ID: 1103515270

View in Genome Browser
Species Human (GRCh38)
Location 12:121503758-121503780
Sequence CTGAATTACTTTAAGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103515270_1103515275 17 Left 1103515270 12:121503758-121503780 CCTTGTTCCTTAAAGTAATTCAG 0: 1
1: 0
2: 0
3: 32
4: 246
Right 1103515275 12:121503798-121503820 GTTATGCCCATATCATAGTGAGG 0: 1
1: 0
2: 0
3: 1
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103515270 Original CRISPR CTGAATTACTTTAAGGAACA AGG (reversed) Intronic
901146456 1:7068106-7068128 CTAAATTACCTTAAAGAAGAAGG - Intronic
905754045 1:40492556-40492578 CAGAACAACTTTAAAGAACAAGG - Intronic
906813682 1:48855064-48855086 CTAAATTAAATTAAGGCACAGGG - Intronic
907642390 1:56204092-56204114 CAGAATGACTTTAAGGATGATGG + Intergenic
908351623 1:63291739-63291761 TTGAATTGCTATAAGGAATATGG + Intergenic
908414277 1:63897873-63897895 CTGAATGACTGTATGGAGCAGGG - Intronic
909627533 1:77734495-77734517 CCAAATTACATTAAGGACCACGG + Intronic
910208499 1:84771693-84771715 CTTAATTCCTTTATGGAACATGG + Intergenic
910269007 1:85372528-85372550 CTAAATTACTTTAAAAAATATGG + Intronic
910866530 1:91793230-91793252 CTGAAGAACTTTAAGGCACCTGG + Intronic
912191736 1:107348484-107348506 ATGAAATAATTTAAGGAAAATGG - Intronic
913301111 1:117369390-117369412 AAGAATTATTTTAAGAAACAAGG - Intronic
913417566 1:118628603-118628625 CTGAAAAACATAAAGGAACAAGG - Intergenic
914852346 1:151324442-151324464 CTGAGTTTCTATAAGGAAAAAGG - Intronic
916007404 1:160674980-160675002 ATGGCTTTCTTTAAGGAACAGGG - Intergenic
917856321 1:179103184-179103206 CTGAATTACTTCAGGAAACTAGG - Exonic
917984268 1:180298863-180298885 CTGAATAACTTAAAGGACAAGGG + Intronic
920629713 1:207639689-207639711 TTGGATTACTTAAAGGAATAAGG + Intronic
920639547 1:207738696-207738718 TTGGATTACTTAAAGGAATAAGG + Intergenic
921157264 1:212448342-212448364 CAGAATTTCTTTAAATAACAAGG + Intergenic
921574313 1:216816193-216816215 CTGGAGTACTGTATGGAACATGG + Intronic
921890684 1:220350778-220350800 CTGAATTAAATTAAGGAAAAAGG + Intergenic
922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG + Intergenic
923165698 1:231359438-231359460 ATGAATTAATTTAAGCTACAAGG - Intergenic
923690121 1:236184483-236184505 CTGGAATAATTTACGGAACAAGG - Intronic
924212623 1:241786459-241786481 CTGTATTACTTTAAACCACATGG + Intronic
1062907206 10:1187144-1187166 GTGAATCACTTGAAGGAAAAAGG - Intronic
1063029695 10:2221962-2221984 GTGAATTACTTCAAGCATCAAGG + Intergenic
1064227396 10:13499639-13499661 CTGAGTTACTTTAAAAGACAGGG - Intronic
1064441730 10:15359898-15359920 CTGAATTCCAAAAAGGAACATGG + Intronic
1065261285 10:23926163-23926185 CTGAATCTAATTAAGGAACAGGG - Intronic
1065653411 10:27919110-27919132 CTGAACTAATTTAAGGAAAATGG - Intronic
1067191050 10:44068719-44068741 CTGACTAACTTTAGGGAAGAAGG + Intergenic
1067894796 10:50167265-50167287 CTGAACTCCTCTTAGGAACAAGG - Intergenic
1067954042 10:50772997-50773019 CTGAACTCCTCTTAGGAACAAGG + Intronic
1068085693 10:52370806-52370828 ATAAATTACTTTGAGGAATATGG + Intergenic
1070629409 10:78074164-78074186 CTGCATGACTTTCAGCAACAAGG + Intergenic
1071960526 10:90805277-90805299 GTGGAGTCCTTTAAGGAACAGGG - Intronic
1072210841 10:93245803-93245825 CAGAAATAATTTAAAGAACAAGG - Intergenic
1072914460 10:99528996-99529018 CTGAATTGCTTTAAAAAAAATGG + Intergenic
1074130769 10:110572182-110572204 GTAAATAACTTTAAGGAAAAAGG - Intronic
1076449421 10:130546191-130546213 CTGAATTAATTAAAGCTACAGGG + Intergenic
1079896347 11:26123847-26123869 ATGAATTTCTCTAAGAAACAGGG + Intergenic
1080997666 11:37623723-37623745 CTGAATCACTTTAAAGAAGCAGG + Intergenic
1088770623 11:113032381-113032403 CTGAATGACTGTATGGAGCAGGG - Intronic
1095282608 12:40373435-40373457 CTGACTTTCTTTAAAGAAAATGG + Intergenic
1097432332 12:59525946-59525968 CTGAATTACTTGTATGATCAAGG - Intergenic
1097448401 12:59704923-59704945 CTGAATTTCTTTGAAGAATACGG - Exonic
1097462271 12:59876586-59876608 TTAAATTACTTGAAGCAACATGG - Intergenic
1097486673 12:60212375-60212397 CTGAATTTCTTTTTGGAAAATGG - Intergenic
1097603441 12:61723401-61723423 ATGAATTAATATAAGGAAAAAGG + Intronic
1101038314 12:100727460-100727482 CTATATTACTTTTAGGAAAAAGG - Intronic
1103414325 12:120733769-120733791 CTGTATTGCTTTAAGCCACAGGG - Intronic
1103515270 12:121503758-121503780 CTGAATTACTTTAAGGAACAAGG - Intronic
1105054651 12:133087063-133087085 CTGAATTATTTTAAGTAAACAGG + Intronic
1105322212 13:19337702-19337724 GTGAATTACAGTAAGGTACATGG + Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107852601 13:44586278-44586300 CTGAGTTACGGTAAGGAAAATGG - Intergenic
1108449282 13:50544821-50544843 CTGAAGTCCTTGAAGGAACTGGG + Intronic
1110163968 13:72414663-72414685 ATGAATTACTTTATGTGACATGG + Intergenic
1110972692 13:81786288-81786310 CTGAATTACTTTGAGCAGTACGG + Intergenic
1111150529 13:84248081-84248103 CTGAATTGCATTAAGAAACATGG + Intergenic
1111617360 13:90677260-90677282 CTGAATTACTATAATAAACAAGG + Intergenic
1112961243 13:105129548-105129570 ATGAATTACTTAAAGGAATTTGG + Intergenic
1113128101 13:107002987-107003009 CTTAATTCCTTTAATGACCAAGG + Intergenic
1113417189 13:110137450-110137472 TTGAATTTCTTTAAGTACCAAGG + Intergenic
1114488574 14:23080586-23080608 CTGAAAGAGTTTAAGGAAGAAGG - Exonic
1116521212 14:45849587-45849609 CTTAATTAGTTTGAGGAAAATGG + Intergenic
1116612056 14:47088127-47088149 ATAAATTATTTTAATGAACAAGG + Intronic
1117115943 14:52512317-52512339 CAAAAATACTATAAGGAACAAGG + Intronic
1117318818 14:54601033-54601055 ATGAAATACTCTAAGAAACAAGG - Intronic
1117370692 14:55075898-55075920 CTCAATTACTTTAGGAAACAGGG + Intergenic
1118018737 14:61689053-61689075 CTGGATTATTTTATGGAAAAGGG - Intergenic
1118463625 14:66010939-66010961 TTGAATAATTGTAAGGAACATGG - Intergenic
1120532558 14:85650267-85650289 ATGAATGAATTAAAGGAACATGG - Exonic
1121116985 14:91350778-91350800 CAGAATTACTCTATGGAATATGG - Intronic
1202888194 14_KI270722v1_random:128442-128464 CTTAATGGCTTAAAGGAACATGG - Intergenic
1123819050 15:24008346-24008368 CTGAAATATTTTAAAGAACAAGG - Intergenic
1123832220 15:24152014-24152036 CTGAAATATTTTGAAGAACAAGG + Intergenic
1123838126 15:24217262-24217284 CTGAAATATTTTGAAGAACAAGG - Intergenic
1123847677 15:24319561-24319583 CTGAAATATTTTGAAGAACAAGG - Intergenic
1123866720 15:24526942-24526964 CTGAAATATTTTGAAGAACAAGG - Intergenic
1124700033 15:31904634-31904656 CTGAATTACTTTGAGAGACCAGG - Intergenic
1124920088 15:34017319-34017341 CTGCTTAACTTTATGGAACAGGG - Intronic
1126865691 15:52934436-52934458 CTGAGTAACCTAAAGGAACAGGG - Intergenic
1127543698 15:59968890-59968912 ATGACTTTCTTTAAGGAAGAAGG + Intergenic
1127562511 15:60153277-60153299 TTGAATAACTATTAGGAACAAGG + Intergenic
1127602233 15:60549378-60549400 ATGAATTAATTTAAGAAACAAGG + Intronic
1130658766 15:85813310-85813332 CTGAACCACTTTAAATAACATGG - Intergenic
1131792033 15:95975370-95975392 CTGAATGACTCTGTGGAACAGGG + Intergenic
1135693762 16:24568114-24568136 ATGAATAACTTTAAGGGACAAGG - Intronic
1135803136 16:25517782-25517804 CTAAATTAGCTTAAGGAATAAGG - Intergenic
1136415430 16:30100337-30100359 CTGAATTTCCTAAGGGAACAAGG + Intergenic
1137227518 16:46528881-46528903 CTGTACTATTTTAAGGAAAAGGG - Intergenic
1137656429 16:50163288-50163310 GTGAATAACTTCAAAGAACAAGG - Intronic
1137902366 16:52282621-52282643 CTGTATGACTTTAAGGTACAAGG - Intergenic
1138638723 16:58365180-58365202 ATGCATTAATTTAAAGAACAAGG - Intronic
1140356398 16:74310573-74310595 CCTAATTACTTTAAGGACCATGG + Intergenic
1140929197 16:79611396-79611418 CTGAATTTGTTTAAGCAAAAAGG + Intergenic
1143985905 17:10913820-10913842 CTGAACTACTTGAAGGAAAAGGG + Intergenic
1145287440 17:21516795-21516817 CTGAGTTACAGAAAGGAACAGGG - Intergenic
1145390183 17:22449583-22449605 CTGAGTTACAGAAAGGAACAGGG + Intergenic
1146093394 17:29905060-29905082 ATTAATTACTTTAAGTAATATGG - Intronic
1146914944 17:36672391-36672413 GTTAATTACTTTAAATAACACGG - Intergenic
1148599395 17:48882633-48882655 CTGCATTAATTAAAGGTACATGG - Intergenic
1149791523 17:59481902-59481924 CTGAAATCCTTTCTGGAACAAGG - Intergenic
1150760952 17:67961114-67961136 CAGAATTTCTTTAAATAACAAGG + Intronic
1151011853 17:70508376-70508398 TAGAAGTATTTTAAGGAACATGG + Intergenic
1153111824 18:1599687-1599709 TTGAGTTATTTCAAGGAACATGG - Intergenic
1153463087 18:5358857-5358879 CTGAAGTATTTCTAGGAACAGGG + Intergenic
1153887111 18:9476362-9476384 CAGAATTACTTCAGGGAAGACGG - Intronic
1155643665 18:28050893-28050915 CTGAATTATCTTAATGATCATGG - Intronic
1155786311 18:29905664-29905686 CTTAACGCCTTTAAGGAACAAGG + Intergenic
1155965345 18:32030390-32030412 CTGAAATACTTTCAGGTAAATGG + Intronic
1156997101 18:43481900-43481922 TGGACTTACTGTAAGGAACATGG + Intergenic
1157192796 18:45595542-45595564 GTGAATTACTTGAAGTCACATGG + Intronic
1157761721 18:50270223-50270245 CTGAATTACTTAAAGCTGCAGGG + Intronic
1157962349 18:52169042-52169064 TTGAATTGCTTGAAGGAAAAGGG - Intergenic
1159712014 18:71772770-71772792 CTGAAATTCTTCAAGGTACAGGG + Intronic
1160091334 18:75829877-75829899 CTGCATGACTTTAAGGATAAAGG - Intergenic
1163397613 19:17073240-17073262 CAGGATCTCTTTAAGGAACATGG - Intronic
1165576076 19:36819817-36819839 CTGAATGAATTTAAAGAACTGGG - Exonic
1166578671 19:43870939-43870961 CTTAATTTCTTTAAGCAACTGGG + Intergenic
1202663590 1_KI270708v1_random:95237-95259 CTTAATGGCTTAAAGGAACATGG - Intergenic
925177012 2:1793183-1793205 CTGCATTTCTCTAAGGAAAAAGG + Intronic
925631925 2:5903227-5903249 CTAGATTACTTTAAGGAACCTGG + Intergenic
928073624 2:28242398-28242420 CTGACTTACTTAAGGAAACAGGG - Intronic
928132655 2:28664221-28664243 CTGAATTGCTGCAAGGAACATGG + Intergenic
928708511 2:33978236-33978258 CTGTATTACTTTTAGGTAGAGGG + Intergenic
929930975 2:46255206-46255228 CTGAATGAGTTTAAGAAATAAGG - Intergenic
933122622 2:78560242-78560264 CTGACTTACTTTCTGGAAAATGG - Intergenic
934733702 2:96676138-96676160 CTGAATTACTTTCAGGCAAATGG - Intergenic
936604632 2:113937679-113937701 CTGACTTATTTTCAGAAACAAGG - Intronic
939603869 2:144228364-144228386 CTGAATTACTTCTATAAACATGG + Intronic
939758873 2:146149812-146149834 CAGAAATACTTTGAGGAATAAGG + Intergenic
941539508 2:166765116-166765138 CTTAAATACTTTAAACAACAGGG - Intergenic
942439673 2:176019602-176019624 ATGAATGACTTTAAGGAAGGAGG + Intergenic
943144788 2:184029372-184029394 CATAATTACTTAGAGGAACAGGG - Intergenic
943737330 2:191371210-191371232 GTGAATTTCTTTAAGGAACCAGG + Intronic
947797026 2:232901174-232901196 CTGAACTGCCTTAAGTAACAGGG - Intronic
1169157012 20:3340264-3340286 TTGAAATACTTGAAGGAAAAAGG - Intronic
1170628607 20:18049034-18049056 CTGAATTAATTTCAAGACCAAGG - Intronic
1171040895 20:21762560-21762582 AGGAATTATTTTAAGGAAAAAGG - Intergenic
1172843938 20:37918595-37918617 CTGAATTTATTTAAGTAAAAGGG + Intronic
1172860614 20:38047474-38047496 CTGAATGACTTTAAACAAGAAGG - Intronic
1177010293 21:15724126-15724148 CTGGAATACTTTAAGGCACAAGG - Intergenic
1178886845 21:36491605-36491627 CTGAAATCCTTTTTGGAACAAGG + Intronic
1180330323 22:11472118-11472140 CTTAATGCCTTAAAGGAACATGG - Intergenic
1182019404 22:27068267-27068289 CTGAATGACTGTATGAAACAAGG + Intergenic
1182777009 22:32838691-32838713 CTGAGTAACTCTATGGAACAAGG + Intronic
1184522782 22:45005557-45005579 CTCAGTTACTTTAAGAAACATGG - Intronic
950354073 3:12388763-12388785 ATGAATTATTTAAAGGAAGAGGG + Intronic
950906629 3:16544794-16544816 CTGAACTCCTTTAAGGCTCAGGG + Intergenic
951803005 3:26617643-26617665 TTGAATGACTTTAAGTAAAAAGG + Intergenic
951814292 3:26736428-26736450 TAGAATTACTATAAGGGACAAGG - Intergenic
952766225 3:36956611-36956633 CTGAAATATTGTCAGGAACAGGG - Intergenic
952833610 3:37585816-37585838 CTGAATGAGTTTAAGAACCATGG + Intronic
955954422 3:64274110-64274132 CTGGGTTACTTTAAGAATCAAGG + Intronic
957441694 3:80256241-80256263 CTTAATTGATTTAAGGAAAATGG - Intergenic
957497142 3:81007159-81007181 CTGAACTATTTAAATGAACAAGG + Intergenic
957576452 3:82014601-82014623 CTGAATTATTTTGAGGGCCAGGG + Intergenic
959866996 3:111282277-111282299 CTGCATTACTGTGAGTAACAGGG - Intergenic
960053474 3:113259438-113259460 CTGGACTCCTTTAAGGAGCATGG + Intronic
961145439 3:124589190-124589212 CTATATTAATTTAAGGACCAAGG - Intronic
964037762 3:152219023-152219045 CTGAATTACTTTACATAAAATGG + Intergenic
964245362 3:154645904-154645926 TTGAATTATTTTAAGCAATAGGG + Intergenic
965463946 3:169003736-169003758 CTGACTTACTTGAGGAAACAAGG + Intergenic
965932801 3:174067932-174067954 CTATATTACTTTAAAGAACTAGG - Intronic
969115961 4:4871042-4871064 ATGAATTAATTTAAGGAAGCTGG - Intergenic
972652355 4:41030397-41030419 CTTTTTTACTTTAAGGGACAGGG + Intronic
973745992 4:53963827-53963849 CTCAAATGCTTTAAGTAACAAGG - Intronic
975491903 4:74998490-74998512 ATTAAATACTTTAAGTAACAAGG - Intronic
976607085 4:86994078-86994100 CAGCCTTACTTTAAGTAACAAGG + Intronic
976790195 4:88870087-88870109 TTTAGTTACTTTAAGGAAAAAGG - Intronic
977911617 4:102543818-102543840 CTCAATTACTTAAAACAACAGGG + Intronic
978214966 4:106188968-106188990 CTGCATTATTTTATGGAAAAGGG - Intronic
978892183 4:113843233-113843255 ATGAATTACTTTAAGGGAAAGGG - Intergenic
980667811 4:135961242-135961264 CTGAAATTCCTTAAGTAACATGG - Intergenic
983214252 4:164988124-164988146 CGGAAATACTTTCAGGAACATGG - Intergenic
985526616 5:406269-406291 CTGCATTTCTTGCAGGAACATGG + Intronic
986058713 5:4165852-4165874 TTGATTTACTATAAGGAATATGG - Intergenic
987199176 5:15557259-15557281 CTGAAATACATTCAGGCACAAGG + Intronic
988117977 5:26920852-26920874 CTCAAGTATTTGAAGGAACATGG - Intronic
989118883 5:37983576-37983598 CTGAATTCCTAAAAGGAACAGGG - Intergenic
989484541 5:41974284-41974306 CAGAAATACTTGAAGGAAAAAGG - Intergenic
991312853 5:65263851-65263873 ATGAATAACAATAAGGAACATGG + Intronic
992625667 5:78634013-78634035 CTGAATTACTTTATGGCTCCTGG - Intronic
993821196 5:92619041-92619063 ATAAATTACTTTAAGCAATATGG + Intergenic
994686897 5:102967089-102967111 CTGATGTACTTTCAGGAATATGG - Intronic
995815158 5:116158970-116158992 CTGGACTACATTAATGAACATGG - Intronic
996097026 5:119409705-119409727 CTGCATCACTTTGAGGAAAAGGG + Intergenic
998199049 5:140104167-140104189 CTGAATTACGTTTAAAAACAAGG + Intergenic
1000108300 5:158082038-158082060 CTGAACTACTTTTAGGTATAGGG + Intergenic
1000721143 5:164708925-164708947 TTGAATTTCTTTAAGTCACACGG + Intergenic
1002030143 5:176422193-176422215 CTGAATTAATTTAAAAAACACGG - Intergenic
1003818166 6:9864647-9864669 CTGAATTTGTTTCAGGATCAGGG + Intronic
1004484354 6:16051840-16051862 GTGAATCAATTTAAGGAACTAGG - Intergenic
1008002725 6:46377268-46377290 CTGAATTACTTTCTTGAACCAGG - Intronic
1008342077 6:50379343-50379365 CTGAATTAAATTAAGCAATAAGG + Intergenic
1009836272 6:69005332-69005354 CTGAGTTACCTTTAGGATCAAGG - Intronic
1010690842 6:78909701-78909723 ATGAATTACTTTAAGACACATGG + Intronic
1011499006 6:87967361-87967383 CTAAATTCCATTAAGGATCATGG - Intergenic
1012491851 6:99790944-99790966 CTAAAATAATTTAAGCAACAGGG - Intergenic
1013649988 6:112185097-112185119 TTGATTTATTTTAAGGCACATGG + Intronic
1014289950 6:119546870-119546892 CTGAATTTTTTTAAGAAAGAAGG + Intergenic
1014320228 6:119918800-119918822 CTGAAATCCTTTAACAAACAAGG + Intergenic
1014492875 6:122083272-122083294 GTGATATACTTTAAGAAACAAGG + Intergenic
1016694581 6:146977797-146977819 GTGAATTGCTTTAAAGAACATGG - Intergenic
1017840752 6:158220876-158220898 CTAAAATTGTTTAAGGAACAAGG + Intergenic
1018328413 6:162700050-162700072 CTAAATGATTTTAATGAACATGG - Intronic
1021878143 7:25067648-25067670 CAGAATTTCTTTAAATAACAAGG - Intergenic
1022488812 7:30800944-30800966 CTGAATTAAATTATGCAACAAGG - Intronic
1022773334 7:33498183-33498205 CTTAATTACCTTAAGGATGATGG - Intronic
1024515128 7:50243945-50243967 CTGAATTAAATTATTGAACAGGG - Intergenic
1026676216 7:72430777-72430799 CTGAAATCCTCTTAGGAACAGGG - Intronic
1027362175 7:77420781-77420803 CTGATTTAATCAAAGGAACAAGG + Intergenic
1027969940 7:85066477-85066499 CTGACTAACATTAGGGAACATGG - Intronic
1028439500 7:90843246-90843268 GTGAATTTTTTTAAGGAAAAAGG - Intronic
1028731521 7:94156577-94156599 CTCAAATCCTTTAAGTAACAAGG + Intergenic
1028971682 7:96866136-96866158 TTGGTTTACTTTAAGGAGCAAGG + Intergenic
1029991210 7:104964144-104964166 CTGAAGGTCTGTAAGGAACATGG - Intergenic
1030564522 7:111136532-111136554 CTGAATTGCTTTAAGGACATGGG - Intronic
1030604177 7:111621818-111621840 CTTAGTTACTTATAGGAACATGG - Intergenic
1033288329 7:140061363-140061385 CTGAATGACTGTATGGATCAAGG + Intronic
1033442494 7:141393000-141393022 ATTATTTACTTTAAGTAACAAGG - Intronic
1033674736 7:143529181-143529203 CTGCTTTAATTTAAGGAATAAGG - Intergenic
1033697100 7:143800258-143800280 CTGCTTTAATTTAAGGAATAAGG + Intergenic
1034355446 7:150447526-150447548 CTGAATTACTATAACAGACATGG + Intergenic
1038740665 8:30213789-30213811 CTGTATTTCTTTAAAGATCAAGG + Intergenic
1039797879 8:40930923-40930945 CATAATTACTTTAAGGGAAATGG - Intergenic
1045129609 8:99135073-99135095 CATAATTCCTTTAAGGCACATGG - Exonic
1046458294 8:114498550-114498572 CTGAATTGGTTTAATGAAGATGG + Intergenic
1046548479 8:115681867-115681889 TTGAATTATTTTAAGCAAGAGGG + Intronic
1047587301 8:126286883-126286905 CTCAAATACTTTTGGGAACATGG - Intergenic
1048888065 8:138924547-138924569 CTGGTTTTCTTTAGGGAACAGGG + Intergenic
1049016677 8:139924910-139924932 CTGAATGACTTTCATGAGCAGGG + Intronic
1050914893 9:11119157-11119179 ATGAATCAGTTTAAGTAACAAGG - Intergenic
1051322578 9:15924194-15924216 CTGAAATAAGTTAAGGGACAAGG + Intronic
1051710258 9:19924135-19924157 TACAATTTCTTTAAGGAACATGG + Intergenic
1052495684 9:29220604-29220626 CTGAATCATTTTAGGGAACATGG + Intergenic
1052662114 9:31446484-31446506 CTGAATTACTTTAAGTCATAAGG + Intergenic
1052792008 9:32884164-32884186 TTGAATTACTTTATGAAACAAGG + Intergenic
1053542510 9:38988992-38989014 CTGCATTAGTTTAAGCATCATGG + Intergenic
1053806963 9:41812509-41812531 CTGCATTAGTTTAAGCATCATGG + Intergenic
1054623629 9:67374918-67374940 CTGCATTAGTTTAAGCATCATGG - Intergenic
1056430002 9:86517974-86517996 CTCAAATTCTTTTAGGAACAGGG + Intergenic
1056498351 9:87183386-87183408 CTCAATTCCTTTAAATAACATGG + Intergenic
1056744978 9:89293087-89293109 GTGAATTACTTTCTGGAATATGG + Intergenic
1057311648 9:93946842-93946864 CTGAATTACTTTATCGATCCAGG - Intergenic
1057736565 9:97667522-97667544 CTGAAATACTGTAAGGTAAATGG + Intronic
1058477927 9:105359203-105359225 CTGTACTACTTTATGGAAAAAGG - Intronic
1061105751 9:128529075-128529097 CTGAAATTCTTTCTGGAACAGGG + Intronic
1061144926 9:128791960-128791982 CTGACTTTCTTCAAGGAACAGGG - Intronic
1061624526 9:131833909-131833931 CTGAATCACTGTATGGAGCAGGG + Intergenic
1186287720 X:8063966-8063988 CACACTTACTCTAAGGAACAGGG - Intergenic
1188846714 X:35081238-35081260 ATGAATTGCTTTAAGTATCAAGG + Intergenic
1190757325 X:53412356-53412378 GGGAATTACTTAAAAGAACATGG + Intronic
1193972244 X:88068855-88068877 CTGAATTACTTCCAGCATCATGG + Intergenic
1194421000 X:93672915-93672937 ATGAATTGCTTTTAAGAACAGGG + Exonic
1195413270 X:104592442-104592464 CTGAAGTACCTTCAGGAACATGG + Intronic
1195558926 X:106261207-106261229 GTGAAGTTCTTTGAGGAACAGGG + Intergenic
1197012451 X:121582772-121582794 TTGAATTTCTTTAAGAAAAAGGG + Intergenic
1197268588 X:124402003-124402025 ATTAATTATTTTAAGGAACAAGG + Intronic
1197270890 X:124423738-124423760 CTGAATTAGTTTTAGTAACCTGG - Intronic
1197595271 X:128456535-128456557 CTGTATGACTTTGAGCAACATGG - Intergenic
1198127857 X:133663981-133664003 CAGAATTTCTTTAAATAACAAGG - Intronic
1198890296 X:141387200-141387222 TTTAAATACTTTAAAGAACATGG - Intergenic
1200463305 Y:3484274-3484296 ATGAGTTATTTGAAGGAACATGG + Intergenic
1201327218 Y:12775029-12775051 CTGAAATACTCTAAGGTGCAAGG + Intronic
1201781999 Y:17733136-17733158 GTGAATTACTTTAAGCAGCATGG + Intergenic
1201819554 Y:18172853-18172875 GTGAATTACTTTAAGCAGCATGG - Intergenic
1201854434 Y:18525907-18525929 GTGAATTACTTTAAGCACTATGG - Intergenic
1201878887 Y:18794478-18794500 GTGAATTACTTTAAGCACTATGG + Intronic
1202173510 Y:22076061-22076083 GTGAATTACTTTAAGCAGTATGG + Intronic
1202217850 Y:22510322-22510344 GTGAATTACTTTAAGCAGTATGG - Intronic
1202325335 Y:23685737-23685759 GTGAATTACTTTAAGCAGTATGG + Intergenic
1202341780 Y:23876846-23876868 GTGAATTACTTTAAGCAGTATGG + Intergenic
1202528987 Y:25793240-25793262 GTGAATTACTTTAAGCAGTATGG - Intergenic
1202545436 Y:25984317-25984339 GTGAATTACTTTAAGCAGTATGG - Intergenic