ID: 1103480476

View in Genome Browser
Species Human (GRCh38)
Location 12:121247178-121247200
Sequence TTGGACCCACTGGGAAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103480476_1103480480 -6 Left 1103480476 12:121247178-121247200 CCACTTCTTCCCAGTGGGTCCAA 0: 1
1: 0
2: 1
3: 14
4: 227
Right 1103480480 12:121247195-121247217 GTCCAAGTGTGCCTCCATTAGGG 0: 1
1: 0
2: 0
3: 2
4: 68
1103480476_1103480479 -7 Left 1103480476 12:121247178-121247200 CCACTTCTTCCCAGTGGGTCCAA 0: 1
1: 0
2: 1
3: 14
4: 227
Right 1103480479 12:121247194-121247216 GGTCCAAGTGTGCCTCCATTAGG 0: 1
1: 0
2: 0
3: 5
4: 62
1103480476_1103480481 -5 Left 1103480476 12:121247178-121247200 CCACTTCTTCCCAGTGGGTCCAA 0: 1
1: 0
2: 1
3: 14
4: 227
Right 1103480481 12:121247196-121247218 TCCAAGTGTGCCTCCATTAGGGG 0: 1
1: 0
2: 1
3: 6
4: 83
1103480476_1103480484 7 Left 1103480476 12:121247178-121247200 CCACTTCTTCCCAGTGGGTCCAA 0: 1
1: 0
2: 1
3: 14
4: 227
Right 1103480484 12:121247208-121247230 TCCATTAGGGGCATGTCCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103480476 Original CRISPR TTGGACCCACTGGGAAGAAG TGG (reversed) Intronic
900365277 1:2309675-2309697 TCGGACCCACAGGGAGGAGGAGG - Exonic
900365295 1:2309713-2309735 TCGGACCCACAGGGAGGAGGGGG - Exonic
900365315 1:2309751-2309773 TCGGACCCACAGGGAGGAGGGGG - Exonic
900365336 1:2309790-2309812 TCGGACCCACAGGGAGGAGGGGG - Exonic
900365359 1:2309831-2309853 TCGGACCCACAGGGAGGAGGGGG - Exonic
901486695 1:9568358-9568380 TTGAACCCAGTGGGAGGCAGAGG + Intronic
903703359 1:25267294-25267316 TTGCATCCACTGGGTAGAGGCGG + Intronic
903712625 1:25337623-25337645 TTGCATCCACTGGGTAGAGGCGG + Intronic
905889936 1:41512767-41512789 CTGCACCCACAGGGGAGAAGCGG + Intronic
906294903 1:44643774-44643796 TGAGACCCACTAGGAGGAAGTGG + Intronic
907085505 1:51668934-51668956 ATGGAAGCACTTGGAAGAAGGGG + Intronic
914843199 1:151265152-151265174 TTTCACCAGCTGGGAAGAAGGGG - Exonic
918308644 1:183269586-183269608 ATGGGCCCATTGGGAAGGAGGGG + Intronic
919250428 1:195049294-195049316 TTGGTCCCACCGGGAATATGAGG + Intergenic
919522681 1:198608350-198608372 TTTGACCCAATGGCAAGTAGAGG - Intergenic
920225296 1:204434047-204434069 GTGGACACACTGGATAGAAGGGG + Intronic
920960130 1:210656510-210656532 ATGGAGCCACTGGGGAGCAGGGG - Intronic
922316403 1:224446766-224446788 TTGGAAGCACTGGGAAGAGGGGG + Intronic
922344309 1:224683635-224683657 TTGGACCCTCTGGGATGGAAAGG + Intronic
924473978 1:244367476-244367498 TTGGACCCACAGGTCAGGAGAGG + Intronic
1065119990 10:22519316-22519338 TAAGACCCAATGGGAAGAGGAGG + Intergenic
1066493537 10:35918344-35918366 TGGGAACCACAGTGAAGAAGTGG + Intergenic
1069255135 10:66323350-66323372 TTGGAAATACTGGGTAGAAGAGG + Intronic
1069678326 10:70265611-70265633 TTAGAGCCAGTGGGGAGAAGTGG - Intronic
1074356082 10:112784706-112784728 TTGGGCACTCTGGGATGAAGGGG - Intronic
1077154188 11:1084150-1084172 TTTGACTCACGGGGAGGAAGGGG + Intergenic
1077537723 11:3132479-3132501 ATGGAGCCACTGGGGAGATGTGG - Intronic
1078857141 11:15215473-15215495 TTGGGGCCTCTGGGGAGAAGAGG - Intronic
1081577852 11:44330314-44330336 CAGGACCCACTGGGAAGCACAGG + Intergenic
1082764060 11:57152578-57152600 TTGGATCCAGGTGGAAGAAGGGG - Intergenic
1083778765 11:64907368-64907390 ATGCCCCCACTGAGAAGAAGTGG + Exonic
1085518619 11:77125501-77125523 TTGGCCCCACTTTGTAGAAGGGG - Exonic
1086165914 11:83777741-83777763 TTTCACCCACTCGGAAGAAGGGG - Intronic
1086369795 11:86144991-86145013 TTGGAGCCACAGTGAAAAAGAGG - Intergenic
1086949951 11:92881960-92881982 TTGGTCCCTCTGGGAAGCTGGGG - Intronic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1092995045 12:13941644-13941666 CTGGACCCACAGGGAAGTGGTGG + Intronic
1094178855 12:27569637-27569659 TTGAACCCCCTGGGAGGCAGAGG - Intronic
1094672893 12:32588071-32588093 TTGGAACCACAGGGATGGAGGGG + Intronic
1095521515 12:43072448-43072470 TTGGACCCTCAGGGAATAAAAGG + Intergenic
1097603413 12:61722996-61723018 GTGGAGACATTGGGAAGAAGGGG - Intronic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1100078514 12:90819533-90819555 TTACACATACTGGGAAGAAGTGG + Intergenic
1100870262 12:98903423-98903445 TTGGAACTACTGGGAAAAAGGGG + Intronic
1101071316 12:101079251-101079273 TTTGATAGACTGGGAAGAAGAGG + Exonic
1103480476 12:121247178-121247200 TTGGACCCACTGGGAAGAAGTGG - Intronic
1103728832 12:123012802-123012824 GTTGACCCACTGGGTAGGAGTGG + Intronic
1104997611 12:132668419-132668441 CTGGCCCCTCTGGGAACAAGGGG + Exonic
1105599328 13:21871973-21871995 TTGGCTACACTGGGAAGGAGCGG - Intergenic
1106224463 13:27774596-27774618 TGAGACTCACTGGGAAGAGGTGG - Intergenic
1106470172 13:30047084-30047106 CTAGAGCCACTGGGAAGATGTGG - Intergenic
1107750316 13:43558160-43558182 CTGGTACCACTGGGAAGAACAGG + Intronic
1108055616 13:46482009-46482031 TAGGAACCAAGGGGAAGAAGAGG + Intergenic
1110774344 13:79389894-79389916 ATGGAACCACTGGAAAGAATAGG + Intronic
1111937264 13:94570102-94570124 TTGGGTCCTCTGGGAAGTAGTGG - Intergenic
1111979623 13:95002898-95002920 TCGTTCCCACTGGGAGGAAGGGG - Intergenic
1113387869 13:109867259-109867281 TGGGACCCTCTGGGAAGGCGGGG + Intergenic
1113759168 13:112835628-112835650 TTGGACTCAGTGGGAAGCTGCGG - Intronic
1118219450 14:63841258-63841280 TTGGAACTTCTGGAAAGAAGGGG + Intergenic
1118283400 14:64449517-64449539 GTGCACTCACTGGGCAGAAGGGG + Exonic
1120093571 14:80362423-80362445 TTGGCCACACTGGGAAGAAGGGG + Intronic
1121443308 14:93962674-93962696 TTGGACACATTAGAAAGAAGTGG - Intronic
1121644040 14:95505507-95505529 ATGGCCACACTGTGAAGAAGCGG - Intergenic
1122015340 14:98790280-98790302 CTGGTCCCACTGTGAAGCAGTGG + Intergenic
1122819128 14:104332507-104332529 TTGGTCCCTCTGGGAAGACTGGG - Intergenic
1127432413 15:58923423-58923445 TTGGCCCAACTGGGAGAAAGGGG + Intronic
1128922326 15:71623117-71623139 TTGGTGCCACTGGAAAGAATTGG + Intronic
1130809877 15:87365634-87365656 TTGGATCCATTGGGATGTAGAGG - Intergenic
1131071976 15:89471714-89471736 TCAGACCCCCTGGGATGAAGGGG + Exonic
1131116628 15:89799984-89800006 GGGGACCCACAGGGAGGAAGGGG - Intronic
1133167075 16:3955627-3955649 TTGGAACCTCTGGGAGGCAGAGG - Intronic
1133526628 16:6611897-6611919 TTGCAACCAATGGGAAGAGGAGG - Intronic
1134671832 16:16061454-16061476 TTGTCACCACTGGGAAGAAGAGG - Intronic
1136063793 16:27745322-27745344 GTGGACCCACAGAGAAGAAGAGG - Intronic
1136083327 16:27867408-27867430 TGGGAGCCACTGGGAGGCAGAGG + Intronic
1136925665 16:34371264-34371286 TTGAACCTAATGGGAAGGAGAGG - Intergenic
1136978909 16:35040542-35040564 TTGAACCTAATGGGAAGGAGAGG + Intergenic
1138894224 16:61183413-61183435 TATGACCCACTGTGAGGAAGAGG + Intergenic
1140299086 16:73738946-73738968 TTGGACTCACAGAGGAGAAGAGG - Intergenic
1141059507 16:80852910-80852932 CTGGACCCACAGGGATGAATGGG - Intergenic
1141879282 16:86847179-86847201 TTGGAGCAAATGGGAAGCAGGGG - Intergenic
1142107187 16:88310446-88310468 ATGGTTCCACCGGGAAGAAGGGG - Intergenic
1142179276 16:88659467-88659489 TTGTCCCCAGTGGGAGGAAGCGG - Intronic
1144288893 17:13806589-13806611 TAGGACACAGTGGGAAGAGGAGG + Intergenic
1145012605 17:19378390-19378412 TTGGACGCAGTAGGTAGAAGGGG + Intronic
1146372036 17:32270682-32270704 TGGGACCCATGGGGAAGAATCGG - Intronic
1148387641 17:47246068-47246090 TTGGTCTCATTGGGCAGAAGAGG + Intergenic
1148612415 17:48973106-48973128 TTGAACCCAGTGGGCAGAGGAGG + Intergenic
1149561320 17:57609727-57609749 TCGGATCCACTGGGGAGGAGTGG + Intronic
1150495411 17:65604319-65604341 TGAGATCCACTGGGAGGAAGGGG + Intronic
1151871828 17:76841774-76841796 CTGGACCCACTGGGTACAAGGGG - Intergenic
1154503222 18:15006767-15006789 ATGGTCCCACAGGGAATAAGGGG - Intergenic
1156039912 18:32809178-32809200 ATGGACCATCTGAGAAGAAGAGG + Intergenic
1157557245 18:48620933-48620955 CTGTCCCCACTGGGAAGCAGGGG + Intronic
1158241054 18:55378831-55378853 TTGGACGCACTAGCAAGAACAGG + Intronic
1159459806 18:68710578-68710600 TTGTAACCACTGGCAAGAAGGGG + Intronic
1159770541 18:72542364-72542386 GTGGAGCCACCGGGAAGAAGGGG + Intronic
1160304243 18:77717228-77717250 TCGGGCCCACAGGGAGGAAGAGG + Intergenic
1160472538 18:79150222-79150244 TTGGAAACAATGTGAAGAAGCGG + Intronic
1161055475 19:2188747-2188769 TTGGACCCACTGGCAAAATGTGG - Intronic
1162105616 19:8367912-8367934 TTGAACCCAGTGGGAGGCAGAGG - Intronic
1162720816 19:12661551-12661573 TTGGACCCACTACCTAGAAGAGG + Intronic
1162811992 19:13169889-13169911 GTGGAACCACTGGGAAGTTGAGG - Intergenic
1162910307 19:13844372-13844394 TGGGCCCCACAGGGAAGAAAAGG - Intergenic
1163385509 19:16997541-16997563 TTGGCTCCATTGGGCAGAAGAGG + Intronic
1164743427 19:30593902-30593924 TTGTAGACACTGAGAAGAAGAGG + Intronic
1165944339 19:39432645-39432667 CTGGACACATTGGGAAGATGAGG + Intergenic
1166231295 19:41427042-41427064 TTGGACGGAGTGGGAAGAACAGG - Intronic
1166251242 19:41572499-41572521 TTGGTGCCTCTGGGAAGAGGAGG - Intronic
1166559601 19:43723356-43723378 TTGAACCCAGTGGGCATAAGTGG + Intergenic
1167000892 19:46745580-46745602 TGGGACCCGCTGGGAAAGAGCGG - Intronic
1168567657 19:57438582-57438604 ATGGACCCTGTGGGAAGATGTGG - Intronic
925130736 2:1492520-1492542 TGGGAACAACTTGGAAGAAGAGG - Intronic
925611652 2:5706628-5706650 TAGGACACACTGGGTGGAAGTGG + Intergenic
925907519 2:8548104-8548126 TCGGAACCACTGGGTTGAAGGGG - Intergenic
927256263 2:21043585-21043607 TAGCACCCGCTGGGAAGACGTGG - Intronic
927667719 2:25043616-25043638 TTGGACCAAGTGGGAGGAGGGGG + Intronic
929445861 2:42000745-42000767 GAGGAACCACTGGGACGAAGTGG - Intergenic
932275862 2:70451817-70451839 TGGGTCCCACTGGGAATCAGTGG - Intronic
934714104 2:96533353-96533375 TGGGACACACTGGGGAGATGTGG + Intergenic
934908946 2:98232948-98232970 TTGAACCCACAGGGACCAAGAGG + Intronic
936918152 2:117661128-117661150 TTGGAATCACTGGGAAATAGTGG + Intergenic
938086829 2:128407335-128407357 TGGGAGGCACTGGGAAGCAGAGG + Intergenic
938142421 2:128807234-128807256 TTGGAGCAGCTGGAAAGAAGGGG - Intergenic
938502402 2:131836928-131836950 ATGGTCCCACAGGGAATAAGGGG - Intergenic
939560454 2:143725583-143725605 GTGGAACCACAGGGAAGGAGGGG - Intronic
940496339 2:154433625-154433647 TTAGGCCCAATGTGAAGAAGGGG + Intronic
942295002 2:174508366-174508388 CTGGACCCACCGGGAACAAGGGG + Intergenic
945075802 2:206038468-206038490 TTGGTCCCAATAGGAAGTAGAGG + Intronic
947397029 2:229696525-229696547 CTTGAGCCACTGGGAATAAGTGG - Intronic
948580767 2:238986118-238986140 TTGTTCCCACTGGGAAGGGGCGG - Intergenic
1170797478 20:19561599-19561621 TGGGACCAACTGAGTAGAAGTGG - Intronic
1172089274 20:32416428-32416450 TTGTAGCTACTGGGAAGAACAGG - Intronic
1172099713 20:32477837-32477859 TGGGTCCCACTGGGAAAAGGTGG + Intronic
1172309686 20:33908118-33908140 TTGGATCCAAAGGGATGAAGTGG - Intergenic
1173474823 20:43351644-43351666 AGGGAACCTCTGGGAAGAAGAGG + Intergenic
1173916951 20:46714798-46714820 TTGGAGCCATTAGGAAGACGAGG - Intronic
1174450531 20:50617310-50617332 TTGAGCTCTCTGGGAAGAAGGGG + Intronic
1176037534 20:63047163-63047185 TATGACCCACTGGGAAAAACTGG - Intergenic
1177062645 21:16394268-16394290 ATGGAGCAACTGGGTAGAAGGGG + Intergenic
1178462181 21:32812342-32812364 TAGGCCCCAGTGGGAAGAACAGG - Intronic
1178694354 21:34780329-34780351 CTGCACCCACCTGGAAGAAGGGG + Intergenic
1180085127 21:45504946-45504968 TCGCACCCCCAGGGAAGAAGGGG + Intronic
1180631664 22:17234214-17234236 GTGGAGCCACTGGGAAGAGGTGG - Intergenic
1180665182 22:17505179-17505201 TAGGACCCACAGTGAAGGAGAGG - Intronic
1181777566 22:25170578-25170600 GTGGGCCAACTGGGATGAAGTGG - Intronic
1181824325 22:25502096-25502118 TTGTACTTAGTGGGAAGAAGAGG + Intergenic
1182079149 22:27516990-27517012 TTCTACCCACTAGGAGGAAGTGG + Intergenic
1182092495 22:27605411-27605433 CTGGACATGCTGGGAAGAAGAGG + Intergenic
1182428498 22:30287095-30287117 AGGGACCCAGTGGGAAGAGGAGG + Intronic
1184653164 22:45928435-45928457 TTGCACCCACTGTGCAGATGAGG + Intronic
951810589 3:26694758-26694780 GTGGCTCCACTGGTAAGAAGAGG + Intronic
953089406 3:39708716-39708738 ATCCAACCACTGGGAAGAAGTGG + Intergenic
954180290 3:48876259-48876281 TTGAACCCAGGGGGAAGAGGTGG + Intronic
954393183 3:50278224-50278246 TTGCCCCCACTGGGAAGGAAGGG + Intergenic
956151810 3:66251515-66251537 CTGGGCCCACTGGCAAGATGGGG - Intronic
958887949 3:99749762-99749784 TTATACTCACTTGGAAGAAGAGG + Intronic
959582315 3:107994032-107994054 TTGGACCAAGTTGGAAGCAGTGG - Intergenic
959864542 3:111251318-111251340 TTTGACCCACAGGGCAGAACTGG + Intronic
960556280 3:119034494-119034516 CTGGCCCCACCGGGAAGAAAGGG + Intronic
963208845 3:142666104-142666126 TGGGGGCCACTGGGGAGAAGGGG + Intronic
964020544 3:152005144-152005166 TTGGACACACTGGCCAGGAGAGG + Intergenic
966672008 3:182537675-182537697 TTGCAGCCACTGGGAAGGTGTGG + Intergenic
967192709 3:186999009-186999031 TTGGCCACAGTGGGAAGAGGAGG - Intronic
968123867 3:196144326-196144348 TTGGAGGCACTGGGAAGCCGTGG - Intergenic
968336660 3:197919357-197919379 TCTCACACACTGGGAAGAAGAGG - Intronic
969635675 4:8368283-8368305 GTGGCCTCACTGGGAAGATGGGG + Intronic
973774053 4:54229814-54229836 CAGGACCCACTGCCAAGAAGAGG - Intronic
973867269 4:55126020-55126042 TTGGAGCCACAAGGGAGAAGCGG + Intergenic
974011677 4:56613082-56613104 TAAAACCCTCTGGGAAGAAGGGG - Intergenic
974858928 4:67496196-67496218 TTGGACCCAGCTGGAAGAACTGG - Intronic
975608276 4:76178493-76178515 TTGAAGCCACTGGGAACAAAAGG + Intronic
976984529 4:91276747-91276769 TTGGACACAATGGGAAAAACTGG - Intronic
981540955 4:145845851-145845873 TTGAACCCAGTGGGAGAAAGAGG + Intronic
981771241 4:148311145-148311167 TTCAACCCACTGGGAAGATAAGG - Intronic
984087196 4:175327441-175327463 TTGCACCCACAGGGAAACAGAGG - Intergenic
984946515 4:184972861-184972883 TTGGGGCAAATGGGAAGAAGAGG - Intergenic
985769168 5:1798263-1798285 TTAGAGCCTCTTGGAAGAAGTGG - Intergenic
985868603 5:2536274-2536296 TGGGTCTCACTGGGAAGAAGGGG + Intergenic
986493334 5:8316759-8316781 TGGTACCTACTGGGAACAAGAGG - Intergenic
987503712 5:18744542-18744564 TTGGGCACCCTGGAAAGAAGAGG - Intergenic
988776461 5:34481977-34481999 TGGGAAACACTGGGTAGAAGAGG + Intergenic
989719420 5:44506421-44506443 TTGGACCCAAAGGAAGGAAGTGG - Intergenic
990476346 5:56164772-56164794 TTGGACCTGCTGAGAAGCAGAGG + Intronic
993799350 5:92312403-92312425 TTGGAGCCACAGGGAGGCAGAGG + Intergenic
995048104 5:107672131-107672153 TTGAAACGACTGGCAAGAAGTGG + Intergenic
995173219 5:109141976-109141998 GTGGCCACACTGGGAAGAACAGG - Intronic
995625173 5:114068645-114068667 CTGGACCCTCTGGGAAGCACTGG - Intergenic
1001661259 5:173395328-173395350 CTGGACCCAGTAGCAAGAAGAGG - Intergenic
1002629593 5:180562258-180562280 TTGTACCTAGTGGGAAGAATAGG + Intronic
1002634383 5:180599931-180599953 TTGGGCCCACTGGGGTGGAGTGG + Intergenic
1002641377 5:180632188-180632210 GCGGACCCTCTGGGAAGCAGCGG - Intronic
1002695483 5:181085646-181085668 TTGGACCCGGTGATAAGAAGTGG - Intergenic
1003339741 6:5208311-5208333 TTGGTCTCACAGGCAAGAAGCGG - Intronic
1004447878 6:15717504-15717526 TTGGATCCTCTGGTAATAAGGGG - Intergenic
1006299128 6:33184534-33184556 GTGGGTCCAGTGGGAAGAAGTGG + Intronic
1007001957 6:38321924-38321946 TTGCACCCAGTGGGAAGACTGGG - Intronic
1007174409 6:39886286-39886308 TGGGTCTCACTGGGATGAAGTGG + Intronic
1007216995 6:40248147-40248169 TTGCACGCACTGGGCAGATGAGG - Intergenic
1007730552 6:43942870-43942892 TAGGTCCCACAGGGAAGAAGAGG + Intergenic
1008678155 6:53843742-53843764 GTGGACACACTGGAAAAAAGAGG - Intronic
1008906387 6:56681851-56681873 AAGGTCCCACTGGGGAGAAGAGG + Intronic
1009278601 6:61718568-61718590 ATGGACCCAGTAGGAAGCAGAGG - Intronic
1013774068 6:113659429-113659451 GTGAACCCATGGGGAAGAAGAGG - Intergenic
1014172991 6:118299372-118299394 ATGGACCCATTGGTAGGAAGTGG - Intronic
1022497300 7:30861145-30861167 TTGGGCCCTCTGGGAGGCAGAGG - Intronic
1027156136 7:75769580-75769602 ATGGACCCGCTGGGGAGGAGAGG - Exonic
1028947964 7:96602171-96602193 TGGGAGCCATTGGTAAGAAGAGG + Intronic
1030814954 7:114024235-114024257 TTTGAGCGACTGGGAAGATGAGG - Intronic
1030969972 7:116044973-116044995 TAGGACCCACTGGGATGCATTGG - Intronic
1032065853 7:128770061-128770083 TTGGCACACCTGGGAAGAAGAGG - Exonic
1032386653 7:131530055-131530077 CTGCACCCCCTGGAAAGAAGAGG - Intronic
1032495712 7:132360632-132360654 ATGGACCAATTTGGAAGAAGAGG + Intronic
1032839161 7:135700478-135700500 TCGGCCCCACTAGGAAGATGGGG - Intronic
1034513289 7:151553514-151553536 TTGGGCCAATGGGGAAGAAGTGG - Intergenic
1035029873 7:155849938-155849960 TTGGACCCATTGGTAGGAGGTGG + Intergenic
1035596829 8:865103-865125 TAGGACCCCCAGGGAACAAGGGG + Intergenic
1038487419 8:27946765-27946787 TTCCACTCACTGGGATGAAGAGG - Intronic
1040963054 8:53055024-53055046 TTGTACTGAGTGGGAAGAAGAGG + Intergenic
1042064423 8:64858472-64858494 TTCCACCCCCTGGGAGGAAGAGG + Intergenic
1044738253 8:95300961-95300983 TGGGATCAACTGGGAAGATGGGG + Intergenic
1046557372 8:115791144-115791166 TTGGACCCACTGGGGTGCACAGG + Intronic
1047101163 8:121677298-121677320 ATGGAACCACTGGAAAGAAAAGG - Intergenic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1048956357 8:139540222-139540244 TTGGAAACATTGGAAAGAAGAGG - Intergenic
1049665289 8:143840300-143840322 TTGGGCCCACTGGAAAGGTGTGG - Intronic
1051295233 9:15588250-15588272 ATGGAAGCAGTGGGAAGAAGAGG + Intronic
1051606299 9:18920639-18920661 CTGGAACCACTGGGAAGCAAAGG + Intergenic
1051778468 9:20661622-20661644 TTTGTCACACTGGGAAAAAGAGG + Intronic
1056111664 9:83402438-83402460 TTGGCCCCACTAGGATGATGGGG + Intronic
1057404198 9:94753218-94753240 TTGGACCCAGAAGGAAGGAGTGG + Intronic
1058430048 9:104910190-104910212 TTGGCCCCTCTGGGTGGAAGAGG + Intronic
1058576922 9:106413881-106413903 GTGGACCCACTGTGAAAAAGTGG + Intergenic
1060663092 9:125415805-125415827 TTGGACCCACGTGGGAGAGGTGG + Intergenic
1060723826 9:125994806-125994828 TGGGACCCAGTGAGAACAAGGGG + Intergenic
1060883493 9:127134912-127134934 TTGGACTCACTGGGCCGGAGAGG - Intronic
1062163009 9:135090033-135090055 TTTGACCCAAAGGGAAGAAAGGG - Intronic
1187936358 X:24340000-24340022 TGGGACCCAAGGTGAAGAAGAGG + Intergenic
1191858094 X:65643757-65643779 TGGGACCCACTGGGAAGGTATGG + Intronic
1192444624 X:71201541-71201563 TTGGAGCCATTTGGAAAAAGAGG + Intergenic
1192560341 X:72124045-72124067 TTGGAGTCCCTGGGGAGAAGTGG + Intergenic
1193117188 X:77786365-77786387 TTGGACCCCCTGCGAAAAGGTGG - Intergenic
1193884358 X:86965948-86965970 TTGAACCAACTGGGAGGCAGAGG + Intergenic