ID: 1103509953

View in Genome Browser
Species Human (GRCh38)
Location 12:121467358-121467380
Sequence CGCGCCTCGCACGCCCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103509950_1103509953 -1 Left 1103509950 12:121467336-121467358 CCGCGAGGAGGGAGCCGCGCCGC 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1103509953 12:121467358-121467380 CGCGCCTCGCACGCCCGCGCTGG 0: 1
1: 0
2: 0
3: 17
4: 98
1103509949_1103509953 5 Left 1103509949 12:121467330-121467352 CCGCTGCCGCGAGGAGGGAGCCG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1103509953 12:121467358-121467380 CGCGCCTCGCACGCCCGCGCTGG 0: 1
1: 0
2: 0
3: 17
4: 98
1103509948_1103509953 6 Left 1103509948 12:121467329-121467351 CCCGCTGCCGCGAGGAGGGAGCC 0: 1
1: 0
2: 0
3: 23
4: 178
Right 1103509953 12:121467358-121467380 CGCGCCTCGCACGCCCGCGCTGG 0: 1
1: 0
2: 0
3: 17
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103509953 Original CRISPR CGCGCCTCGCACGCCCGCGC TGG Intronic