ID: 1103502633

View in Genome Browser
Species Human (GRCh38)
Location 12:121415341-121415363
Sequence CAAGTGTGAGCCACTATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199650
Summary {0: 32, 1: 1196, 2: 16048, 3: 56759, 4: 125615}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103502633_1103502635 -2 Left 1103502633 12:121415341-121415363 CCTGGCATAGTGGCTCACACTTG 0: 32
1: 1196
2: 16048
3: 56759
4: 125615
Right 1103502635 12:121415362-121415384 TGTAATCTGAGCACTTCAGGAGG 0: 2
1: 155
2: 3376
3: 38310
4: 366536
1103502633_1103502639 22 Left 1103502633 12:121415341-121415363 CCTGGCATAGTGGCTCACACTTG 0: 32
1: 1196
2: 16048
3: 56759
4: 125615
Right 1103502639 12:121415386-121415408 CAAGGTAGGCAGATCACTTGAGG 0: 138
1: 4829
2: 19432
3: 48379
4: 82197
1103502633_1103502634 -5 Left 1103502633 12:121415341-121415363 CCTGGCATAGTGGCTCACACTTG 0: 32
1: 1196
2: 16048
3: 56759
4: 125615
Right 1103502634 12:121415359-121415381 ACTTGTAATCTGAGCACTTCAGG 0: 1
1: 25
2: 795
3: 14049
4: 126173
1103502633_1103502636 4 Left 1103502633 12:121415341-121415363 CCTGGCATAGTGGCTCACACTTG 0: 32
1: 1196
2: 16048
3: 56759
4: 125615
Right 1103502636 12:121415368-121415390 CTGAGCACTTCAGGAGGCCAAGG 0: 1
1: 48
2: 1236
3: 13177
4: 117587
1103502633_1103502637 8 Left 1103502633 12:121415341-121415363 CCTGGCATAGTGGCTCACACTTG 0: 32
1: 1196
2: 16048
3: 56759
4: 125615
Right 1103502637 12:121415372-121415394 GCACTTCAGGAGGCCAAGGTAGG 0: 188
1: 2287
2: 37127
3: 142975
4: 244607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103502633 Original CRISPR CAAGTGTGAGCCACTATGCC AGG (reversed) Intronic
Too many off-targets to display for this crispr