ID: 1103483875

View in Genome Browser
Species Human (GRCh38)
Location 12:121269484-121269506
Sequence CTGTGGATAAGGATGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103483866_1103483875 9 Left 1103483866 12:121269452-121269474 CCAGGAAGCTGAGTGCTGGAAAG 0: 1
1: 0
2: 3
3: 22
4: 274
Right 1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG 0: 1
1: 0
2: 5
3: 41
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103483875 Original CRISPR CTGTGGATAAGGATGGGGGC AGG Intronic
900141629 1:1141356-1141378 ATGGGGGTAAGGATGGGGGCAGG - Intergenic
900931120 1:5738469-5738491 CTATGGAGAAGGGTGGGGGAGGG - Intergenic
901193311 1:7425430-7425452 CTGTGAATGGCGATGGGGGCAGG + Intronic
901673792 1:10871107-10871129 CTGGGGAAATGGCTGGGGGCGGG + Intergenic
902666592 1:17943459-17943481 CATTGGATAATGATGGGGGCTGG + Intergenic
903135371 1:21306019-21306041 ATGTGGAGAAGGATGGATGCTGG - Intronic
903230425 1:21919023-21919045 CTTTGGGGAAAGATGGGGGCAGG - Intronic
903406074 1:23097346-23097368 CAGGGGATAAGGTTGGGAGCAGG + Intronic
903482234 1:23662158-23662180 CTGTGGAGGATGGTGGGGGCAGG - Intergenic
903654686 1:24942105-24942127 CTGAGGACACGGATGGGGGCAGG - Intronic
903820903 1:26101799-26101821 ATGTGGATAAGGCTTGGGGCTGG + Intergenic
903850351 1:26301926-26301948 CAGTGGAGAAGGATGGGGAAGGG + Intronic
904034060 1:27549788-27549810 CCGGGGATAAGGGTGGTGGCTGG - Exonic
904543517 1:31250176-31250198 CTGTGGAGAAGGGAGGGAGCTGG - Intergenic
904658039 1:32064090-32064112 GTCTGGATAAGAATGGGGGTAGG + Intergenic
904962170 1:34342204-34342226 GTGAGGATAGGGATGGGGGAGGG + Intergenic
906276645 1:44521566-44521588 CTGTGGGTGTGGGTGGGGGCAGG + Intronic
906398601 1:45488573-45488595 CTGTGGACAAGGATTTGAGCAGG - Intronic
906945391 1:50290243-50290265 TGGTAGAGAAGGATGGGGGCAGG + Intergenic
909361023 1:74758824-74758846 ATGTGTGTAAGGTTGGGGGCTGG - Intronic
909475236 1:76074664-76074686 CAGTGGATGGGGACGGGGGCGGG + Intergenic
910673229 1:89794238-89794260 TTGTGGATAAGGGTGGGGATAGG + Intronic
911144450 1:94539243-94539265 GTGTGGATATGTATGGGGGTGGG - Intronic
911293407 1:96084355-96084377 CTGAGGAAATGGATGGGAGCTGG + Intergenic
912806252 1:112759067-112759089 GCAGGGATAAGGATGGGGGCAGG + Intergenic
913117993 1:115714089-115714111 TTGTGGTTAAGGGTGTGGGCTGG + Intronic
914244310 1:145874245-145874267 CTGAAGATAAGAATGTGGGCTGG - Intronic
914352820 1:146855077-146855099 CTGTGGTTAAGGAGGTGGTCAGG - Intergenic
914750829 1:150533991-150534013 CTGTGGACAAGGATGGCGTGGGG + Intergenic
914814807 1:151055644-151055666 CTTTGGGTTAGGATGGGGGGTGG + Intronic
915128240 1:153680209-153680231 AGGTGGAGAAGGATGGGGCCAGG - Intronic
915954791 1:160212758-160212780 AAGTGGAAAAGGATGGGGGTGGG + Intronic
917505994 1:175627685-175627707 GGGTGGGTAAGGATGGGGGATGG - Intronic
918144748 1:181745647-181745669 ATGTGGATTAGGAAGGTGGCTGG - Intronic
918371574 1:183866803-183866825 CTGGGGACAAGGGTGGGAGCAGG + Intronic
920203453 1:204274967-204274989 ATCTGGATGAGGGTGGGGGCGGG + Intronic
920569898 1:207008646-207008668 CTGAGGCAAAGGAAGGGGGCTGG + Intronic
920737866 1:208551444-208551466 CTGCTGATAAGGATGGGGAAGGG - Intergenic
921007690 1:211111417-211111439 CGGTGGCAAAGGGTGGGGGCCGG - Intronic
921960132 1:221025779-221025801 CTGAGAATAAGGATGTGGGGAGG + Intergenic
922184668 1:223263613-223263635 CTTTGGAGAAGGATGGGGGAAGG - Intronic
922391794 1:225151317-225151339 CTGTGGATATAGTTGGGGGTGGG + Intronic
923989770 1:239423452-239423474 CTATGGAGGAGGATGGAGGCGGG + Intronic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1063216772 10:3932385-3932407 CTGTGGCAAGGGCTGGGGGCAGG + Intergenic
1063448253 10:6133883-6133905 CTTCGGATGAGGATGGAGGCGGG + Intergenic
1064495466 10:15905508-15905530 CTGGGGATTAGGGTGGTGGCGGG - Intergenic
1064645348 10:17454245-17454267 CTGTGGCTCAGGATGCGGCCGGG - Exonic
1068065534 10:52126153-52126175 CTGTGGATAATGGTGAGGGGAGG + Intronic
1069749171 10:70734688-70734710 AAGTGGATTTGGATGGGGGCAGG + Intronic
1070447082 10:76515798-76515820 CTGTTTAAGAGGATGGGGGCTGG - Intronic
1071756219 10:88543257-88543279 CTGTGGATGAAAATGGGGGCTGG - Intronic
1072465047 10:95655977-95655999 CAGGGGATAATGATGGGGGAAGG + Intronic
1072534938 10:96355408-96355430 CTGTGCAGGACGATGGGGGCTGG - Intronic
1073149995 10:101305057-101305079 CTGCTGCTGAGGATGGGGGCAGG - Intergenic
1073152866 10:101323614-101323636 CTTTGGACTGGGATGGGGGCAGG - Intergenic
1073232777 10:101986475-101986497 CTGTAGGTAATGATGGGGGAAGG - Intronic
1073381705 10:103082757-103082779 TTTTGGATGAGGATGGAGGCAGG + Exonic
1074781364 10:116804540-116804562 CTGTGGCTGGGGCTGGGGGCTGG - Intergenic
1074859768 10:117501554-117501576 CAGGGGTTGAGGATGGGGGCAGG + Intergenic
1074991819 10:118715697-118715719 CTGGGGACGAGGATGGGGGTAGG - Intronic
1075013177 10:118892066-118892088 CTATGGACCAGGATGGGGGTGGG + Intergenic
1075291404 10:121234173-121234195 CCATGGATCAGGTTGGGGGCAGG + Intergenic
1075375615 10:121975576-121975598 CTGTGGAGCAGGATGAGCGCGGG + Intergenic
1075738451 10:124678717-124678739 CTGTGGATACAGATGAGGGCAGG + Intronic
1076248212 10:128964142-128964164 CTGTGGCTGAGGATGAGGGGTGG - Intergenic
1076675125 10:132143730-132143752 CTCAGGATAAGGAAGGGGGCAGG + Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1078002578 11:7509797-7509819 CTGTGGATGAGCATGGGCTCTGG + Exonic
1079397283 11:20075779-20075801 CGCTGGATAAGCATGGGGGGTGG - Intronic
1079460817 11:20676347-20676369 CTGTGGGTTAGGTTGGGGGAGGG - Intronic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1083685238 11:64371465-64371487 GTGGGGATTAGGAGGGGGGCAGG - Exonic
1084705780 11:70815315-70815337 CTGTGGGGGAGGATGGGGGCAGG + Intronic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1087252840 11:95923532-95923554 GTGGGGAAAAGAATGGGGGCGGG + Intronic
1087269722 11:96098955-96098977 TTGTGGAAAGGGATGGGGGCAGG - Intronic
1087356289 11:97098263-97098285 CTGTGCATAGGGATTGGGGGTGG - Intergenic
1087554449 11:99697276-99697298 GTGTGGAGAAGGATGGGGTTGGG + Intronic
1088890708 11:114041953-114041975 CAAAGGAGAAGGATGGGGGCGGG + Intergenic
1089142048 11:116293222-116293244 CTTTGGAGAAGGTCGGGGGCTGG - Intergenic
1090442679 11:126737251-126737273 CTGGGGCTCAGGAAGGGGGCAGG + Intronic
1091624214 12:2110218-2110240 CTGGGGACCAGGATGAGGGCAGG - Intronic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092285174 12:7124510-7124532 CCTTGGATAGGGATTGGGGCTGG + Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1094375542 12:29784194-29784216 CGGGGGAGAAGGATGGGGGCGGG - Intronic
1094414236 12:30201199-30201221 TTGGGGAGAACGATGGGGGCGGG + Intergenic
1095102847 12:38201815-38201837 GTGTGGATGAGGGTGGGGGTGGG + Intergenic
1095999654 12:48118691-48118713 CAGTGGGGAGGGATGGGGGCGGG - Intronic
1096135746 12:49198964-49198986 CTTTGGAGAAGGAAGGGGGCAGG - Intronic
1096139147 12:49227784-49227806 CTGTGGACTAGGATGGCGGAGGG + Intronic
1096630666 12:52924983-52925005 CTGTGGAAAAGGAACAGGGCTGG + Intronic
1096754749 12:53789847-53789869 CTCTGGAGAAGGAAGGGGGAGGG + Intergenic
1096980491 12:55725870-55725892 GTGTGGAGAAGATTGGGGGCTGG - Exonic
1097131819 12:56816913-56816935 CTGAGGATGAGGGTGGGGGTGGG - Intergenic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097250842 12:57631706-57631728 ATGGGGATAAGGATGGGGATGGG - Intronic
1099025469 12:77459688-77459710 CTGTGGACGAGGCTGGGGGAGGG + Intergenic
1099348809 12:81538704-81538726 TTGTGGAACAGGATGGGGGCTGG + Intronic
1102261697 12:111447087-111447109 CTGAGGTTAAGGATCTGGGCAGG - Intronic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1104578459 12:129990410-129990432 CTTTGGAGAAGTTTGGGGGCAGG - Intergenic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104790756 12:131480691-131480713 CTGTGGTGGAGGGTGGGGGCAGG - Intergenic
1106421162 13:29587576-29587598 CAGAGGTTAAGGATGGGGCCTGG - Intronic
1107052893 13:36070939-36070961 CTCTTTATAAAGATGGGGGCCGG - Intronic
1108250308 13:48560307-48560329 CAGGGGTTAAGGATGGGGGAGGG + Intergenic
1111479099 13:88798800-88798822 GTGTGGGCAAGGTTGGGGGCCGG - Intergenic
1111924772 13:94451058-94451080 CTATGGACTAGGCTGGGGGCTGG - Intronic
1113680835 13:112243757-112243779 CTGTGGAGAAGGAGCAGGGCAGG + Intergenic
1114318450 14:21526849-21526871 TTGTGGAGAGGGATGGGGGTAGG - Intronic
1114613252 14:24055518-24055540 GTGGGGATATGGAAGGGGGCAGG - Intronic
1117846484 14:59916859-59916881 GTTGGGATAAGGGTGGGGGCTGG + Intergenic
1118308465 14:64675430-64675452 CTGTGGATAACTCTGGGTGCAGG + Intergenic
1119408151 14:74411490-74411512 CTGTGGATTCTCATGGGGGCTGG - Intronic
1121587453 14:95072047-95072069 CTGCGGATGAGGATGGGGAGCGG - Intergenic
1122075904 14:99234365-99234387 CTCTGAGGAAGGATGGGGGCTGG - Intronic
1124338596 15:28875646-28875668 CTGGGGAACTGGATGGGGGCGGG - Intergenic
1127286960 15:57540976-57540998 CTCTGCCTAAGGATGGAGGCAGG + Intronic
1128233639 15:66052472-66052494 ATGTGGATCAGGATTGAGGCTGG - Intronic
1128335356 15:66782205-66782227 CAGTGGATAGGGATGGCGGTGGG + Exonic
1128589325 15:68880740-68880762 CTGATGAGAAGGAGGGGGGCAGG + Intronic
1128673601 15:69593195-69593217 ATGTGGATAAACATGGTGGCAGG + Intergenic
1128715496 15:69904761-69904783 CAGTGGATAGGGGTGGGTGCTGG + Intergenic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1132413396 15:101602962-101602984 CTGTGGCTCAGAATGGGGTCCGG - Intergenic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132579857 16:679914-679936 CTGCGGATGGGGCTGGGGGCGGG + Intronic
1132841295 16:1979592-1979614 ATGTGGAGAAGGGTGCGGGCGGG - Exonic
1133688478 16:8189785-8189807 CTGTGGAGAGGGATGGAGGGTGG - Intergenic
1134511953 16:14855658-14855680 TTGCAGAGAAGGATGGGGGCAGG + Intronic
1134699594 16:16254158-16254180 TTGCAGAGAAGGATGGGGGCAGG + Intronic
1134972235 16:18540513-18540535 TTGCAGAGAAGGATGGGGGCAGG - Intronic
1135471860 16:22738180-22738202 CTGTGGATACAGAGAGGGGCTGG + Intergenic
1137019824 16:35414419-35414441 CTGAGGATAAGGTTGCGGCCTGG - Intergenic
1137271531 16:46905573-46905595 CTGTGGAAGTGCATGGGGGCTGG - Intronic
1138483014 16:57316649-57316671 CTGTGAATGAGTATGGGGGAAGG + Intergenic
1139017782 16:62711324-62711346 CAGTTGATAAGGAGAGGGGCAGG + Intergenic
1139981206 16:70860441-70860463 CTGTGGTTAAGGAGGTGGTCAGG + Intronic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1142385172 16:89759440-89759462 CTGTGGATACGGATGGGAAGGGG + Intronic
1142728161 17:1831477-1831499 CTGTGGATGGGAATGGTGGCAGG - Intronic
1143013731 17:3880435-3880457 CTATGGAGAAGGATGCGGGGAGG + Intronic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146489738 17:33271746-33271768 GTGTGGATAAGAATGGAGGCTGG - Intronic
1147192982 17:38748123-38748145 CTGGGGATTGGGATGGGGGCCGG - Intronic
1148464761 17:47858164-47858186 CTGGGGCTGAGGATGGGGGCCGG - Intergenic
1148592092 17:48824140-48824162 CAGTGGTTAAGAATGGGGCCAGG + Intergenic
1148829769 17:50424128-50424150 CTGTGGATGGGGAGGAGGGCTGG - Intergenic
1149429339 17:56584841-56584863 GTGGGGATGAGGATGGGGTCGGG + Intergenic
1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG + Intronic
1150229971 17:63544421-63544443 CTGTGGTCAGGGCTGGGGGCTGG + Intronic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151620810 17:75243768-75243790 CTGTGGATAGGCAGGGGGCCAGG + Intronic
1152287665 17:79422099-79422121 CTGGGGAGAAGGGTGTGGGCCGG + Intronic
1152928521 17:83098825-83098847 GTGGGGACAAGGAGGGGGGCTGG - Intergenic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1154031452 18:10757110-10757132 ATGGGGATAAGGATGAGGGTTGG + Intronic
1155096121 18:22558200-22558222 CTGAGTTTAAGGATGGGGGGTGG + Intergenic
1155526508 18:26721314-26721336 CTGGGGATGGGGATGGAGGCAGG + Intergenic
1156131922 18:33987003-33987025 CAGTGGGTAGGGATTGGGGCAGG + Intronic
1156885939 18:42136028-42136050 CTGTGAATGAGGAGGAGGGCTGG + Intergenic
1157595338 18:48860658-48860680 CTGGGGAAAAGGATGGGAGTGGG + Exonic
1158134949 18:54197926-54197948 CTGTAGATAAAGTTGGGGACAGG - Intronic
1158817595 18:61121468-61121490 CTGTGGATAAAGATGTGGCCTGG + Intergenic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1160348328 18:78152990-78153012 CTGGGGATAAGGAAGGGTCCTGG - Intergenic
1161016755 19:1987140-1987162 CTGGGGATGAGGCTTGGGGCTGG + Intronic
1161220633 19:3116508-3116530 CGCTGCATGAGGATGGGGGCAGG - Intronic
1161583952 19:5095106-5095128 CTGTGGACAGGGATGGGGACGGG - Intronic
1162929258 19:13948587-13948609 TGGGGGATGAGGATGGGGGCAGG - Intronic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163188458 19:15658228-15658250 CCCTTGATAAGGATTGGGGCTGG + Intronic
1163216328 19:15879911-15879933 CCCTTGATAAGGATTGGGGCTGG - Intronic
1163640125 19:18457334-18457356 CAGGGTATGAGGATGGGGGCGGG + Intronic
1166983364 19:46645091-46645113 CTGTGGATTCAGGTGGGGGCTGG + Intergenic
1166998788 19:46732792-46732814 CTGAGTATCAGGACGGGGGCAGG + Intronic
1167504435 19:49863648-49863670 GTGAGGAAAAGGAGGGGGGCCGG + Intronic
926234721 2:11031244-11031266 CTTTGGAGGAGGATGGGGGTGGG - Intergenic
927996754 2:27492383-27492405 CTGGGGATAGGGATGGGGTCAGG - Exonic
928140716 2:28726645-28726667 CTATGGATAGGGATGGGGACAGG - Intergenic
929950297 2:46405128-46405150 CTGGGGATAAGGATGGAAGGAGG - Intergenic
931169595 2:59788784-59788806 ATGTTGTTGAGGATGGGGGCAGG + Intergenic
931627694 2:64271659-64271681 CAGTGGATAAAGATGGGGCTGGG + Intergenic
931924822 2:67060542-67060564 GTCTGGATTAGGATGTGGGCTGG + Intergenic
932492554 2:72131451-72131473 CAGTGAATAAATATGGGGGCGGG + Exonic
932624240 2:73284822-73284844 CTGTGAATCCGGAAGGGGGCGGG + Intergenic
933271768 2:80240425-80240447 CTGTGGAGATGGCTGGAGGCAGG - Intronic
934559523 2:95305657-95305679 CAGGGGTTAAGGATGGGGGGAGG - Intronic
934560466 2:95310538-95310560 CTGTGGTCAAGGGTGGGGGTGGG + Intronic
934781216 2:96970950-96970972 CTGGGGGTGGGGATGGGGGCAGG - Intronic
935121449 2:100186653-100186675 CTCTGGATATGTGTGGGGGCAGG + Intergenic
935208954 2:100922118-100922140 CTGTGGCTATGGCTGGGGGTGGG + Intronic
935635830 2:105248979-105249001 CTGTGGAAGAAGATGGGAGCTGG + Intergenic
935813816 2:106827536-106827558 CTGTGGGTAAGGGTTGGGGGTGG - Intronic
936093874 2:109517290-109517312 CCGGGGATAAAGAGGGGGGCTGG - Intergenic
937524561 2:122752191-122752213 CTGAGCATAAGGATGAGGACAGG + Intergenic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
940041233 2:149363028-149363050 CAGCGGAGAAGTATGGGGGCAGG + Intronic
940640007 2:156334690-156334712 CTGGGGAGAAGGAAGGGGGTGGG + Intronic
940735360 2:157444905-157444927 CTTTGGCTGAGGTTGGGGGCAGG + Intronic
941229821 2:162897921-162897943 CTGTGGGCCTGGATGGGGGCTGG - Intergenic
945951568 2:216043935-216043957 CGGTGGATGTGGATGGGGGCCGG - Exonic
948946684 2:241224074-241224096 CTGGGGAGAGGGTTGGGGGCAGG - Intronic
1169671355 20:8106233-8106255 CTCTGCATAAGGATGGGGAGTGG - Intergenic
1169895405 20:10500453-10500475 GTGTGGAAAAAGATGGGGCCAGG + Intronic
1169901758 20:10560235-10560257 CTGTAGACAGGGATGGGGCCAGG - Intronic
1170174547 20:13454269-13454291 CTGTGGAGAATGATGGGGTGGGG + Intronic
1170407101 20:16049940-16049962 CTGTGGAGGAGGGTGGGGGTGGG + Exonic
1171358939 20:24573009-24573031 ATGTGGGTCAGGACGGGGGCTGG - Intronic
1172569546 20:35958781-35958803 CTGTGGTTAGGGATAGGGGAAGG - Intronic
1174148711 20:48470635-48470657 CTGTGGATGAGGGTTTGGGCAGG - Intergenic
1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG + Intergenic
1175412252 20:58777917-58777939 CTGTGGGGAAGGGTGGAGGCTGG - Intergenic
1175572755 20:60036661-60036683 CTGTAGATAGGGGTGGGGACAGG - Intergenic
1175839282 20:62016462-62016484 CTCTGGAGAAAGATGGAGGCCGG - Intronic
1176074777 20:63243469-63243491 CTGTGGAGAAGGATAGAGCCGGG - Intronic
1177281369 21:18986973-18986995 CTATTGATAGGGACGGGGGCAGG + Intergenic
1179029677 21:37709849-37709871 CTGTGGTGAAGGATGGGTGATGG + Intronic
1179389722 21:40976686-40976708 CAGTAGATAAGGATAGGGTCTGG - Intergenic
1180065087 21:45408462-45408484 TTGTTGAAAAGGCTGGGGGCTGG + Intronic
1180115730 21:45703747-45703769 CAGTGGATATGCATGGTGGCTGG + Intronic
1180701152 22:17782072-17782094 CTGTGGCTCAGAATGGGTGCTGG + Intergenic
1180725134 22:17941346-17941368 CAGTGGATAATGATGATGGCAGG + Intronic
1181465412 22:23108102-23108124 CTGTGCAGAAGGGTGGGGCCAGG + Intronic
1181472243 22:23147687-23147709 ATGTGCATAAGGATAGGGGTTGG + Intronic
1182096585 22:27630233-27630255 CTGTGGATTAGGAGAGGGGGTGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183299323 22:37051312-37051334 GTGTGTATAGGGGTGGGGGCGGG - Intergenic
1183654809 22:39178173-39178195 CTGTGGAGGAGGATGGGCACAGG + Intergenic
1184135940 22:42549956-42549978 GTGAAGATGAGGATGGGGGCGGG + Intergenic
949371394 3:3338302-3338324 CTGTGGATAAGGATAGTCTCTGG - Intergenic
949723008 3:7012544-7012566 CAGGGGAGAAGGATGGGGGAAGG - Intronic
949899696 3:8800334-8800356 CTCTGGAGAAGGATGAGGGCTGG + Intronic
950453820 3:13080650-13080672 CTGTGGGTAAGGATGCCTGCTGG - Intergenic
950903509 3:16517084-16517106 ATGTGAATTAGGGTGGGGGCAGG + Intergenic
951097575 3:18649793-18649815 AGGTTGAAAAGGATGGGGGCTGG - Intergenic
951717632 3:25665276-25665298 CTAAGGATGAGGATGGGGGCGGG + Intergenic
952277752 3:31893831-31893853 CTGGGGCTAAGGGTGGGAGCAGG + Intronic
952334213 3:32391353-32391375 GGCTGGATAAGGATGGGGCCAGG + Intergenic
953027262 3:39152472-39152494 ATGTGGAGAAGGAAGAGGGCAGG + Intronic
953095362 3:39769654-39769676 CTGTGGGTATGGATGTTGGCAGG - Intergenic
953980797 3:47412071-47412093 CTGTGGGACAGGATGGGGCCAGG - Intronic
954196891 3:49002307-49002329 CTGAGGAGAAGGCCGGGGGCTGG - Intronic
954329002 3:49879158-49879180 CTTTGGTTAAGAATGGGGACAGG + Intergenic
954749152 3:52804010-52804032 GTGGGGATAGGGATGGAGGCCGG + Intronic
955396923 3:58564152-58564174 TTCTGGAGAAGGATGGCGGCTGG + Intronic
955581962 3:60433087-60433109 CAGGGGATAGTGATGGGGGCAGG - Intronic
957602436 3:82355476-82355498 ATGTGCATAGGGATGGGGGCAGG - Intergenic
958057484 3:88430807-88430829 ATGTGGATGAGGAAGGGTGCAGG - Intergenic
959941307 3:112084807-112084829 CCCTGGGTAAGGATGGGGGTGGG + Intergenic
960218256 3:115070415-115070437 CTGTAGATAAGCATGGCAGCAGG + Intronic
960530421 3:118757891-118757913 GCCTGGATAAGGGTGGGGGCTGG - Intergenic
960934392 3:122888615-122888637 CAGTGTATTAGGATGGAGGCGGG - Intergenic
961381103 3:126497091-126497113 CTGTGGAGGAGGAGGCGGGCAGG - Intronic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
962354705 3:134683954-134683976 CTGTGGATCTGGGTGGGGTCAGG + Intronic
962608230 3:137050387-137050409 CTGGGTATAAAGATGTGGGCTGG - Intergenic
963051270 3:141146087-141146109 CTCTGGAAGAGGGTGGGGGCAGG - Intronic
963940200 3:151089660-151089682 ATGTGGAGAAGTATGGGGGTGGG + Intronic
964729832 3:159853053-159853075 CTGTGGAGAGGAATTGGGGCGGG + Intronic
967445293 3:189558896-189558918 GTTTGTCTAAGGATGGGGGCTGG + Intergenic
968808258 4:2788633-2788655 CTGAGGACAGGGCTGGGGGCTGG - Intergenic
969542692 4:7803535-7803557 CTGTGGTTGGGGATCGGGGCCGG - Intronic
972572955 4:40327302-40327324 CTGTGGGAGAGGTTGGGGGCTGG + Intergenic
973952665 4:56032943-56032965 GTGTGTATTAGGATGTGGGCTGG + Exonic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976060425 4:81121986-81122008 CTGTGCAAAAGCATGTGGGCAGG + Intronic
977360206 4:95994389-95994411 CTGTGGGGCAGAATGGGGGCAGG - Intergenic
977803194 4:101263645-101263667 GTGTGCATATGGGTGGGGGCAGG - Intronic
977865176 4:102016905-102016927 CTGTGGATAAGAATGGATACAGG + Intronic
978134467 4:105240553-105240575 CTGTGTAGAAGGATGGAGGGAGG + Intronic
978228322 4:106366011-106366033 CTGTGAATAAGGAGAGGAGCTGG - Intergenic
978823813 4:112996255-112996277 CTGGGAATAGGGATGGGAGCAGG + Intronic
979266806 4:118712903-118712925 CTGTGGAGAAAGAAGAGGGCAGG + Exonic
981728578 4:147873533-147873555 ATGGGGATAAGGGTGGGGGATGG + Intronic
983098126 4:163590172-163590194 CCTTGGCAAAGGATGGGGGCAGG - Intronic
983481928 4:168285713-168285735 ATGTGGATATGCATGGGGGATGG + Intronic
983565564 4:169147459-169147481 GTGTGGATGTGCATGGGGGCAGG + Intronic
983617665 4:169725697-169725719 CTGAGGATGAGGGTGGGGGTTGG + Intergenic
983904241 4:173168521-173168543 CTGCGGATCTGGAAGGGGGCAGG + Intergenic
986028206 5:3870955-3870977 GTGTGGAACAGGATGGGGGCGGG + Intergenic
986282274 5:6333404-6333426 CTGGGGATCTGGATGGTGGCAGG + Intergenic
987900531 5:24005215-24005237 CTGTGGAAAAAGTTGGGGGCAGG - Intronic
988404531 5:30807168-30807190 CTGGGGATCAGGATGTTGGCTGG - Intergenic
990271712 5:54148692-54148714 CATTGGGTAAGGATGGTGGCTGG + Intronic
990461791 5:56037556-56037578 CTGAGGATGAGGTTGGGGGAGGG + Intergenic
990581885 5:57173781-57173803 GCGTGGCTAAGGCTGGGGGCGGG - Intergenic
993302918 5:86235595-86235617 ATGAGGAAAAGGATGGGGGAAGG + Intergenic
993532707 5:89043873-89043895 CTGATGATAAGGAAGGAGGCAGG - Intergenic
994316570 5:98339798-98339820 CGGTGGATGAGGAAGGGGTCAGG - Intergenic
995006738 5:107206103-107206125 CTAAGGAGAAGGATGGGGCCAGG - Intergenic
995246071 5:109937106-109937128 CTGTGGCTTAGAATGGGGGTTGG - Intergenic
996338432 5:122410465-122410487 ATGTTCATAAAGATGGGGGCAGG + Intronic
996823939 5:127660289-127660311 CTCTGGACAAGGAAGGAGGCAGG - Intergenic
997267149 5:132501457-132501479 CTGCGGGAAAGGGTGGGGGCAGG + Intergenic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998563169 5:143191019-143191041 CTGTGGCTGAGCATGGGAGCAGG + Intronic
999010596 5:148034425-148034447 CTGTGGACAAGGGTTGGGGGGGG - Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
1000209685 5:159098021-159098043 CTGAGTATTAGGATGGGGGTGGG - Intronic
1000332386 5:160215987-160216009 TTGTGTGTAAGGATGGGGCCTGG + Intronic
1000873861 5:166611212-166611234 CTGTGTATGTGGTTGGGGGCGGG - Intergenic
1001650062 5:173309862-173309884 CTGTGCAGAAGGAATGGGGCCGG - Intergenic
1001663812 5:173416143-173416165 CTGAAGATAACGTTGGGGGCTGG - Intergenic
1002195114 5:177497159-177497181 CTGTGGAGACAGATGGGGGCTGG + Intronic
1002682786 5:180981421-180981443 CGGTGGAGAAGGAGGAGGGCGGG + Intergenic
1002886413 6:1299285-1299307 CTGGGGCTAAGGATGGGGCAGGG + Intergenic
1004455531 6:15788315-15788337 CTGTGGACAGTGACGGGGGCTGG - Intergenic
1004536922 6:16511984-16512006 TTGAGGAGAAAGATGGGGGCTGG - Intronic
1005913169 6:30327975-30327997 CCCTGGAGAAGGATGGGGGTCGG + Intronic
1006088979 6:31616642-31616664 CTATGGATAGGGATGGGGTCGGG - Intronic
1006297769 6:33177619-33177641 CGGGGGATAAGAATGGGGGTGGG + Intronic
1006313183 6:33275884-33275906 GTGAGGACAAGGAAGGGGGCTGG + Intronic
1006642192 6:35495275-35495297 CTTTGGGTGAGGATGGGAGCAGG + Intronic
1006741354 6:36311304-36311326 CTGAGGATAAGGGTGTGGGAGGG + Intergenic
1007263341 6:40579119-40579141 CTGTGAATGAGGATGCTGGCAGG - Intronic
1007315342 6:40983787-40983809 CTCTGGACTGGGATGGGGGCAGG - Intergenic
1007423546 6:41733878-41733900 CTGGGGATGAGGTTGGAGGCTGG - Intronic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1008611520 6:53188621-53188643 CTGTGGATAAGGGAGCGGGAGGG + Intergenic
1011406855 6:87024712-87024734 CAGAGAATAAGGGTGGGGGCAGG - Intergenic
1012164804 6:95935579-95935601 CTGTGGATAACGGCGGGGGTGGG - Intergenic
1012750002 6:103147852-103147874 TTGGGGATAAGGATGGGGGTTGG + Intergenic
1013481139 6:110553805-110553827 CTGTGTAGAAGGATGGGGCTGGG - Intergenic
1015089003 6:129331384-129331406 CTGAGGGTAAGGATGGGAGGGGG - Intronic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1015946352 6:138505123-138505145 GTGTAAATAGGGATGGGGGCGGG - Intronic
1016739834 6:147515231-147515253 CTGTGGAAAAAAGTGGGGGCAGG + Intronic
1016851878 6:148628392-148628414 AGGGGGATAAGGATGGGGGAGGG - Intergenic
1017645680 6:156538114-156538136 CTGGGCATGAGGATGGGGGTTGG + Intergenic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1019343862 7:520360-520382 CTTTGGGGAAGGAGGGGGGCGGG + Intergenic
1019664229 7:2243375-2243397 CAGATGATAAGGAAGGGGGCAGG - Intronic
1019789292 7:3000361-3000383 CTGTGGGTAAGGGTGGTTGCTGG - Intronic
1020473554 7:8567398-8567420 TTGTGGAAAAGGCTGTGGGCAGG + Intronic
1022920960 7:35014295-35014317 CTGGGGATAAGGGTGGGGAGTGG + Intronic
1024465298 7:49705911-49705933 CTGTAGAAAAGGAGGAGGGCAGG - Intergenic
1024473123 7:49783665-49783687 CTGTGGAAAAGGATGATGTCAGG + Intronic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1024866698 7:53911542-53911564 GTGTGCATGTGGATGGGGGCGGG - Intergenic
1026523838 7:71137612-71137634 ATGTGGAGAGGGGTGGGGGCTGG + Intronic
1026913382 7:74105852-74105874 CTGTGGGTAAGGCAGGGGTCAGG - Intronic
1027059145 7:75071726-75071748 CAGTTGGTAAGGATGGGGCCAGG - Intronic
1027361663 7:77416176-77416198 CTGCGGAGAGGGGTGGGGGCGGG - Intronic
1028805409 7:95020616-95020638 CTGGGGGACAGGATGGGGGCTGG - Intronic
1028849467 7:95520640-95520662 GTGTGGATGGGGATGGGGGGTGG - Intronic
1029851805 7:103469381-103469403 CTGGGGATGGGGATGGGGGTGGG - Intergenic
1030023494 7:105299010-105299032 CAGTGCATATGGATGGGGGAGGG - Intronic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032197466 7:129797625-129797647 CTGGGGAAAAAGCTGGGGGCGGG + Intergenic
1035222083 7:157411809-157411831 CTGTGGCTATGGCTGTGGGCGGG + Intronic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035362874 7:158325044-158325066 CTGTGGATAATTGTGGGGACTGG - Intronic
1035447196 7:158951316-158951338 CTGTGCCTGATGATGGGGGCAGG - Intronic
1035469054 7:159098151-159098173 CTGTGCTGATGGATGGGGGCCGG - Intronic
1037438587 8:18890807-18890829 CTGGGGGTAAGGGTGGGGGAGGG + Intronic
1037936739 8:22919996-22920018 TTGAGGAGAAGGCTGGGGGCTGG - Intronic
1038635856 8:29286653-29286675 CAGTGGCTGAGGTTGGGGGCTGG + Intergenic
1040700394 8:50056467-50056489 CTGTGGAGAAGGATGAAGTCAGG + Intronic
1042543988 8:69934533-69934555 ATGTGGGGAAGGATGGGGGCAGG - Intergenic
1043132117 8:76474399-76474421 CGGTGAATAAGGGTGGGGGATGG + Intergenic
1043616311 8:82129965-82129987 CTGTGGATATGAATGAGCGCAGG + Intergenic
1044304887 8:90627616-90627638 CTGGGGAGTAGGATGAGGGCAGG + Intronic
1044737748 8:95296664-95296686 GTATGGATGAGGATGTGGGCAGG - Intergenic
1046534323 8:115489101-115489123 TTTTGCATAAGAATGGGGGCAGG - Intronic
1047705575 8:127496083-127496105 TTGAGAATAAGGATGGGGACAGG - Intergenic
1048438994 8:134445903-134445925 CTGTGGCTAATGATGAGGGAAGG + Intergenic
1048999425 8:139815279-139815301 CTGGAGATGAGAATGGGGGCAGG + Intronic
1049353497 8:142176672-142176694 GTGGGGAAAAGGACGGGGGCAGG - Intergenic
1053195024 9:36110789-36110811 ATGTGGAGAGGGGTGGGGGCCGG + Intronic
1054918705 9:70520460-70520482 CTGTGGAGGAGGATGGGCGAGGG + Intergenic
1055656266 9:78453035-78453057 GTGAGGAAAGGGATGGGGGCAGG - Intergenic
1056457981 9:86781691-86781713 TTGTGGATAGGGATGGGGTTGGG - Intergenic
1056881817 9:90401548-90401570 GTCTGGACAAGGTTGGGGGCAGG + Intergenic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1057598772 9:96439098-96439120 CTGTTAATAATGATGGGGGAGGG + Intergenic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058327157 9:103713128-103713150 CTGGGGGTAATGGTGGGGGCTGG - Intergenic
1060106920 9:120878399-120878421 CTGAGGGCAAGGATGGGGGTGGG - Intronic
1060566417 9:124596574-124596596 CTGAGGGTAAGGATTGGGGGTGG - Intronic
1061940404 9:133880895-133880917 CCGTGGCTCAGGATGGAGGCAGG + Intronic
1062445625 9:136592973-136592995 CTTGGGAGAAGGATGGGGGTGGG + Intergenic
1062735454 9:138134875-138134897 CTGTGGCCAAGGATGGGGGAAGG + Intergenic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187354082 X:18550333-18550355 CTGTGGGTATGGATGTGGGTGGG - Intronic
1187557958 X:20370078-20370100 CTGAGGGTAGGGTTGGGGGCTGG - Intergenic
1187811059 X:23177378-23177400 CTGAGGATTAGGATTGGGGATGG + Intergenic
1188112808 X:26212095-26212117 CTGTGGGGAAGGGTGGGGGGTGG + Intergenic
1188316110 X:28675685-28675707 CTGTGGAGAAATATGGGGGTGGG + Intronic
1189171404 X:38913118-38913140 GTTTGAATAAGGTTGGGGGCGGG + Intergenic
1189256345 X:39642600-39642622 CAGAGGAGAAAGATGGGGGCAGG + Intergenic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1192410435 X:70928761-70928783 CCAGGGATAAGGATGGGGGATGG - Intronic
1193531613 X:82661023-82661045 CAGTGAATGAGGATGAGGGCGGG + Intergenic
1194632468 X:96302332-96302354 CTGTGGATAAGTAAGGGGGCAGG - Intergenic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1197905056 X:131415788-131415810 TGGTGGACAAGGTTGGGGGCAGG - Intergenic
1198119578 X:133578871-133578893 CTATGGAGAGGGATGGGGGTTGG + Intronic
1198235619 X:134733749-134733771 CTGGGGATGAGGATGAGGCCTGG + Intronic
1198382988 X:136101553-136101575 CTGTGGATGAGGATGGGAAGAGG + Intergenic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic