ID: 1103509745

View in Genome Browser
Species Human (GRCh38)
Location 12:121466668-121466690
Sequence TCGGGGCTGGAGCGCTCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103509745_1103509759 21 Left 1103509745 12:121466668-121466690 CCCCGGGAGCGCTCCAGCCCCGA 0: 1
1: 0
2: 0
3: 15
4: 101
Right 1103509759 12:121466712-121466734 TTTGCGAACGCAGAGGCAGGAGG 0: 1
1: 0
2: 1
3: 51
4: 912
1103509745_1103509758 18 Left 1103509745 12:121466668-121466690 CCCCGGGAGCGCTCCAGCCCCGA 0: 1
1: 0
2: 0
3: 15
4: 101
Right 1103509758 12:121466709-121466731 AACTTTGCGAACGCAGAGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 226
1103509745_1103509757 14 Left 1103509745 12:121466668-121466690 CCCCGGGAGCGCTCCAGCCCCGA 0: 1
1: 0
2: 0
3: 15
4: 101
Right 1103509757 12:121466705-121466727 GCACAACTTTGCGAACGCAGAGG 0: 1
1: 0
2: 0
3: 3
4: 31
1103509745_1103509751 -8 Left 1103509745 12:121466668-121466690 CCCCGGGAGCGCTCCAGCCCCGA 0: 1
1: 0
2: 0
3: 15
4: 101
Right 1103509751 12:121466683-121466705 AGCCCCGAAGCCGAGGGTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 151
1103509745_1103509760 27 Left 1103509745 12:121466668-121466690 CCCCGGGAGCGCTCCAGCCCCGA 0: 1
1: 0
2: 0
3: 15
4: 101
Right 1103509760 12:121466718-121466740 AACGCAGAGGCAGGAGGTGCCGG 0: 1
1: 0
2: 5
3: 49
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103509745 Original CRISPR TCGGGGCTGGAGCGCTCCCG GGG (reversed) Intronic