ID: 1103514111

View in Genome Browser
Species Human (GRCh38)
Location 12:121495708-121495730
Sequence ATGGCTCTATGAAGGCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103514111 Original CRISPR ATGGCTCTATGAAGGCATCA AGG (reversed) Intronic
900806388 1:4770667-4770689 ATGGCTGTGTGCAGGCAGCAAGG - Intronic
904006819 1:27367235-27367257 ATGGCTCTCTAGAGACATCAGGG + Intergenic
905117493 1:35654923-35654945 ATGGGACTATGAAGGCATTCAGG + Intergenic
905389437 1:37626734-37626756 AGGGCTCAATGAAGGAATGATGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
908858458 1:68455570-68455592 ATGGCACTAAGAAGCCAGCAGGG - Intergenic
913150018 1:116032429-116032451 AGGGCTCCATGCAGGCTTCATGG - Intronic
915695987 1:157742146-157742168 ATGGCTGTAGGTAGGCACCATGG + Intergenic
915696132 1:157744030-157744052 ATGGCTGTAGGTAGGCACCATGG - Intergenic
920825464 1:209420914-209420936 ATGGCTCCATGCAGGCCTCCCGG - Intergenic
923976630 1:239271473-239271495 ATGGCTTTATCAGGGGATCAGGG + Intergenic
924105370 1:240644174-240644196 AAGGCTCTCTGAAGGCATTCTGG - Intergenic
1070540249 10:77410423-77410445 TTGGCTCTAGGCAGGCAGCAGGG - Intronic
1070691729 10:78532110-78532132 CTGGCTGCATCAAGGCATCAAGG + Intergenic
1071768846 10:88701510-88701532 ATAGTTCTATCAAGTCATCAAGG - Intergenic
1073177684 10:101566383-101566405 ATGTCCCTATGCAGGGATCAAGG - Intergenic
1073651113 10:105359343-105359365 ATTTCTCTATGAAGGAGTCAGGG - Intergenic
1075251992 10:120887443-120887465 ATGGTTAAATGAAGGCATGAGGG + Intronic
1076915189 10:133419919-133419941 GAGGCTCCATGATGGCATCAGGG - Intronic
1077155577 11:1089456-1089478 CTGGCTCCATGAGGGCAGCACGG + Intergenic
1077227431 11:1444569-1444591 GTGGCTCTAGGAAGGAACCAAGG - Intronic
1078391793 11:10941179-10941201 ATGGCTTGTTGAAGTCATCAAGG - Intergenic
1080279330 11:30538745-30538767 ATTTCTCTTTGATGGCATCATGG - Intronic
1083023239 11:59528248-59528270 ATTGCTCTATGAATGTAGCAAGG + Intergenic
1087706740 11:101501969-101501991 CTGCCTCTATGAAGGTTTCAAGG - Intronic
1090468384 11:126955995-126956017 ATGGGTCCCTGAAGGCAACATGG - Intronic
1091119954 11:133048804-133048826 ATGGCTCTTTGAAGGTATTTAGG + Intronic
1091383178 12:76164-76186 ATGGGCCTATGAAGGCAGGAGGG + Intronic
1093262676 12:16958781-16958803 ATGGCTCTATCAAGGTATCATGG - Intergenic
1095391709 12:41714959-41714981 ATGGCTCCATGAAAGCATTCTGG + Intergenic
1097016938 12:55993917-55993939 ATGTCTCTGAGAAGCCATCAAGG + Exonic
1101366908 12:104080793-104080815 CTGGCTGTATGAAGGCTTCGTGG - Exonic
1103514111 12:121495708-121495730 ATGGCTCTATGAAGGCATCAAGG - Intronic
1105275745 13:18923364-18923386 GGGGTTCTATGGAGGCATCATGG - Intergenic
1107293220 13:38880741-38880763 ATGGCTCTGTGGGGGCACCATGG - Exonic
1108035730 13:46289016-46289038 GTGGATCTATGATGCCATCAGGG - Intergenic
1108375370 13:49809195-49809217 AAGGCTCTATGAAGACAGCAAGG - Intergenic
1116493076 14:45528377-45528399 ATGTCTTTATGAAGGCATTTAGG - Intergenic
1118543807 14:66861747-66861769 ATGGGTCAATGAAGGAATTAAGG + Intronic
1119996092 14:79255241-79255263 ATGCCTCTATGACGGCACTATGG - Intronic
1121070017 14:91010419-91010441 ATGGCTCTATGAAATCTCCATGG - Intronic
1121820738 14:96964077-96964099 ATGGTTCTGTCAAGACATCAGGG + Intergenic
1125491223 15:40150019-40150041 CTGGCTTTATGACAGCATCATGG - Intergenic
1125711392 15:41789858-41789880 ATGCCTTTGTGCAGGCATCAGGG - Intronic
1125765391 15:42132096-42132118 AGGGATCTATGAAGGCATCCAGG + Intergenic
1125885783 15:43228520-43228542 ATATCTCTTTGAAGGCATCAAGG + Intergenic
1129230239 15:74193066-74193088 ATGGATGGATGAATGCATCATGG - Intronic
1131078587 15:89515038-89515060 CTGGCCCTATGATGGCAGCAGGG - Intergenic
1132139890 15:99383655-99383677 GTATATCTATGAAGGCATCAAGG + Intronic
1133244362 16:4437895-4437917 ATGGCACAATCATGGCATCATGG - Intronic
1133828591 16:9301260-9301282 ATGCCACTTTTAAGGCATCAGGG + Intergenic
1138227112 16:55305429-55305451 ATGGCTAAATGATGGCACCACGG - Intergenic
1139329356 16:66175525-66175547 CTGGCTCTGTGAAGGCAGCCAGG - Intergenic
1141061174 16:80872400-80872422 ATGGCTCAAAGAAGAAATCAGGG + Intergenic
1143040594 17:4033084-4033106 ATGGCTCTTTGAAGGCTTCTGGG - Intronic
1144036351 17:11369589-11369611 ATGGCTCTATTAAGAAATGAAGG - Intronic
1144431216 17:15193540-15193562 ATGCACCTATGAAGTCATCATGG + Intergenic
1146472094 17:33132711-33132733 CTGGCTTTATGCAGGCATCTTGG + Intronic
1150670155 17:67188124-67188146 GTGGCTCTGTGAAGAAATCAGGG + Intronic
1150850940 17:68703149-68703171 TTGGGTCTCTGATGGCATCATGG + Intergenic
1151131272 17:71899133-71899155 ATGGCTGAGTGAAGACATCAGGG + Intergenic
1152594658 17:81232367-81232389 GTGGCTGGCTGAAGGCATCATGG + Intronic
1154467365 18:14660488-14660510 GGGGTTCTATGGAGGCATCATGG - Intergenic
1161567083 19:5009219-5009241 ATGGCTCAATAAAGGAAGCAGGG - Intronic
1163579327 19:18128958-18128980 ATGGGTCTATGCAGGACTCAGGG - Intronic
1163908183 19:20166207-20166229 ATGCCTCAATGAATGCCTCAAGG + Intergenic
927218780 2:20687233-20687255 GTGGCTCTCTCAAGGCAGCAAGG + Intronic
933995197 2:87663035-87663057 ATGGCTCTATCAAGACTTCCTGG - Intergenic
936298663 2:111287878-111287900 ATGGCTCTATCAAGACTTCCTGG + Intergenic
938030009 2:127984267-127984289 TTGTCTTTCTGAAGGCATCACGG + Intronic
938081440 2:128372394-128372416 ATGGCTGCAAGGAGGCATCATGG - Intergenic
940058561 2:149539247-149539269 ATTGCTATAGGAAGGCAACAAGG - Intergenic
941676545 2:168348644-168348666 GTGGCTCTATTATGCCATCATGG + Intergenic
942888117 2:180953590-180953612 ATTGCTCTATTGAGGCATAATGG - Intergenic
943881932 2:193156721-193156743 AAGGCTCTTTGAAGGGATTAAGG - Intergenic
945782235 2:214190081-214190103 ATGTCTATATGCATGCATCAAGG - Intronic
946667644 2:222067530-222067552 ATGTCCCTATGAAAGCATAAAGG - Intergenic
1169854730 20:10090453-10090475 AGGGCTCAGTGATGGCATCAAGG - Intergenic
1174274127 20:49391233-49391255 ATGGCTCTATAAAGTCATCATGG - Intronic
1176282003 20:64318625-64318647 ATGGGCCTATGAAGGCAGGAGGG - Intergenic
1176807148 21:13497195-13497217 GGGGTTCTATGGAGGCATCATGG + Intergenic
1178701879 21:34840873-34840895 AAGGCTCTGTGAAGGCTTAAGGG - Intronic
1179060138 21:37972173-37972195 ATGGCTATATTCTGGCATCACGG + Intronic
1179447487 21:41442606-41442628 ATGGCTCTCTGTAGGCTTCTGGG - Intronic
1180112459 21:45668181-45668203 ATAGCTCTATGTATGCACCATGG + Intronic
1180579693 22:16820581-16820603 CTGACTCTGTGAAGGCATGAAGG + Intronic
1181753837 22:25008918-25008940 AAGGCTCCATGAATGCATCAGGG - Intronic
1182477986 22:30586973-30586995 AGGGCTCCATGAAGGCACGACGG - Intronic
1184144715 22:42602817-42602839 GTGGGTTTATGAAGGCAGCAGGG + Exonic
950770563 3:15307525-15307547 AGGGCTCTTAGAAGGAATCAAGG + Intronic
952033016 3:29167365-29167387 ATTGCTCTATGAAGTTATGATGG + Intergenic
956551444 3:70464470-70464492 CTTGATCTATGAAGGCATTAGGG + Intergenic
957894624 3:86405384-86405406 ATGGCTCTAGGAAGACAACCAGG + Intergenic
960894475 3:122488142-122488164 ATGGATCTAGGAAGGGACCATGG + Intronic
962493525 3:135917245-135917267 ATGCTTCTCTGTAGGCATCAGGG + Intergenic
964295933 3:155233155-155233177 ATGACTTTCTGATGGCATCAGGG + Intergenic
965420998 3:168457890-168457912 ATGGTACTATGAAGTCATAATGG - Intergenic
965685581 3:171298928-171298950 ATGGCTCCATCATGGCACCATGG + Intronic
966195140 3:177305767-177305789 ATAGCTCTATGAAGTAGTCATGG - Intergenic
967278842 3:187802946-187802968 ATGGCTCTATGAGGGGCCCAAGG + Intergenic
967791173 3:193550886-193550908 ATGGCTGAACGAAGGTATCATGG - Intronic
967952620 3:194852773-194852795 ATGGCCCAAGGAGGGCATCAGGG - Intergenic
969259831 4:6026211-6026233 TTGGCTCACTGAAGTCATCAAGG + Exonic
969890455 4:10255239-10255261 ATTTCTCCATGAAGGCCTCATGG - Intergenic
973547655 4:51998023-51998045 ATGTCTCTATGGAGGCAATATGG + Intronic
974708765 4:65559680-65559702 ATGGGTCTATGAAGATACCATGG + Intronic
974728228 4:65824856-65824878 AAGTTTCTATGAAGGCATCCTGG - Intergenic
979372726 4:119908312-119908334 CAGGCTCCATCAAGGCATCAAGG - Intergenic
979575684 4:122289545-122289567 ATGGCTATATGCTGGCAGCATGG + Intronic
983986343 4:174064633-174064655 TTGACTCTATGATGGCTTCAGGG + Intergenic
985125190 4:186686432-186686454 AGGGCTCAATGAAAGCATCTTGG + Intronic
985903355 5:2814191-2814213 ATGACTTTGTGAAAGCATCAAGG - Intergenic
986768990 5:10954805-10954827 ATGGAGCTATGAAGCCACCATGG + Intergenic
988445535 5:31282251-31282273 ATGTCTTTATGGAGGCTTCAGGG + Intronic
991398450 5:66228678-66228700 ATGGCACAAGGAAGGCATCTAGG - Intergenic
991416414 5:66397345-66397367 CTGGCTCCATGATGGCTTCATGG + Intergenic
991416415 5:66397351-66397373 GTGGTTCCATGAAGCCATCATGG - Intergenic
991464036 5:66891419-66891441 ATGGCTCTGGGAGGGCAACATGG - Intronic
994842384 5:104942071-104942093 ATACCTCTATGAAGGTATTAAGG + Intergenic
1001742495 5:174065435-174065457 AAGGCTGTATGAAGGCATTTAGG + Intronic
1006791050 6:36701519-36701541 TGGGCACTATGAGGGCATCAGGG + Intronic
1008804171 6:55407554-55407576 ATGGCTCAATGAAATCTTCAAGG + Intergenic
1012802245 6:103845751-103845773 ATGACTCCATGAAGTCATTATGG - Intergenic
1013162520 6:107559604-107559626 ATGGCTTTATCAGGGAATCATGG + Intronic
1014457261 6:121650321-121650343 ATGAATCAATGAGGGCATCAAGG - Intergenic
1021738198 7:23659684-23659706 TTGGATCAATGAATGCATCAGGG - Intergenic
1022760330 7:33342703-33342725 ATGGCTATAAGAAGACGTCATGG - Intronic
1022964457 7:35459486-35459508 GTGGCTCAATGATGCCATCAGGG + Intergenic
1025600502 7:62991496-62991518 ATGGCTCAATGAGGCCATAAGGG + Intergenic
1026513579 7:71047745-71047767 AAGGCTCTGAGAAGGCATCCAGG + Intergenic
1026587183 7:71665413-71665435 ATGGCTCTGTGGGGGCAGCATGG + Exonic
1027674885 7:81144722-81144744 ATGGGTCTATGAAGAAATTAAGG + Intergenic
1031873568 7:127113022-127113044 AAGGCTCAGTGAAGGCAACATGG - Intronic
1032110241 7:129069613-129069635 ATTGCTCTAGGAAGGCACCCAGG - Intergenic
1034738571 7:153452432-153452454 TGGGCTCTGTGGAGGCATCAGGG + Intergenic
1038843276 8:31205638-31205660 GTAGATCTATGAAGGCTTCATGG - Intergenic
1039012409 8:33109181-33109203 ATGGAACTATTAAGGCTTCAGGG - Intergenic
1043536142 8:81206709-81206731 ATGGATCTCTGAAGGTCTCATGG + Intergenic
1045767978 8:105698772-105698794 ATGGCTTTATGATTGCAACAAGG + Intronic
1046446793 8:114331623-114331645 ATATCTATATGAAGTCATCAAGG - Intergenic
1047500716 8:125438880-125438902 ACAGATCTCTGAAGGCATCATGG + Intergenic
1047573434 8:126127523-126127545 ATGACTCTCTGAAGGCTTCAGGG + Intergenic
1048814722 8:138321775-138321797 ATGGCTTTATGAAGGCACCTTGG + Intronic
1050560611 9:6831300-6831322 ATGGGTCTATAATGACATCATGG - Intronic
1055422382 9:76158249-76158271 GTGGCTCGATGAAGGTCTCAGGG + Intronic
1055708070 9:79030273-79030295 ATGGCTCTGTGATGTGATCATGG + Intergenic
1059591143 9:115663662-115663684 GTGGCTCAATGATGCCATCAAGG - Intergenic
1060884655 9:127142187-127142209 ATGCCTCTAAGAGGGCATTAGGG + Intronic
1186143020 X:6596879-6596901 ATGGCTCTTCAAAAGCATCAAGG - Intergenic
1186429243 X:9490296-9490318 AGGGCTCTAAGATGGAATCAAGG - Intronic
1190473691 X:50807806-50807828 AGGCCTCTATGAAGGCATCTGGG - Intronic
1196377952 X:115055557-115055579 ATGACGTTATGAAGGCATGAAGG - Intergenic
1196549841 X:117010720-117010742 ATGGCACTTTGAGGACATCAAGG + Intergenic
1199253787 X:145695400-145695422 ATGGCTCTATTAATGCACAATGG - Intergenic