCTTCCTGG - Intronic
973763351 4:54140608-54140630 AAAAAATAAAAGTGTCTGCCTGG + Intronic
973833507 4:54786040-54786062 AGAAAATAGAAGTGACTACCAGG - Intergenic
973884990 4:55311956-55311978 AAGAAAGGGAAGTGGATGCCGGG - Intergenic
974229328 4:59089914-59089936 AAGAATCAGGATTGATTGCCAGG + Intergenic
978030354 4:103934075-103934097 ATTAAACATAAGTGAATGCCAGG + Intergenic
978645443 4:110925460-110925482 AAGAAAGAGAAGAGAGTCCCAGG - Intergenic
979767363 4:124477903-124477925 GAAAAACAGCAGTGACTACCAGG + Intergenic
980284087 4:130759291-130759313 ATGAAAGAAAAGTGACTGGCTGG - Intergenic
980287800 4:130804014-130804036 AATAAACAGAAACAACTGCCAGG - Intergenic
981201520 4:141984970-141984992 AAGAAAAAAAAGAAACTGCCTGG - Intergenic
983498252 4:168469581-168469603 AAGAAAACGAAGTGGCAGCCGGG + Intronic
983965503 4:173804598-173804620 AAGAAACAGAAGATGCTGGCAGG - Intergenic
984919292 4:184749810-184749832 AAAAAACAGAAGTACCGGCCAGG + Intergenic
985384752 4:189434022-189434044 AAGAACCAGCAGTGACACCCAGG - Intergenic
985493572 5:192708-192730 ACGAAACAGAAGTGCCTACGTGG + Intronic
985724936 5:1511122-1511144 AAGTAACCGCAGTGACTCCCTGG - Intronic
986763510 5:10901612-10901634 AAGAAACAGAAGTCACGGTAGGG - Intergenic
988240196 5:28598571-28598593 AAGAAACAGAACTGAATGGGAGG - Intergenic
988542211 5:32120741-32120763 AAGAAAAAGAAATAATTGCCGGG + Intergenic
988952451 5:36277142-36277164 AAGAAAATGCAGGGACTGCCAGG - Intronic
990979445 5:61588890-61588912 AAGGAAGAGAAGTCAATGCCTGG + Intergenic
992175237 5:74143419-74143441 AAGTGACAGAAGCGACTTCCAGG - Intergenic
992728918 5:79638435-79638457 AAGCAACAGCAGAAACTGCCAGG - Intronic
993653919 5:90555307-90555329 AAGAAAAAGTAGTGATTGTCAGG - Intronic
994377831 5:99035068-99035090 AAAAATCAGTAGAGACTGCCAGG - Intergenic
994498579 5:100544255-100544277 AAGAAACTGAAGTGAATCACTGG + Intronic
994600290 5:101894143-101894165 TAAAAACAGAAGTGATTGCTTGG - Intergenic
994601191 5:101907537-101907559 AAGAAAGAGAAGTGAGCACCAGG + Intergenic
995031011 5:107481554-107481576 AAGAAACTGAAAAGAATGCCAGG + Intronic
995251365 5:109996921-109996943 AAGAAACAGAAATGTTTGTCAGG - Intergenic
995389075 5:111619475-111619497 AAGAAACAGAACTAACACCCAGG + Intergenic
997672671 5:135689214-135689236 ATGAAACAGAAGGGACTGATAGG - Intergenic
998403505 5:141860818-141860840 AAAAAATGGAAGTGAGTGCCGGG + Intronic
999172688 5:149608663-149608685 TAGAAACAGTACTTACTGCCGGG - Intronic
999876086 5:155807526-155807548 AAGAAACATCATTCACTGCCAGG - Intergenic
1000861134 5:166457539-166457561 AAGAAAGTGAAGTGAGGGCCAGG + Intergenic
1001045786 5:168370571-168370593 AAGAAACCAAAGTGACTGTCTGG + Intronic
1001677098 5:173528113-173528135 GAGTTACAGAAGTGTCTGCCAGG - Intergenic
1002777010 6:336820-336842 AAGAAACAGAAGTGGTTGGAAGG + Intronic
1003106502 6:3220665-3220687 CAGAAACAGTAGTGATTTCCTGG + Intergenic
1003777469 6:9384992-9385014 AAGAAACAGAAGGGCCGCCCTGG + Intergenic
1004157840 6:13185898-13185920 AAGAAAAATAAGTGACTTCCAGG + Intronic
1006178104 6:32135693-32135715 CAGAAATGGAAGAGACTGCCGGG + Intergenic
1006574054 6:35030821-35030843 AAGAAACTGGCGTGCCTGCCTGG - Intronic
1007732675 6:43958322-43958344 AAGAAACGGAAGTGAGCACCAGG + Intergenic
1007787890 6:44291876-44291898 AAGAGAGAGAGGTGACTCCCTGG - Intronic
1008564639 6:52755172-52755194 ACGAAAAAGAAATTACTGCCTGG + Intronic
1009511275 6:64552554-64552576 AATCAACAGAAGGGACTGTCTGG - Intronic
1010142389 6:72626218-72626240 AAGAAAAAGAAGTGAAGCCCGGG + Intronic
1010166731 6:72923510-72923532 AAGACACACAAATGACTGGCAGG - Intronic
1010728280 6:79360362-79360384 AAGGAAGAGAAGTGAGTGCCAGG - Intergenic
1013962377 6:115915798-115915820 AAGAAACTCAAGTGAGTGCAGGG - Intergenic
1014191811 6:118504850-118504872 AATATGCAGAACTGACTGCCTGG + Intronic
1014623684 6:123700307-123700329 AAGGTCCATAAGTGACTGCCAGG + Intergenic
1016046682 6:139487922-139487944 AGGCAACAGATGTGGCTGCCTGG + Intergenic
1016061602 6:139636581-139636603 AATAACCAGCAGTGACTCCCAGG - Intergenic
1016742844 6:147546554-147546576 AAATAACAGAAGTCACTTCCAGG - Intronic
1017222132 6:151977807-151977829 AATAAAAAAAAGTGACTGCAGGG + Intronic
1017557737 6:155590309-155590331 AAGAAATAGTATTGTCTGCCTGG - Intergenic
1017591431 6:155982070-155982092 AAGAAACAGAACTGAAGGACGGG + Intergenic
1017598475 6:156055739-156055761 AAAAAAAAGAAGTGACAGGCTGG - Intergenic
1018584625 6:165343617-165343639 AGCACACAGAAGTGACAGCCAGG + Intronic
1018620581 6:165726446-165726468 AAGCAAAATAAATGACTGCCCGG + Intronic
1018644093 6:165931782-165931804 AAGGAGGAGAAGTGACTGTCGGG - Intronic
1020879349 7:13739456-13739478 AAGAAGAAGAAATGACTGCTGGG - Intergenic
1021456490 7:20834923-20834945 AAGAAAAAGAAGAGATTGCAAGG - Intergenic
1021881006 7:25095451-25095473 AACAAACAAAACTCACTGCCAGG - Intergenic
1022061232 7:26797395-26797417 AGGAAACAGGAGTCTCTGCCTGG + Intronic
1023824453 7:43999726-43999748 AAAAAACACATGTAACTGCCAGG - Intergenic
1024813667 7:53243002-53243024 AAGAAACAAAAGTGGAGGCCGGG - Intergenic
1025773607 7:64537630-64537652 AAAAAACAGAATAGACGGCCAGG + Intronic
1026088002 7:67278490-67278512 AAAAAACACATGTAACTGCCAGG - Intergenic
1026748093 7:73028199-73028221 AAAAAACACATGTAACTGCCAGG + Intergenic
1026751741 7:73056344-73056366 AAAAAACACATGTAACTGCCAGG + Intergenic
1026755390 7:73084471-73084493 AAAAAACACATGTAACTGCCAGG + Intergenic
1026759040 7:73112485-73112507 AAAAAACACATGTAACTGCCAGG + Intergenic
1027034296 7:74913513-74913535 AAAAAACACATGTAACTGCCAGG + Intergenic
1027088368 7:75280988-75281010 AAAAAACACATGTAACTGCCAGG - Intergenic
1027092010 7:75308916-75308938 AAAAAACACATGTAACTGCCAGG - Intergenic
1027095653 7:75336883-75336905 AAAAAACACATGTAACTGCCAGG - Intergenic
1027117605 7:75493825-75493847 AAAAAACACATGTAACTGCCAGG - Intergenic
1027274198 7:76541660-76541682 AAAAAACACATGTAACTGCCAGG + Intergenic
1027323688 7:77030803-77030825 AAAAAACACATGTAACTGCCAGG + Intergenic
1027327642 7:77060713-77060735 AAAAAACACATGTAACTGCCAGG + Intergenic
1027569007 7:79838819-79838841 AAGAAACCAAAGTCACTGCTTGG + Intergenic
1028284554 7:88980623-88980645 AAGAAACAAAAGTCTCTGCCTGG - Intronic
1028383833 7:90229970-90229992 AAGGGATAGAAGTGACTGCCAGG - Exonic
1028657086 7:93220712-93220734 AAGATACAGCAGTGAATGCATGG - Intronic
1029624422 7:101711162-101711184 AAAAAAAAAAAGTGACTTCCAGG + Intergenic
1029719895 7:102356224-102356246 AAAAAACACATGTAACTGCCAGG + Intergenic
1029752718 7:102553033-102553055 AAAAAACACATGTAACTGCCAGG - Exonic
1029770669 7:102652126-102652148 AAAAAACACATGTAACTGCCAGG - Exonic
1030284701 7:107813934-107813956 AGGTAACAGAAGTGCCTGTCTGG + Intergenic
1031971538 7:128068369-128068391 AAGGAAGAGAAGTGAAAGCCAGG - Intronic
1032765440 7:134987067-134987089 AAGAAACTGAAGTTTCTGCCTGG - Intronic
1033138594 7:138805056-138805078 CAGAAACTGAAGAGATTGCCTGG + Exonic
1033548177 7:142421260-142421282 AAGAAGCAGCAGAGAGTGCCTGG - Intergenic
1034614353 7:152402124-152402146 AACAAACAAAAGTTACTGCTTGG + Intronic
1035047083 7:155974609-155974631 AAGAAACAGAGGAGGCAGCCTGG + Intergenic
1035884865 8:3280911-3280933 AAAAAAAAGAAGTGATGGCCAGG + Intronic
1036118292 8:5985825-5985847 AAGAAACACAACTGAGGGCCGGG + Intergenic
1036187300 8:6634996-6635018 AAGACACAGATGTGCGTGCCTGG + Intronic
1038408787 8:27342243-27342265 GAGAAGAAGAAATGACTGCCTGG - Intronic
1039588221 8:38725058-38725080 AAAAATTAGAAGTGACAGCCAGG + Intergenic
1040768747 8:50948198-50948220 CAGAAACAGAAGGAAATGCCAGG + Intergenic
1041259787 8:56011187-56011209 AAGGAACATAAGTGACTACAAGG + Intronic
1041792098 8:61708554-61708576 AAGAAAAAGAAGTTACAGACAGG + Intronic
1044520313 8:93191727-93191749 AAGAAACAAAGGTGAATGTCTGG - Intergenic
1045408235 8:101889090-101889112 AAGAACAAAAAGTGAATGCCAGG - Intronic
1045670738 8:104550595-104550617 AAGAAACTGAAATGACTTCCAGG - Intronic
1047596839 8:126386500-126386522 AGAAAACAGAAGTGAGAGCCGGG + Intergenic
1049073049 8:140371997-140372019 AAGAAACAGAAGTTGTTGGCTGG - Intronic
1049779272 8:144420883-144420905 AAGAAAGAAGGGTGACTGCCAGG + Intergenic
1050051087 9:1602285-1602307 AAGAACCAGAAGTGACAAGCTGG - Intergenic
1050636053 9:7614381-7614403 AAGATAAAGAAGTGCCTGTCAGG + Intergenic
1050742933 9:8843136-8843158 AAGCAACAGAAAAGACTCCCTGG + Intronic
1051191019 9:14513332-14513354 ATGAAACAGAAATGAAGGCCGGG + Intergenic
1051532839 9:18124374-18124396 AAGATATAGAAGTGGCTGTCGGG - Intergenic
1052828062 9:33191750-33191772 AGAAAACAGACGTTACTGCCGGG + Intergenic
1053353234 9:37426960-37426982 AAGAAAAATAAGTGAACGCCTGG + Intronic
1056249903 9:84737168-84737190 AGGAAACAGATGTGTCTTCCTGG + Intronic
1058604000 9:106701574-106701596 AAGAAAAAGATGTGAGTGGCGGG - Intergenic
1059635506 9:116166441-116166463 AAGCAACAGATATGACTGCCAGG - Intronic
1059842809 9:118237052-118237074 ACAAAACAGAAATTACTGCCTGG + Intergenic
1059846975 9:118290749-118290771 AAGAAACAGAAGTTCCAACCTGG - Intergenic
1060004684 9:119989436-119989458 GATAAAAAGAAGTGACTGACAGG + Intergenic
1060144106 9:121236119-121236141 AAGAAACACCTGTGGCTGCCAGG - Intronic
1060756920 9:126220314-126220336 AAGAAACAAGAGTCATTGCCTGG - Intergenic
1061357368 9:130116603-130116625 GAGAAACAGGAGAGACTGACGGG + Intronic
1185987377 X:4850495-4850517 AACAAACAAAAGTGAATGCTTGG - Intergenic
1187234016 X:17449754-17449776 AAGAACCAGAAGTGATTTCCAGG + Intronic
1187626759 X:21122972-21122994 AAAAAAAAGAACTGACTGACAGG + Intergenic
1187877708 X:23817659-23817681 ATGATAGAAAAGTGACTGCCTGG - Intergenic
1188854143 X:35171588-35171610 AAAAAACAAAAGTCTCTGCCTGG - Intergenic
1188895721 X:35665978-35666000 AAGAAACAGAAGTCACGGAAGGG - Intergenic
1189491930 X:41476745-41476767 AAAAAAAAGAAGTGACAGCTTGG - Intergenic
1189799820 X:44681894-44681916 AAAAAAAAAAAGTGACTGACAGG + Intergenic
1190172842 X:48125359-48125381 AAGAACCAGGAGTGAGAGCCAGG - Intergenic
1190794876 X:53731617-53731639 AAGGAAGAGAAGTGAGTACCAGG + Intergenic
1192611972 X:72575763-72575785 AAGAAACACAAATAACTCCCAGG - Intergenic
1193207901 X:78770505-78770527 CAGAAACAAAATTGACAGCCGGG - Intergenic
1193931840 X:87562451-87562473 AATAAACACCAGTGGCTGCCAGG + Intronic
1193933408 X:87584047-87584069 AAGGAACAAAAGTCTCTGCCTGG + Intronic
1194298450 X:92155921-92155943 AAGCTACTGAAGTAACTGCCGGG - Intronic
1195082643 X:101385892-101385914 AATCACCAGAAGGGACTGCCAGG + Intronic
1195254145 X:103077229-103077251 AAAAAAAAGAAGTGAGTGCTGGG - Intronic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1195690341 X:107619101-107619123 AAGAAAAAGAAAAGACGGCCGGG - Intergenic
1195759113 X:108227013-108227035 AAGATACAGAAGTGGTAGCCAGG - Intronic
1197964053 X:132037715-132037737 CAGAAACAGAATTCAATGCCTGG - Intergenic
1198036809 X:132808968-132808990 AACAAACAAAAATGAATGCCAGG - Intronic
1199921162 X:152405382-152405404 AATAAACTTAAGTGACTGTCAGG + Intronic
1200616056 Y:5380882-5380904 AAGCTACTGAAGTAACTGCCGGG - Intronic
1200974751 Y:9196767-9196789 AAAAAAAAGAAGTGACAGCCAGG + Intergenic