ID: 1103509713

View in Genome Browser
Species Human (GRCh38)
Location 12:121466564-121466586
Sequence TGCGAGCCGCGGGCCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 214}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103509713_1103509731 22 Left 1103509713 12:121466564-121466586 CCCGCGCCGGCCCGCGGCTCGCA 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103509731 12:121466609-121466631 CACGGCGGGCGGCGGGCGCGCGG 0: 1
1: 0
2: 7
3: 79
4: 595
1103509713_1103509724 8 Left 1103509713 12:121466564-121466586 CCCGCGCCGGCCCGCGGCTCGCA 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103509724 12:121466595-121466617 TGTCTCCGTCTGCCCACGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1103509713_1103509721 4 Left 1103509713 12:121466564-121466586 CCCGCGCCGGCCCGCGGCTCGCA 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103509721 12:121466591-121466613 TTCCTGTCTCCGTCTGCCCACGG 0: 1
1: 0
2: 5
3: 37
4: 284
1103509713_1103509723 7 Left 1103509713 12:121466564-121466586 CCCGCGCCGGCCCGCGGCTCGCA 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103509723 12:121466594-121466616 CTGTCTCCGTCTGCCCACGGCGG 0: 1
1: 0
2: 1
3: 15
4: 122
1103509713_1103509728 15 Left 1103509713 12:121466564-121466586 CCCGCGCCGGCCCGCGGCTCGCA 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103509728 12:121466602-121466624 GTCTGCCCACGGCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 9
4: 132
1103509713_1103509727 14 Left 1103509713 12:121466564-121466586 CCCGCGCCGGCCCGCGGCTCGCA 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103509727 12:121466601-121466623 CGTCTGCCCACGGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 105
1103509713_1103509725 11 Left 1103509713 12:121466564-121466586 CCCGCGCCGGCCCGCGGCTCGCA 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103509725 12:121466598-121466620 CTCCGTCTGCCCACGGCGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103509713 Original CRISPR TGCGAGCCGCGGGCCGGCGC GGG (reversed) Intronic
900174966 1:1287602-1287624 TGCCAGCCCCTGGCCGGTGCGGG + Intronic
900349556 1:2228175-2228197 GGCGGGCCGGGGGCCGGCGGCGG + Intergenic
901535940 1:9883103-9883125 TGGCAGCAGCGGGACGGCGCAGG + Intronic
901798030 1:11691761-11691783 GGCGAGCCGCGGAACGGGGCCGG - Exonic
903034596 1:20485836-20485858 TGCGAGCGGCGGGGCTGCGAGGG + Exonic
905995900 1:42380594-42380616 AGCGAGCCGCCGGCGGGCGCAGG - Intergenic
906214605 1:44031420-44031442 TGCGAGCGGCGCGGCGGGGCGGG - Intronic
906637160 1:47417142-47417164 AGCGGGCAGCGGGCCGGGGCCGG - Exonic
912174658 1:107141154-107141176 GGGGAGTGGCGGGCCGGCGCTGG + Intronic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
916414097 1:164576639-164576661 GGGGAGCCTCGGGCCGCCGCCGG - Intronic
917442430 1:175079419-175079441 TGCGAGCGGCTGGCCTGCCCCGG + Exonic
918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG + Exonic
920184594 1:204152087-204152109 AGCGGCCCGCGGGCCGGGGCGGG - Intergenic
920612387 1:207454420-207454442 TGGGCGCCGCGGGCCTGCTCGGG + Exonic
922116472 1:222618360-222618382 TGCGACCCCCGGGCCGGCCAGGG - Intronic
1062874162 10:931736-931758 CGCGAGGCGCGGGTCCGCGCGGG - Intergenic
1064274226 10:13891861-13891883 GGCGAGGGGCGGGCCGGCGGCGG - Intronic
1064645416 10:17454474-17454496 GGCGCTCCGCGGGCCGGGGCCGG - Intergenic
1071291834 10:84194492-84194514 TCCCAGCCGCGGGCGGGGGCAGG - Intergenic
1071600982 10:86958624-86958646 TGCGAGCTGCGGGCTTGAGCTGG - Intronic
1072021802 10:91410174-91410196 CGCGAGCCCCGGGCGGGCGGGGG + Intergenic
1073392845 10:103193324-103193346 CGCGAGCAGAGGGGCGGCGCGGG - Intergenic
1074772314 10:116742223-116742245 TGTGACCCGCGGGCCGTCTCCGG + Intronic
1075940770 10:126388600-126388622 AGCGAGCCGCGGCTCGGGGCGGG - Intergenic
1075999827 10:126905690-126905712 TGCGAGCGGGGCGGCGGCGCGGG - Intronic
1076374241 10:129972844-129972866 TGGGGGCCGCGGGCTGGGGCGGG + Intergenic
1076887137 10:133268042-133268064 TGCCAGCCGCGTGCCGGCCAAGG - Exonic
1077011155 11:379998-380020 TGCGCGCCGCGCGCCTGCCCCGG + Exonic
1077049554 11:560684-560706 TGCGGCCCGCGGGCAGGCGTCGG - Exonic
1077404615 11:2377504-2377526 TGCGGGGCGCGGGCCGGTCCTGG - Exonic
1083579087 11:63813535-63813557 GGCGAGCGGCGGGCGGGCGGCGG + Exonic
1083609676 11:63998924-63998946 GGCGGGCCGTGGGGCGGCGCGGG + Intronic
1083667893 11:64285406-64285428 GGCGAGGGGCGGGCCCGCGCGGG + Intronic
1083686641 11:64380488-64380510 GGGGAGCCGCGGGCAGGCACGGG + Intergenic
1084086305 11:66856905-66856927 CCCGAGGCCCGGGCCGGCGCGGG - Intronic
1084129178 11:67119742-67119764 CCCGAGCCCCGGGCCGGCCCCGG - Exonic
1084296036 11:68213790-68213812 TGCGGGACGCGGGCACGCGCGGG + Intronic
1089622234 11:119728728-119728750 TCCGGGCCCCGGGCCGCCGCCGG + Exonic
1090327779 11:125904188-125904210 GGCGGGCCGCGGGGCGGCGCGGG + Intronic
1090714594 11:129419128-129419150 TGCCAGGCGGGGGCCGGCCCTGG - Intronic
1091226010 11:133956800-133956822 CGCGAGGCGCGTGCGGGCGCGGG - Exonic
1092045948 12:5431993-5432015 GGCGCGGCGCGGGCCGGCGGGGG + Intergenic
1098596047 12:72273587-72273609 TTCGAGCCGCGCGCCGGGGTGGG - Intronic
1102644622 12:114396138-114396160 GGCGAGCCGCGGCCGGGGGCGGG + Intronic
1103509713 12:121466564-121466586 TGCGAGCCGCGGGCCGGCGCGGG - Intronic
1103534726 12:121626710-121626732 GCCGAGGCGCGGGCCGGCCCGGG - Exonic
1104049631 12:125186729-125186751 CGGGAGCCGCGGGCCGGGCCGGG + Intergenic
1104344479 12:127983470-127983492 TCCGAGCGGCCGGCCGGCGCTGG + Intergenic
1105557364 13:21459419-21459441 CGCGGGCCGCGGGCCGCCCCCGG + Intergenic
1111232570 13:85363151-85363173 TGGGAGGCGCGGGCGGGAGCCGG + Intergenic
1113874303 13:113584912-113584934 CGGGAGCCGCGGGCGGGAGCCGG + Intronic
1115566613 14:34630123-34630145 TCCGAGGCGAGGGCCGGCGCAGG + Exonic
1117722131 14:58638245-58638267 TGCTCGCCTCGGGCCGGCGCCGG - Exonic
1118030350 14:61812624-61812646 TGCTGGGCGCGGGGCGGCGCGGG + Intergenic
1119330190 14:73787467-73787489 TGCGATCCGGGGCCCCGCGCTGG + Intronic
1119731954 14:76956674-76956696 CGCCCGCCGCGGGCCGGGGCTGG + Intergenic
1121776189 14:96592689-96592711 ACTGAGCCGAGGGCCGGCGCGGG - Intergenic
1122066272 14:99176060-99176082 AGCGAGCTGCTGGCCGGCCCGGG + Exonic
1122779186 14:104136483-104136505 GGCGCGCCGCGGGGCGGCTCGGG - Intergenic
1122960971 14:105093511-105093533 CGCGGGCCGGGGGCGGGCGCTGG - Intergenic
1123037766 14:105478372-105478394 TGCGCGGCGCGGGCGGGGGCGGG + Intronic
1126626095 15:50686893-50686915 TGCGCGCCGCGCGCACGCGCTGG + Intergenic
1128322582 15:66703538-66703560 TCGGAGCCAGGGGCCGGCGCTGG + Exonic
1128482958 15:68054989-68055011 AGCGAGCCCCGGGCCGGCGTTGG + Intronic
1129162162 15:73752978-73753000 GGCGAGCGGCGGGCCGGGCCGGG + Intergenic
1130224258 15:82045727-82045749 GCCGAGCCGAGGGCCGGCGGGGG - Exonic
1132460761 16:53452-53474 TGGGACCCGAAGGCCGGCGCTGG - Intronic
1132630991 16:917379-917401 TGTGCGCTGCGGGCGGGCGCAGG + Intronic
1132630999 16:917425-917447 TGTGCGCTGCGGGCGGGCGCAGG + Intronic
1132631007 16:917471-917493 TGTGCGCTGCGGGCGGGCGCAGG + Intronic
1132721019 16:1315596-1315618 TGCCTGCCGCAGGCCGGCCCAGG - Intronic
1132950262 16:2557844-2557866 GCCGAGCCTCGGCCCGGCGCCGG + Exonic
1132964084 16:2642326-2642348 GCCGAGCCTCGGCCCGGCGCCGG - Intergenic
1136152978 16:28364501-28364523 GGCGACCCTCGGGCCGGCGGGGG + Intergenic
1136210105 16:28750772-28750794 GGCGACCCTCGGGCCGGCGGGGG - Intergenic
1140442638 16:74999303-74999325 GGCGAGCGGCGGGCGGGCGCGGG - Exonic
1140915078 16:79485827-79485849 TGCCAGCCGCTGGCCGCCCCTGG - Intergenic
1142179832 16:88662987-88663009 TGAGTGCCGCGGGCCGGCCTGGG - Intronic
1142271879 16:89094066-89094088 TGCGACCCAGGGGCGGGCGCCGG - Intronic
1142582589 17:951551-951573 TGCGAGCTGGGGGCGGGGGCGGG + Intronic
1145265110 17:21376305-21376327 TGCGCGGCGCGGCGCGGCGCGGG + Exonic
1146183316 17:30710246-30710268 TGCGCGCCGCGCGCCGGCCCCGG + Intergenic
1147000626 17:37359422-37359444 GGCGGGCCGCGGGCGGGCCCTGG + Intronic
1147757890 17:42780540-42780562 GGCGGGCCGCGGGGCGGCGACGG + Intergenic
1148150802 17:45395669-45395691 TGCGAACTGCGGGGAGGCGCTGG + Intronic
1148464721 17:47857957-47857979 TGAGATCCGAGGGCTGGCGCTGG - Intergenic
1148652614 17:49260558-49260580 AGCGAGCGGCGGGCAGGGGCCGG - Intergenic
1150488764 17:65560881-65560903 GCCGAGCCGGGGGCCGGGGCCGG - Intronic
1151370739 17:73644878-73644900 CGCCAGCCGCGGGGCGGCGGGGG + Intergenic
1151812546 17:76453020-76453042 TCCGAGGCGGGCGCCGGCGCCGG + Exonic
1151840660 17:76615181-76615203 TCAGAGCGGCTGGCCGGCGCTGG - Intergenic
1152048918 17:77958139-77958161 GGCGAGACGCGCGCCGGTGCGGG + Intergenic
1152349773 17:79778117-79778139 TGCGCGGGGCGGGCCGGCGCCGG + Exonic
1152362560 17:79839403-79839425 CGCGAGCCGGGAGCCGGGGCGGG - Exonic
1152617031 17:81342791-81342813 TGCGGGCCGCGGTGGGGCGCAGG - Intergenic
1152649250 17:81484360-81484382 TGCGAACCGGCGGCCGGAGCGGG - Intergenic
1152936536 17:83140429-83140451 TGAGGGCCGCGGGCCCTCGCTGG + Intergenic
1154475185 18:14748307-14748329 TGCGAGCCGGGGGCGGGTGCTGG + Exonic
1156502382 18:37567636-37567658 GGCTAGCCGAGGGCCGGCGGGGG - Intergenic
1157464336 18:47930904-47930926 TGCCAGCCCCGGGGCTGCGCCGG - Intronic
1160853596 19:1206166-1206188 TGGGGGTCGCGGGCCGGCTCGGG + Intronic
1160991976 19:1863774-1863796 TCCGAGCCGCGCGCGGCCGCCGG + Intergenic
1161309406 19:3585689-3585711 GACGAGGCGCGGGCGGGCGCGGG - Exonic
1161401513 19:4067707-4067729 TGCGGGCCGCGGGGCGGGACGGG + Intergenic
1161959548 19:7516194-7516216 GGGGAGCCGGCGGCCGGCGCGGG + Exonic
1162046848 19:8005644-8005666 TCCGGGCCGCGGGCCGGAGCGGG - Intronic
1162932039 19:13962258-13962280 CCTGAGCCCCGGGCCGGCGCAGG - Exonic
1163450981 19:17377335-17377357 TGCGAGGCGGGGGCCAGAGCAGG - Exonic
1163822097 19:19501915-19501937 TGCGGTCCGCTGGCCGGCCCAGG - Intronic
1163844133 19:19628859-19628881 TGGGAGCCCGGGGCCGCCGCAGG - Exonic
1164713422 19:30375237-30375259 TGGCAGCCGCGGGCCGGCGGGGG - Intronic
1165718613 19:38063264-38063286 TGGGAGCTGGGGGCCGGCGGGGG - Intronic
1165922464 19:39307615-39307637 TGTGAGCGGCGGGCGGGCGCCGG - Exonic
1166568468 19:43779300-43779322 TGGGAGCGGCGGGCAGGCCCCGG + Intronic
1166723642 19:45012121-45012143 TGCGGGCCCGGGCCCGGCGCTGG - Exonic
1167437194 19:49486345-49486367 CTGGAGCCCCGGGCCGGCGCTGG + Intergenic
1167622768 19:50568358-50568380 TCCGAGGCGGGGGCCGGGGCCGG - Intergenic
1168078487 19:53992921-53992943 GGGGGGCCGCGGGCCGGCGGCGG + Exonic
925730534 2:6917319-6917341 TCCGGGCCTCGGGCCGGCGCAGG + Intergenic
926077085 2:9950884-9950906 CGCGCGCCCCGGGCCGGCCCCGG - Intergenic
926141958 2:10373102-10373124 TGAGAGCTGCGAGCCGGGGCCGG + Intronic
927472110 2:23384915-23384937 GGCGAGCCGGGGGCCACCGCGGG + Intergenic
927751257 2:25673077-25673099 CGCGAGCGGGGGCCCGGCGCCGG - Intronic
935046724 2:99489791-99489813 AGCGACCCCCGGGCCGGCGGCGG - Intronic
935645334 2:105329677-105329699 CAGGAGCCGCGGGCCGGAGCGGG - Exonic
937221446 2:120345088-120345110 TCCGTGCCGCGGCCCGGCGCGGG + Intergenic
938368795 2:130756155-130756177 CGGGAGGGGCGGGCCGGCGCTGG - Intronic
940774936 2:157875866-157875888 GGCGCGGCGCGGGGCGGCGCGGG + Intergenic
944069935 2:195657348-195657370 TGCGAGTCCCGGGACGGCGTGGG + Intronic
948492247 2:238320895-238320917 TGCGGGTCGGGGGCCGGGGCTGG + Intronic
948645264 2:239400539-239400561 TGGGAGGCGGGGGCCAGCGCTGG - Exonic
948800310 2:240430423-240430445 TGTGTGCCGCCGGCCTGCGCTGG - Intergenic
1168777832 20:462512-462534 TGCGCGCCGCTGGCCGACGGAGG - Exonic
1169262517 20:4148996-4149018 TGAGAGCCGGGGCCCGGGGCCGG - Intronic
1171036229 20:21714682-21714704 TGCACCCCGCGGGCCGGCACTGG - Exonic
1171175653 20:23049513-23049535 GGCGCGCCGCGTGCAGGCGCCGG + Exonic
1173279749 20:41618011-41618033 TGCGGGCCGCGCGCAGGGGCGGG - Intronic
1174317492 20:49713845-49713867 TCCCAGCCGCCGGCCGTCGCGGG + Exonic
1176022073 20:62967055-62967077 TGGGAGCCACAGGCCGGCCCAGG - Intronic
1176058083 20:63159495-63159517 TGCTGGCCGGGGGCCGGGGCGGG + Intergenic
1176156911 20:63626704-63626726 TTGGCGCCGCGGGCGGGCGCGGG - Intronic
1179522529 21:41954180-41954202 CGCGGCCCGCGGGCAGGCGCCGG - Intergenic
1179675070 21:42975202-42975224 TGCGGGGCGCGCGGCGGCGCAGG + Intronic
1179775599 21:43659828-43659850 GGCGGGCCGGGGGCCGGGGCTGG + Intronic
1179965521 21:44802394-44802416 TTCGAGCCGCGGGCCCGAACAGG - Intergenic
1180736818 22:18023750-18023772 CGCGCGCCGCGGGCGGGTGCAGG + Intronic
1182445464 22:30387156-30387178 AGCGAGCCGGCGGCCGGGGCGGG - Exonic
1183590599 22:38777324-38777346 GGAGAGGCGGGGGCCGGCGCTGG - Intronic
1183736702 22:39648481-39648503 TGGGAGCAGTGAGCCGGCGCTGG + Intronic
1184337503 22:43862402-43862424 TGCGAGCCGGGAGGCGGCGGCGG - Exonic
1185397583 22:50600742-50600764 GGCGGGCCGAGCGCCGGCGCGGG + Exonic
953391508 3:42536373-42536395 TCCGAGCCCAGGGCCGGGGCTGG - Exonic
954795899 3:53161273-53161295 TCCGCGCGGCGGGCGGGCGCCGG - Exonic
955246272 3:57227811-57227833 TGCGGCGGGCGGGCCGGCGCGGG + Exonic
956761179 3:72446832-72446854 TGCAAGCCCCGGGCCCGGGCCGG + Exonic
956761227 3:72446962-72446984 GGGGAGCCGCGGGCCGGATCTGG + Intergenic
961182409 3:124887137-124887159 GGCGGGGCGCGGGCCAGCGCGGG - Exonic
962367409 3:134795613-134795635 TGCGGGCCGTCGGCCGGCGATGG + Exonic
963870316 3:150408759-150408781 CGGGAGCCGCGGGCCGGAGCTGG - Exonic
968092858 3:195909242-195909264 TGGGGGCCGCCGGACGGCGCGGG - Intronic
968506531 4:973591-973613 CGCGGGCCGCGGGGCGGGGCGGG + Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968737266 4:2303931-2303953 TGTGAGCCGCGTGCCTGTGCGGG - Intronic
968831352 4:2934322-2934344 CGCGGGGCGCGGGCCGGGGCTGG - Exonic
968891422 4:3371270-3371292 TGCCTGCCGCGGGCCGCCTCTGG + Intronic
972418715 4:38867644-38867666 TGCGAGGGCCGGGCCCGCGCTGG - Intergenic
974047347 4:56908612-56908634 GGAGGGCCGCGGGCCGGCGCGGG - Intronic
978207206 4:106092663-106092685 TGGGAGCAGCCGGCCGGCTCTGG - Intronic
978741906 4:112145940-112145962 CGCGACCCCGGGGCCGGCGCTGG - Intronic
979547126 4:121951430-121951452 TCCGAGGCGCGGGCCGCGGCCGG + Intronic
985497596 5:218424-218446 TCCGTGCCGCGGACCGGGGCGGG + Intronic
985737726 5:1594367-1594389 TCCGTGCCGCGGACCGGGGCGGG - Intergenic
985896392 5:2751919-2751941 CGCGAGCCGCGGGCTGGGGCCGG - Intergenic
999140454 5:149358073-149358095 GGCGAGCAGCGGGGCTGCGCGGG - Exonic
1002170314 5:177371039-177371061 TCCGGGCCGCGGGGCGGGGCGGG + Intronic
1002291709 5:178204913-178204935 GGCGAGTCGCCGGCCGGGGCTGG + Exonic
1002664043 5:180810066-180810088 TAGGAGCCGCGGCCCGCCGCGGG + Intronic
1002784504 6:391616-391638 TGCAAGCCGAGAGCCGGGGCCGG - Intergenic
1002926766 6:1609681-1609703 GGCGGGCCGGGCGCCGGCGCGGG + Intergenic
1002927832 6:1615004-1615026 TGGAGGCTGCGGGCCGGCGCGGG - Intergenic
1002929178 6:1621503-1621525 GGCGAGGAGCGGGTCGGCGCTGG - Intergenic
1003325117 6:5085256-5085278 TGCGGGCCTGGGGCCGGCTCCGG - Exonic
1003427354 6:6006627-6006649 TCCGCGCCTCGGGCCGGGGCAGG + Intronic
1003882564 6:10491641-10491663 GGAGAGCCGCGGGCGGGAGCCGG + Intergenic
1006334068 6:33411249-33411271 AGGGAGCCGGGGGTCGGCGCGGG + Intronic
1007701920 6:43770787-43770809 GGCGAGCCGCGGGCAGGGGCCGG + Exonic
1011518552 6:88179543-88179565 TGCGGGCCGGGGGCGGGGGCAGG - Intergenic
1011603594 6:89081389-89081411 CGGGAGCCGCGGGCCGCAGCGGG - Exonic
1013155735 6:107490051-107490073 GGCGGGCCGGGGGCCGGCGCGGG - Exonic
1013571348 6:111429723-111429745 GGCGAGCCGAGGGCGGGAGCGGG - Intronic
1015149232 6:130019869-130019891 CGCGGGCCGCGGGCCGGGCCGGG + Intronic
1018046317 6:159969283-159969305 TGCGGGCGGCGGGCGGGCGCGGG - Exonic
1019233032 6:170584581-170584603 TGCGGGGCGCGGGCTGGCGTGGG + Exonic
1020274339 7:6615613-6615635 TGCGGGCCGCTGGCCGGGCCGGG - Exonic
1022102981 7:27180186-27180208 GGCGGGCGGCGGGCGGGCGCGGG - Intronic
1022207889 7:28180612-28180634 TGCGAGCGCCGGGCGGGCGAGGG + Exonic
1022721209 7:32943087-32943109 GGCGAGTCGCGGGGCGGCGGCGG - Intergenic
1026458883 7:70596157-70596179 GGCGCTCCGCGGGCCGGGGCGGG + Intronic
1026968368 7:74454118-74454140 TCCTGGCCGCGGGCCGGGGCCGG + Exonic
1027250097 7:76393564-76393586 AGCGGGCTGCGGGCCTGCGCTGG - Exonic
1031887003 7:127253419-127253441 GGCGAGCCCGGGACCGGCGCGGG + Intergenic
1036664672 8:10730705-10730727 GGCGGGCCGGGGGCAGGCGCGGG - Intronic
1037481925 8:19313632-19313654 TGGGCGCGGCGGGGCGGCGCGGG + Exonic
1037901415 8:22691527-22691549 TGGGCGCCGCGGCCCGGAGCCGG - Intronic
1039947180 8:42140231-42140253 GGCGAGCTGCGGCCCGGGGCTGG - Intergenic
1040423434 8:47261039-47261061 GGGAAGCGGCGGGCCGGCGCGGG + Intronic
1043502882 8:80874060-80874082 TGCGGGCCGCGGCGCGGGGCCGG + Intronic
1046661212 8:116950006-116950028 TCGGAGCCGCCGGCCGGCCCGGG - Intergenic
1047454803 8:124998872-124998894 CGGGGGCTGCGGGCCGGCGCGGG - Exonic
1047961624 8:130015967-130015989 TGCGAGCCGGGTGTCGGTGCGGG - Intronic
1049109890 8:140635872-140635894 TGGGAACCGCGGGCGGGAGCGGG + Intergenic
1049352900 8:142173550-142173572 TGTGAGCCCCGGGCCAGCCCCGG + Intergenic
1049419094 8:142509084-142509106 TGTGAGCCGCTGGCTGGCGGGGG - Intronic
1049664669 8:143837601-143837623 TGTGAGCAGCAGGCCGGCCCGGG - Exonic
1049710492 8:144060892-144060914 GGCGAGCCCAGGCCCGGCGCCGG - Intronic
1051278983 9:15422769-15422791 GGCGAGCGGCGAGGCGGCGCGGG - Exonic
1053214348 9:36258297-36258319 TGAGAGCCGCGCGGCGGCGTGGG - Intronic
1056985673 9:91361936-91361958 TGCGCGCGGCAGGTCGGCGCCGG - Intergenic
1057432254 9:95004996-95005018 TGCGGACCCCGGGCGGGCGCAGG + Intronic
1057436870 9:95048601-95048623 TGGGAGCCGAGGGCAGGCGTGGG - Intronic
1059268840 9:113060240-113060262 TGCGTGCCGCCGGCGGGCCCCGG + Intergenic
1059269976 9:113065689-113065711 TGCGTGCCGCCGGCGGGCCCCGG + Intergenic
1059271110 9:113071137-113071159 TGCGTGCCGCCGGCGGGCCCCGG + Intergenic
1059272243 9:113076583-113076605 TGCGTGCCGCCGGCGGGCCCCGG + Intergenic
1059273378 9:113082025-113082047 TGCGTGCCGCCGGCGGGCCCCGG + Intergenic
1059274514 9:113087471-113087493 TGCGTGCCGCCGGCGGGCCCCGG + Intergenic
1061328123 9:129876240-129876262 TGCGTGCGGCGAGGCGGCGCGGG + Intronic
1062529080 9:136992125-136992147 TGCGCGGGGCGGGCCGGAGCAGG - Intergenic
1062574550 9:137200189-137200211 TGGGGGCCGCGGGCGGGGGCCGG + Exonic
1062591940 9:137278259-137278281 TGGGAGCCGCGGGCGGGGGCAGG + Intronic
1062596423 9:137301941-137301963 CGCGGGCCGCGGGCCGGGCCGGG + Exonic
1189336169 X:40172116-40172138 TGCGTGCCGCGGGTCGGTGTGGG - Intronic
1194663904 X:96656166-96656188 GGTGAGGCGCTGGCCGGCGCAGG - Intergenic
1198099855 X:133414567-133414589 TGCGAGCGGAGGGGCGCCGCCGG - Intronic
1198177615 X:134172176-134172198 TGCGAGGGGCGGGCCGGAGCTGG - Intergenic
1200057799 X:153470701-153470723 TGGGAGCCCGGGGCCCGCGCAGG - Intronic
1200093587 X:153647150-153647172 TCCGAGGGGCGGGCCGGGGCGGG - Intronic
1200163321 X:154019976-154019998 TGCGCGCCGCGGCCGCGCGCTGG + Exonic