ID: 1103502635

View in Genome Browser
Species Human (GRCh38)
Location 12:121415362-121415384
Sequence TGTAATCTGAGCACTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408379
Summary {0: 2, 1: 155, 2: 3376, 3: 38310, 4: 366536}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103502633_1103502635 -2 Left 1103502633 12:121415341-121415363 CCTGGCATAGTGGCTCACACTTG 0: 32
1: 1196
2: 16048
3: 56759
4: 125615
Right 1103502635 12:121415362-121415384 TGTAATCTGAGCACTTCAGGAGG 0: 2
1: 155
2: 3376
3: 38310
4: 366536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103502635 Original CRISPR TGTAATCTGAGCACTTCAGG AGG Intronic
Too many off-targets to display for this crispr