ID: 1103503609

View in Genome Browser
Species Human (GRCh38)
Location 12:121424980-121425002
Sequence GGAAGGGTTAAGAGCAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103503609_1103503617 16 Left 1103503609 12:121424980-121425002 CCAGAGTTGCTCTTAACCCTTCC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1103503617 12:121425019-121425041 TGAGAAACTTGGGCCAGGTGTGG 0: 1
1: 0
2: 12
3: 151
4: 987
1103503609_1103503615 6 Left 1103503609 12:121424980-121425002 CCAGAGTTGCTCTTAACCCTTCC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1103503615 12:121425009-121425031 ACATAAGAAATGAGAAACTTGGG 0: 1
1: 0
2: 2
3: 49
4: 609
1103503609_1103503614 5 Left 1103503609 12:121424980-121425002 CCAGAGTTGCTCTTAACCCTTCC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1103503614 12:121425008-121425030 CACATAAGAAATGAGAAACTTGG 0: 1
1: 0
2: 2
3: 46
4: 514
1103503609_1103503618 19 Left 1103503609 12:121424980-121425002 CCAGAGTTGCTCTTAACCCTTCC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1103503618 12:121425022-121425044 GAAACTTGGGCCAGGTGTGGTGG 0: 2
1: 16
2: 196
3: 1424
4: 8564
1103503609_1103503616 11 Left 1103503609 12:121424980-121425002 CCAGAGTTGCTCTTAACCCTTCC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1103503616 12:121425014-121425036 AGAAATGAGAAACTTGGGCCAGG 0: 1
1: 1
2: 13
3: 94
4: 775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103503609 Original CRISPR GGAAGGGTTAAGAGCAACTC TGG (reversed) Intronic
908323232 1:62998510-62998532 GGAAGGGAGAAGAGCTTCTCAGG + Intergenic
908471538 1:64448853-64448875 TGAAGGGTGAAGAGCAGCTGAGG - Intergenic
908535513 1:65073057-65073079 GGAAGGGTGAACAGGAACTGGGG - Intergenic
912723316 1:112038124-112038146 GGGAGGGTGAAGAACAAGTCTGG - Intergenic
913343442 1:117783233-117783255 GGTAGGATTAAGAAAAACTCTGG - Intergenic
913373740 1:118129111-118129133 GGAAGGGGTAAGAGCACAGCAGG + Intronic
913581576 1:120232623-120232645 GGAAGGTTTAGGAGCAATCCCGG - Intergenic
913626601 1:120665765-120665787 GGAAGGTTTAGGAGCAATCCCGG + Intergenic
914563508 1:148844070-148844092 GGAAGGTTTAGGAGCAATCCCGG - Intronic
914609319 1:149286155-149286177 GGAAGGTTTAGGAGCAATCCCGG + Intergenic
915009413 1:152671423-152671445 GGGAGTCTTAAGAGCAACACCGG - Intergenic
916608621 1:166367773-166367795 GCAAGGGGTAAGGGCAGCTCAGG - Intergenic
918307469 1:183260168-183260190 GGAAGTGGTATGCGCAACTCTGG + Intronic
918380859 1:183953726-183953748 GGAAGAGTTAACAGCTACTATGG - Intronic
919801986 1:201359678-201359700 GGAAGGACAAAGAGCAACGCTGG + Intronic
920704043 1:208238977-208238999 GCATGGGTTGTGAGCAACTCCGG - Intronic
920846162 1:209594822-209594844 GGAAGGATTAGGAGCAAACCTGG - Intronic
924692613 1:246365916-246365938 GGCAGGGTTCAGAGCAGCCCTGG - Intronic
1067162541 10:43839493-43839515 AGGAGCATTAAGAGCAACTCTGG - Intergenic
1070982755 10:80662922-80662944 GGACGGATTAAGAACAACGCTGG + Intergenic
1071893981 10:90044066-90044088 GAATGGGTTTAGAGCAACTCTGG + Intergenic
1072120910 10:92405024-92405046 GGAAGGGTGAAGATGAACTGAGG - Intergenic
1073465473 10:103692592-103692614 GGAAGGGTTAATAGAGACGCGGG - Intronic
1075043727 10:119129099-119129121 TTAAGGGTTCAGGGCAACTCAGG - Intronic
1075933114 10:126316107-126316129 GGAAGAGTTAAGAGCCCATCAGG - Intronic
1078023874 11:7676236-7676258 GAATAGGTTCAGAGCAACTCTGG - Intronic
1079420315 11:20280119-20280141 GAATAGGTTCAGAGCAACTCTGG + Intergenic
1081837081 11:46164805-46164827 GGAAGCAGTAAGAGGAACTCAGG - Intergenic
1088808104 11:113370078-113370100 GATGGGGTTCAGAGCAACTCAGG + Intronic
1090475153 11:127013625-127013647 GGAAGGGTTTAACGCAAGTCTGG + Intergenic
1090986770 11:131774078-131774100 GGAAGGTTTCAGAGCAATTTTGG - Intronic
1091938000 12:4448799-4448821 AGAAGGGTCAAGTGCAAATCTGG - Intergenic
1092977671 12:13761172-13761194 GGCAAGTTTAAGAGCCACTCTGG + Intronic
1098873336 12:75841026-75841048 GGAACGTTTAAGAGAAACTTAGG - Intergenic
1103449851 12:121020954-121020976 GGAAGGTTAAAGAGAAAATCCGG - Exonic
1103503609 12:121424980-121425002 GGAAGGGTTAAGAGCAACTCTGG - Intronic
1106122579 13:26872913-26872935 GGCAGGGAGATGAGCAACTCTGG - Intergenic
1113205188 13:107908595-107908617 TAAAGGGTTCAGAGAAACTCTGG - Intergenic
1114532518 14:23404637-23404659 GGGAGGGTTAGGGGTAACTCGGG + Intronic
1117954153 14:61109871-61109893 GGCAGGGTTCAGAGTAACTCAGG - Intergenic
1122034776 14:98939358-98939380 GGATGGTTTTAGAGCAACTGTGG - Intergenic
1202904650 14_GL000194v1_random:61102-61124 GGCAGGGCTAAGAGCACCCCAGG + Intergenic
1125390118 15:39183730-39183752 GAAGGGGTTAAGAGCAGCTCTGG - Intergenic
1125400645 15:39298913-39298935 AGAAAGGTTAAAAGGAACTCTGG - Intergenic
1129263475 15:74381845-74381867 GGAGGGGTCAAGAGTAACTTGGG - Intergenic
1135950836 16:26912692-26912714 GGCATGGTTAAGAGTAACTCAGG + Intergenic
1136034998 16:27532494-27532516 GGAAGGTTTCAGTGCAAGTCAGG - Intronic
1136086912 16:27891771-27891793 AGAAGGGTTAAGAGAATCTGAGG - Intronic
1139547007 16:67654102-67654124 GTCAGGGTTGAGTGCAACTCTGG - Intronic
1140388693 16:74565688-74565710 GGAAAGGTTGAGAACTACTCTGG - Intronic
1141910301 16:87053916-87053938 AGAAGAGTTCAGAGCATCTCAGG - Intergenic
1143476755 17:7207546-7207568 GGAAGGGACAAGAGCAAATGAGG + Intronic
1145878932 17:28340121-28340143 GGAAGGGTGAAGAGCAGCCATGG + Intronic
1147748337 17:42710015-42710037 GGGAGGGTTCTGAGAAACTCAGG + Intronic
1147966070 17:44194859-44194881 GGGAGGGTTCTGAGGAACTCAGG + Intronic
1151243928 17:72779821-72779843 GGCAGGGCTAAGAGCAAGCCTGG - Intronic
1151707205 17:75775514-75775536 GGAAGGGTGAAGAGGAAGACGGG - Intergenic
1155391490 18:25342201-25342223 GCAAGGGTTAAGAAGAACTGTGG - Intronic
1156890283 18:42183077-42183099 GAATGGGTTCAGAGAAACTCTGG - Intergenic
1159297660 18:66517026-66517048 GGAAGGCTTAGGAGCAAATTTGG + Intronic
1160808515 19:1002976-1002998 GGAAGGGTTTAGAGCAGGGCTGG + Intronic
1164710395 19:30353218-30353240 GGAAGGGATAAGAAAAATTCAGG + Intronic
1167757413 19:51421453-51421475 GGAAGGGCTGGGAGCAAGTCGGG - Intergenic
1168639334 19:58020309-58020331 GGAGGGGTGAGGAGCAGCTCAGG + Intergenic
926623442 2:15069392-15069414 TGAAGGGTTGAGAACAACACTGG - Intergenic
927208969 2:20627173-20627195 GGAAGGGTGGAGAGCCACCCCGG + Intronic
927325441 2:21800074-21800096 GGAAAGGTTTGGAGCAAATCTGG - Intergenic
934096954 2:88615494-88615516 GGAAGGGGCAAGGGCATCTCTGG - Intronic
936783536 2:116064015-116064037 GGTGGGGTTAAGAGCACCTGTGG + Intergenic
937669567 2:124523895-124523917 GGTAGAGTTAAGAGCAATTTTGG - Intronic
941221070 2:162782305-162782327 GGAAGGGTGAAGAGGAAGTAAGG + Intronic
943353186 2:186819759-186819781 TGAAGGGCTAAGAGAAATTCAGG + Intergenic
943472899 2:188317028-188317050 GGAAGGGTTAAGTGCAGGTGTGG - Intronic
946748544 2:222870026-222870048 GGCAGGGTTACAAACAACTCGGG - Intronic
947946941 2:234112533-234112555 GGAAGGGTGAACCGGAACTCAGG + Intergenic
948511292 2:238466883-238466905 AGAAGGCTTTAGAGCTACTCGGG - Intergenic
1171024218 20:21614145-21614167 GGAAGGTTTAAAAGAAAGTCAGG + Intergenic
1173640849 20:44600971-44600993 GGAAAGGATAAGAGCCCCTCGGG + Intronic
1173894527 20:46540818-46540840 GAATAGGTTCAGAGCAACTCTGG - Intergenic
1174107129 20:48170753-48170775 GGTAGGGTCAAGAGCATGTCTGG + Intergenic
1174120826 20:48264030-48264052 GGAAGGGCAAAGAGCATCCCGGG - Intergenic
1174191796 20:48745901-48745923 GGAAGGGTTAACAGCATCCCTGG - Intronic
1176268587 20:64223612-64223634 GGATGGGTCAAGAGCAGCGCAGG - Intronic
1176512224 21:7757509-7757531 GGATGGCTTAGAAGCAACTCAGG + Intronic
1176624020 21:9075869-9075891 GGCAGGGCTAAGAGCACCCCAGG + Intergenic
1177658685 21:24054131-24054153 GGAAGGTTTAGCAGCAACTTTGG + Intergenic
1177689136 21:24481251-24481273 GGCAGGGTTTAGGGTAACTCTGG - Intergenic
1178646336 21:34388033-34388055 GGATGGCTTAGAAGCAACTCAGG + Intronic
1182219870 22:28749728-28749750 TGTAGGGATAAGAGAAACTCAGG + Intronic
1182343279 22:29641873-29641895 AGAAGTGTCAAGAGCAGCTCTGG - Intronic
1182759526 22:32710995-32711017 AGAAGAGTGAAGAGCATCTCCGG - Intronic
1185208480 22:49553634-49553656 GGAAGGGACAAGAGCACCTCTGG - Intronic
951244426 3:20323898-20323920 GGATGGGAGAAGGGCAACTCTGG + Intergenic
952199544 3:31111886-31111908 GGATGGGTTAAGAGCAAGGTTGG - Intergenic
959576139 3:107936090-107936112 GGAAGGGTGAGGAGCATCTCGGG - Intergenic
959972972 3:112427712-112427734 TGGAGTGTTAAGGGCAACTCTGG + Intergenic
960941575 3:122938361-122938383 GGAAGGGTTGGGAGGAACTAGGG - Intronic
963168248 3:142226106-142226128 GCTAGGGTTAAGAGAAACGCTGG - Intergenic
964213026 3:154249105-154249127 GGAAGGTTAAAGAGCAACTAAGG + Intronic
965132968 3:164725175-164725197 TGAAGGGTTAAGATCCTCTCAGG + Intergenic
966619392 3:181947290-181947312 GGAAGGGTAGAGAGGAACACTGG + Intergenic
967184917 3:186936234-186936256 GGAAGGCTTCAGAGAAAATCTGG + Intronic
967844102 3:194030934-194030956 GGTGGGGTCAAGAGAAACTCTGG - Intergenic
968570579 4:1338383-1338405 GGAAGGGTTGGGGGCCACTCAGG - Intronic
969074248 4:4564894-4564916 GGAAAGGTTAAGAGAAAAGCTGG - Intergenic
970231215 4:13913233-13913255 GGAAGGGTAAAGAGCAGATGAGG - Intergenic
971520755 4:27547314-27547336 GGAAGCATTAAGAACAAATCTGG - Intergenic
979265614 4:118698638-118698660 GGAAGAGTTAAGGATAACTCAGG + Intronic
980211681 4:129796662-129796684 GGAAGGATAAAAATCAACTCAGG - Intergenic
986387069 5:7244916-7244938 GGAAAGGTTAAGTGCCTCTCAGG + Intergenic
987077532 5:14398080-14398102 GGAACAGTTAAAAGCAGCTCAGG - Intronic
991191012 5:63873760-63873782 GGAAGGGTTAATAGGACATCTGG - Intergenic
994416111 5:99473934-99473956 GGAAAGGTAAACAGCAACTGTGG - Intergenic
994463856 5:100101238-100101260 GGAAAGGTAAACAGCAACTGTGG + Intergenic
995036924 5:107544617-107544639 TGAAGGAATAAGAGCAATTCAGG + Intronic
997866133 5:137464542-137464564 AGATGGGTTGAGAGCAACTGAGG + Intronic
998399437 5:141840909-141840931 GGCAGGGTTAACAGCCACTGAGG + Intergenic
1003591475 6:7440793-7440815 GGAAGGGGGAAAAGCAACTTGGG - Intergenic
1004504255 6:16234945-16234967 TTAAGGGATAAGAGCAAATCTGG - Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1006263475 6:32895744-32895766 GGGAGGGTTAGGAGAAATTCTGG - Intergenic
1008936578 6:56999103-56999125 AGAAGGGTGGGGAGCAACTCAGG - Intronic
1010796888 6:80127088-80127110 GGAAGGGTAAAGATAAACTTTGG - Intronic
1013068109 6:106703268-106703290 GGATGGGCTAAGAGGAAGTCTGG - Intergenic
1016571171 6:145514728-145514750 GGAATGTTTAACAGCATCTCTGG - Intronic
1018963623 6:168466471-168466493 GGAAGGGTTGAGAGACACTTGGG + Intronic
1019758955 7:2794719-2794741 GGAAGGAGCAAGAGCCACTCAGG - Intronic
1021846244 7:24765633-24765655 GAATAGGTTCAGAGCAACTCTGG - Intergenic
1022237067 7:28472668-28472690 GGGAGGGTTAAAGGCATCTCAGG - Intronic
1022374987 7:29804871-29804893 GGAAAGGGCAAGAGGAACTCAGG + Intergenic
1022921786 7:35023193-35023215 GGAAGGGGTAAGAGCAGGTGGGG - Intronic
1023138670 7:37079550-37079572 AGATGGGTTAAGAGCAAGTAGGG - Intronic
1023329755 7:39102242-39102264 GAAAGGGGGAAGAGCAACTGGGG - Intronic
1024972633 7:55084840-55084862 TGAATGGCTAAGAGCATCTCAGG - Intronic
1028515350 7:91671920-91671942 GGAAGGGGTAGCAGCATCTCAGG - Intergenic
1032018799 7:128395303-128395325 AGAAGAGTCAACAGCAACTCCGG + Intronic
1033544247 7:142385705-142385727 GGAAGGGTTAAGAAAAATTAGGG + Intergenic
1033552439 7:142459719-142459741 GAAAGGGTTAAGAAAAATTCGGG + Intergenic
1037750774 8:21680788-21680810 GGAAGGGTTAAGAGGAGCCTCGG - Intergenic
1040460464 8:47642611-47642633 GGAAGGTTGAAAAGCAACTGTGG + Intronic
1040566072 8:48568799-48568821 TGAAGTGTTATGAGCAGCTCAGG + Intergenic
1040810163 8:51443256-51443278 GTAAGGGTTAGAAGCATCTCTGG + Intronic
1042598388 8:70473420-70473442 GAATAAGTTAAGAGCAACTCTGG - Intergenic
1045495258 8:102702656-102702678 GGAAGGGTTAGGAGTAAATTGGG + Intergenic
1047242736 8:123107643-123107665 GGAATGGTCATGAGCAACTTTGG + Intronic
1049119494 8:140721894-140721916 GCAAGAGTTAAGAGCAAGTTAGG - Intronic
1053146215 9:35713869-35713891 GGAAAGGTTTTGAGCAGCTCTGG + Intronic
1057156095 9:92841162-92841184 GACAGGGTTAAGAGCAAATGTGG - Intergenic
1057556412 9:96091791-96091813 GGAAGGGCAAAGAGGAACTAGGG - Intergenic
1059087723 9:111322004-111322026 GGAAGGGTAGAGAGTATCTCTGG - Intergenic
1061537584 9:131259404-131259426 GAGAGGGTTCAGAGCCACTCTGG - Exonic
1203747203 Un_GL000218v1:46297-46319 GGCAGGGCTAAGAGCACCCCAGG + Intergenic
1203562902 Un_KI270744v1:73183-73205 GGCAGGGCTAAGAGCACCCCAGG - Intergenic
1191901764 X:66047905-66047927 GGAAGAATTAAGAGCAAATAAGG + Intergenic
1194716047 X:97288020-97288042 GGAAGACTTAAAAGCAAATCTGG + Intronic
1198985700 X:142450471-142450493 GGAAGGGTTGAGGGCAAGGCTGG - Intergenic
1201160524 Y:11161292-11161314 GGCAGGGCTAAGAGCACCCCAGG + Intergenic