ID: 1103494622

View in Genome Browser
Species Human (GRCh38)
Location 12:121352122-121352144
Sequence GGCGCCTCTCACCTGCAGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2481
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 2439}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103494616_1103494622 29 Left 1103494616 12:121352070-121352092 CCGCACAGAGCAGATGCTCAGTA 0: 1
1: 2
2: 8
3: 63
4: 377
Right 1103494622 12:121352122-121352144 GGCGCCTCTCACCTGCAGCAGGG 0: 1
1: 0
2: 0
3: 41
4: 2439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103494622 Original CRISPR GGCGCCTCTCACCTGCAGCA GGG Exonic
Too many off-targets to display for this crispr