ID: 1103507778

View in Genome Browser
Species Human (GRCh38)
Location 12:121453286-121453308
Sequence GCCAACTTCACCGCGGAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103507768_1103507778 8 Left 1103507768 12:121453255-121453277 CCGCCGAGCTCCTGCCGTTGTCC 0: 1
1: 0
2: 1
3: 7
4: 135
Right 1103507778 12:121453286-121453308 GCCAACTTCACCGCGGAGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 61
1103507773_1103507778 -2 Left 1103507773 12:121453265-121453287 CCTGCCGTTGTCCGGTTGGCGGC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1103507778 12:121453286-121453308 GCCAACTTCACCGCGGAGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 61
1103507770_1103507778 5 Left 1103507770 12:121453258-121453280 CCGAGCTCCTGCCGTTGTCCGGT 0: 1
1: 0
2: 1
3: 4
4: 79
Right 1103507778 12:121453286-121453308 GCCAACTTCACCGCGGAGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 61
1103507767_1103507778 14 Left 1103507767 12:121453249-121453271 CCGGCGCCGCCGAGCTCCTGCCG 0: 1
1: 0
2: 2
3: 23
4: 167
Right 1103507778 12:121453286-121453308 GCCAACTTCACCGCGGAGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 61
1103507774_1103507778 -6 Left 1103507774 12:121453269-121453291 CCGTTGTCCGGTTGGCGGCCAAC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1103507778 12:121453286-121453308 GCCAACTTCACCGCGGAGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103507778 Original CRISPR GCCAACTTCACCGCGGAGGC CGG Exonic
903884216 1:26531553-26531575 GCCAGCTTCACCAGGGAGCCAGG + Intronic
920816726 1:209341301-209341323 GCCACCACCACCCCGGAGGCTGG - Intergenic
920861776 1:209714755-209714777 GGCATCTTCACCGGGGAGGAAGG + Intronic
922161563 1:223082227-223082249 GCCTGACTCACCGCGGAGGCAGG + Intergenic
1064254048 10:13729097-13729119 GCCTACTTGGCCGCGGGGGCGGG - Intronic
1068148379 10:53099921-53099943 GCAATCTTCACCACAGAGGCAGG - Intergenic
1074355990 10:112783752-112783774 GCCACCTTAACCCTGGAGGCAGG + Intronic
1076698943 10:132260349-132260371 GCCAACTGCACGGAAGAGGCAGG + Intronic
1076753599 10:132556120-132556142 GGCAACTTCAGCACGGGGGCTGG - Intronic
1077847124 11:6037877-6037899 GCCTACTTGACAGCGGAGGTTGG + Intergenic
1088623475 11:111710691-111710713 GCCAACTTCACAGTGAAGTCAGG - Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096650461 12:53059712-53059734 GCCAGCTTCTCCTCGCAGGCTGG - Exonic
1103507778 12:121453286-121453308 GCCAACTTCACCGCGGAGGCCGG + Exonic
1103997212 12:124838211-124838233 GCCAGCTTCACGGGTGAGGCCGG + Intronic
1110246479 13:73330704-73330726 GCCTACTTGACGGTGGAGGCTGG + Intergenic
1116796770 14:49399625-49399647 GCCTACTTAACGGCGGAGGGTGG + Intergenic
1128737444 15:70061207-70061229 GACAGCCTCACCGTGGAGGCGGG - Intronic
1134213222 16:12295321-12295343 GGCAACTTCTCCTGGGAGGCTGG - Intronic
1134492192 16:14703553-14703575 GCCATATTCCCCGCGGAGGCCGG + Intergenic
1134497573 16:14742675-14742697 GCCATATTCCCCGCGGAGGCCGG + Intronic
1135891031 16:26357651-26357673 GCCTACTTGACCGTGGAGGGTGG + Intergenic
1142038693 16:87878583-87878605 GCCAACTTCAAGGTGGTGGCAGG - Intergenic
1143336113 17:6172817-6172839 GCCAGCTTCACTGGGGAGGGGGG - Intergenic
1143509367 17:7387048-7387070 GCCAGCGTCACTGCCGAGGCTGG - Exonic
1145728925 17:27157862-27157884 CCCAAATTCACCGCGGATTCAGG + Intergenic
1147314696 17:39614044-39614066 GCCAACTTCCCGGAGGAGGAGGG - Intergenic
1148108855 17:45133161-45133183 GACAACTACACCGCGGGTGCCGG - Intronic
1148236665 17:45973750-45973772 TCCACCTTCACAGCAGAGGCAGG - Intronic
1157574921 18:48737123-48737145 GCCAACTTCTCCTTGGAGGAAGG - Intronic
1161393121 19:4031570-4031592 GCCAACTTGAGGGAGGAGGCTGG + Intronic
1164246957 19:23439045-23439067 GTCAACTTCACTGAGGAGGAAGG + Intergenic
1165479633 19:36054954-36054976 GCCATCGTCACGCCGGAGGCGGG - Exonic
1165957081 19:39507668-39507690 GCCAACTGCACCACGGAGATGGG - Intronic
925918717 2:8625029-8625051 CCCAACTTCTCCCCAGAGGCTGG + Intergenic
936083250 2:109449388-109449410 GCAAACCTCAACGGGGAGGCTGG + Exonic
936087982 2:109482521-109482543 GCCAAGTTCACCACGGTGTCAGG - Intronic
1174332409 20:49830698-49830720 GCCAACTTCACCTAGGAAGGAGG - Intronic
1175521497 20:59605099-59605121 GCCACCTCCTCCGCGGACGCCGG + Exonic
1183989479 22:41588728-41588750 GGCAACTTCACCACAGAGGATGG + Intronic
1185043531 22:48517732-48517754 GCCAGCCTCACCGCGGCTGCTGG - Intronic
961492655 3:127266180-127266202 GCCCACTTCACCGAGCAGACAGG + Intergenic
967827560 3:193890282-193890304 GCCAGGTTCACCGCGGAGAGGGG - Intergenic
968930049 4:3573947-3573969 GCCCACTTGAGGGCGGAGGCGGG + Intergenic
968950225 4:3687689-3687711 GCCATCTTCCCCGCGAAGCCAGG + Intergenic
969697753 4:8744697-8744719 GACAACCTCACCGTGGAGGTGGG - Intergenic
976496766 4:85739200-85739222 GCCTACTGCACCAGGGAGGCAGG - Intronic
980013600 4:127623291-127623313 TCCAGGTTCACCGCGGCGGCCGG + Intronic
983015084 4:162603524-162603546 GAAAACTTCACCGAGGTGGCTGG - Intergenic
986315215 5:6582670-6582692 GCCACCTGCACCTGGGAGGCTGG + Intergenic
986511157 5:8507576-8507598 GCCAACTTCAGCCAGGAAGCAGG + Intergenic
1018001064 6:159579086-159579108 GACAACTTCACCTCTGAGGAAGG - Intergenic
1018311163 6:162510481-162510503 GCCAGCTGCACCGAGGAAGCAGG + Intronic
1020194475 7:6026434-6026456 GCCAACCCCACAGCGAAGGCCGG - Intronic
1027146812 7:75701280-75701302 GCCACCTTAACGGCTGAGGCAGG + Intronic
1038709740 8:29932336-29932358 CCCAAGTTCACCCAGGAGGCGGG - Intergenic
1039150137 8:34495514-34495536 ACCAACTCCACAGGGGAGGCTGG - Intergenic
1045381533 8:101632222-101632244 GCCAACTTCCCATCAGAGGCTGG - Exonic
1047104811 8:121720453-121720475 GCCAGCTGCAGCGGGGAGGCGGG - Intergenic
1059797896 9:117719382-117719404 GTCCACTTCACCGCAGAAGCAGG + Intergenic
1060497730 9:124130471-124130493 GCCACCATCACAGCTGAGGCGGG + Intergenic
1185857573 X:3550249-3550271 CCCAACTTGACTCCGGAGGCAGG + Intergenic
1186426180 X:9465486-9465508 GCAAACTTCTGCGGGGAGGCGGG + Intronic
1199621388 X:149704833-149704855 GCCAACTCCACTGAGCAGGCTGG + Intronic