ID: 1103518132

View in Genome Browser
Species Human (GRCh38)
Location 12:121520686-121520708
Sequence GGCAGGTCCCTGAAATCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 179}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103518123_1103518132 17 Left 1103518123 12:121520646-121520668 CCTAATCCCTCACACCACTTTCT 0: 1
1: 0
2: 0
3: 28
4: 284
Right 1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG 0: 1
1: 0
2: 3
3: 18
4: 179
1103518120_1103518132 20 Left 1103518120 12:121520643-121520665 CCCCCTAATCCCTCACACCACTT 0: 1
1: 0
2: 0
3: 19
4: 210
Right 1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG 0: 1
1: 0
2: 3
3: 18
4: 179
1103518128_1103518132 3 Left 1103518128 12:121520660-121520682 CCACTTTCTCCACGTGAGGAGGA 0: 1
1: 0
2: 2
3: 19
4: 185
Right 1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG 0: 1
1: 0
2: 3
3: 18
4: 179
1103518121_1103518132 19 Left 1103518121 12:121520644-121520666 CCCCTAATCCCTCACACCACTTT 0: 1
1: 0
2: 0
3: 30
4: 245
Right 1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG 0: 1
1: 0
2: 3
3: 18
4: 179
1103518124_1103518132 11 Left 1103518124 12:121520652-121520674 CCCTCACACCACTTTCTCCACGT 0: 1
1: 0
2: 2
3: 18
4: 202
Right 1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG 0: 1
1: 0
2: 3
3: 18
4: 179
1103518130_1103518132 -6 Left 1103518130 12:121520669-121520691 CCACGTGAGGAGGAAGAGGCAGG 0: 1
1: 0
2: 3
3: 57
4: 618
Right 1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG 0: 1
1: 0
2: 3
3: 18
4: 179
1103518122_1103518132 18 Left 1103518122 12:121520645-121520667 CCCTAATCCCTCACACCACTTTC 0: 1
1: 0
2: 1
3: 13
4: 243
Right 1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG 0: 1
1: 0
2: 3
3: 18
4: 179
1103518119_1103518132 26 Left 1103518119 12:121520637-121520659 CCAAATCCCCCTAATCCCTCACA 0: 1
1: 0
2: 0
3: 19
4: 259
Right 1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG 0: 1
1: 0
2: 3
3: 18
4: 179
1103518125_1103518132 10 Left 1103518125 12:121520653-121520675 CCTCACACCACTTTCTCCACGTG 0: 1
1: 0
2: 0
3: 21
4: 181
Right 1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG 0: 1
1: 0
2: 3
3: 18
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103518132 Original CRISPR GGCAGGTCCCTGAAATCTCA CGG Intronic
900568714 1:3347897-3347919 GCCAGGACCCTGAAGTCACAGGG - Intronic
901232578 1:7649441-7649463 GGCAGGTTCCTGGAATCTCCAGG + Intronic
902838882 1:19063090-19063112 GGCAGGTCCCTGAAGCCCCTGGG - Intergenic
903013599 1:20347812-20347834 GGCAGGCCCCTGAAATCCCAGGG - Intronic
903586297 1:24417856-24417878 GGCAGCTCTCTGAAGCCTCAGGG + Intronic
908890942 1:68847241-68847263 GACTGGTCTCTGGAATCTCACGG - Intergenic
911395297 1:97298933-97298955 GGCCAGACCCTTAAATCTCAGGG - Intronic
917335275 1:173919066-173919088 AGCATGTTCCTGAAACCTCAAGG - Intergenic
918518897 1:185392848-185392870 GGCACGCCCCTGTAATCCCAGGG - Intergenic
921314047 1:213874089-213874111 GGAAGGACCCTGCAATATCATGG + Intergenic
922824776 1:228510261-228510283 GGCAGGTCCCTGTCCTCACATGG - Intergenic
923724182 1:236492110-236492132 GGCAGGTCCCCGAAGCTTCATGG + Intergenic
924017156 1:239739719-239739741 GGCATGTCCCAGTCATCTCAGGG + Intronic
1063255283 10:4320782-4320804 GGCAGGTGCATGAATCCTCAGGG + Intergenic
1063484934 10:6410849-6410871 GGCGGGTGCCTGTAATCCCAGGG + Intergenic
1064168364 10:13006001-13006023 GGCAGGTCCCTGAATTTTTGTGG + Intronic
1065751408 10:28890987-28891009 GGCAGGGCCCTGAGAGCTGAGGG + Intergenic
1071575138 10:86719718-86719740 TGCAGATTCCTGTAATCTCACGG + Intronic
1071685099 10:87746247-87746269 GGCAGGTCCCAGATTTCTTAAGG + Exonic
1072728764 10:97830685-97830707 GGCAGATCCCTGGAATCCCAAGG - Intergenic
1073305917 10:102503548-102503570 AAAAGGTCCCTGAAATTTCAAGG - Intergenic
1073477111 10:103761628-103761650 GGCAGGTGGCTGGAACCTCACGG - Intronic
1074566346 10:114581764-114581786 GACAGGTCCCAGAACTTTCATGG - Intronic
1075394489 10:122117115-122117137 ATCAAGTCCCTCAAATCTCAGGG + Intronic
1075400475 10:122157985-122158007 GGCCAGTCCCCAAAATCTCAGGG - Intronic
1077256687 11:1587576-1587598 GGCACGTGCCTGTAATCCCAGGG - Intergenic
1078352070 11:10602940-10602962 GGCAGATCACTGAACCCTCAAGG - Intronic
1079123270 11:17699873-17699895 CTCAGGTCCCTGACCTCTCATGG - Intergenic
1080541191 11:33267242-33267264 GGCAGTTGCCTGTAATCTCAAGG - Intronic
1081710180 11:45211179-45211201 GACAGGTCTCTGGGATCTCAGGG + Intronic
1083181454 11:60988564-60988586 GGCCGGTCCCTGACACCCCAAGG + Intronic
1083270648 11:61570658-61570680 TGCAGGTCCCTGAGTTCCCAAGG + Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083364155 11:62131238-62131260 GGCAGGTCCTGGAAACTTCACGG + Intronic
1083487770 11:62994417-62994439 AGCAGGTCCCTGCACTCTCTGGG - Intronic
1084412530 11:69012934-69012956 GGCAGCTCCCAGAAATCCTAAGG - Intronic
1087301391 11:96440132-96440154 GGCAGGTCCAGGAAATCCAATGG - Intronic
1088993883 11:114978869-114978891 GGCAGGACCTTGAAAACACATGG - Intergenic
1089183993 11:116602579-116602601 AGCTGGTCCCTGAAGTCTAAGGG + Intergenic
1089673595 11:120073957-120073979 GGGACTTCCCTGAAGTCTCAGGG - Intergenic
1090902581 11:131045973-131045995 GGCAAGCCCCTGACATCTCCCGG + Intergenic
1091812379 12:3410145-3410167 GGCAGATGCCTCAAATTTCAAGG - Intronic
1091994775 12:4984818-4984840 GACAGGTCACTGAATTCTCTGGG - Intergenic
1094323939 12:29216096-29216118 AGCTGGTCTCTGAAACCTCATGG + Intronic
1094553979 12:31479747-31479769 GGGAGGTCACTGAAATTTTATGG - Exonic
1098586931 12:72165047-72165069 GGCAGCTCACTAAAAACTCAAGG + Intronic
1100796524 12:98187577-98187599 GGCAGGTACTCGAAGTCTCATGG - Intergenic
1103257895 12:119558454-119558476 GGCAGTTCACTCAAATCACATGG + Intergenic
1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG + Intronic
1103889633 12:124228694-124228716 GGCAGGTCCCTAAGACCTCTGGG + Intronic
1104762387 12:131305280-131305302 GGCAGGGGCCTGAGATCTCCGGG - Intergenic
1104817389 12:131655516-131655538 GGCAGGGGCCTGAGATCTCCAGG + Intergenic
1105068371 12:133218893-133218915 GGCTGCTCCCTGAAAACTCAAGG + Exonic
1105204623 13:18210272-18210294 GGCACGTGCCTGTAATCCCAGGG + Intergenic
1106225659 13:27784678-27784700 GGCAGCTCCTTGATCTCTCAGGG + Intergenic
1106423889 13:29607272-29607294 AGCAGGTCACTGAACTCTCTAGG + Intergenic
1107425459 13:40288471-40288493 GGCAGGCTCCTGTACTCTCATGG - Intergenic
1109933553 13:69248107-69248129 GCCAGGTATCTGAAAACTCAAGG + Intergenic
1113454041 13:110434821-110434843 GGCTGGTCCCTGAGATCCCCTGG - Intronic
1113482465 13:110631774-110631796 GGCAGGTACCTGAGACTTCATGG - Intronic
1114674459 14:24431077-24431099 GGAAAGTCCCTCAAAACTCAGGG - Intronic
1115559466 14:34570199-34570221 GGCACATGCCTGTAATCTCAAGG - Intronic
1115825946 14:37275972-37275994 TCCAGGTTCCTGATATCTCATGG + Intronic
1116704089 14:48274776-48274798 GGCAGGTACCTGTAATCCCAGGG + Intergenic
1120377678 14:83730159-83730181 GGAAGGTCCCCGAAATGTCCTGG + Intergenic
1120547075 14:85825280-85825302 GGAATGTCCCTGAAATTTGATGG + Intergenic
1121417671 14:93790020-93790042 GACAGGCCCCTGAATTCTTAGGG - Intergenic
1122827226 14:104376201-104376223 GGCAGCTCCCTGAAGGCACACGG - Intergenic
1124051738 15:26202692-26202714 TGCTGGACACTGAAATCTCAAGG - Intergenic
1125341983 15:38684393-38684415 GGCACTTCTCGGAAATCTCAAGG - Intergenic
1126758419 15:51946954-51946976 TGCAGGTCCCTGACATACCAAGG - Intronic
1127449962 15:59106465-59106487 GTCGGGACCCTGAACTCTCAGGG + Intronic
1130674127 15:85937394-85937416 ATCAGCTCCCTGAAATCTCAGGG - Intergenic
1132613116 16:827521-827543 AGCAGGTCCGTGAAATCCCTGGG - Intergenic
1133453601 16:5923452-5923474 AGCAGCTCCCTGAAGGCTCACGG + Intergenic
1133715187 16:8440870-8440892 GTCAGGTCCCTAAAACCTCATGG - Intergenic
1135010001 16:18867400-18867422 GGCGGGTGCCTGTAATCCCAGGG + Intronic
1140197644 16:72868537-72868559 GCCAGGTCCCCCAGATCTCAGGG + Intronic
1141031308 16:80591474-80591496 GGCAGGTGCGTGCAGTCTCAAGG - Intergenic
1141318490 16:82984085-82984107 GGCAGGTCACTTGAATCACATGG + Intronic
1141555463 16:84834096-84834118 GGCAGGTTCCTTAAATTCCATGG + Intronic
1142196863 16:88742999-88743021 AGCAGGTGCCTGAAATGCCAGGG - Intronic
1144629939 17:16865955-16865977 GGCAGGTCCCTGCCAGCTGAGGG - Intergenic
1144651491 17:17010162-17010184 GGCAGGTCCCTGCCAGCTGAGGG + Intergenic
1145873959 17:28301565-28301587 GGCACGTGCCTGTAATCCCAGGG - Intergenic
1152054005 17:78007635-78007657 GGCAGCACCCAGAAGTCTCAAGG + Intronic
1152169486 17:78734923-78734945 GGCAGGTCCCTGAGATCCCAGGG - Intronic
1152671887 17:81613286-81613308 AGTAGGACCCTGGAATCTCATGG + Intronic
1157453092 18:47802423-47802445 AGCAGATACCTGAAATATCAGGG + Intergenic
1157625893 18:49050879-49050901 GGCATGTCACTGACATCTTAAGG + Intronic
1157701926 18:49766750-49766772 GGCAGATCCGTGTGATCTCAGGG + Intergenic
1157727612 18:49976973-49976995 GGCAGGCCACTTAAATGTCAGGG - Intronic
1157814607 18:50721755-50721777 GGCAGGTGGCTGACATCTCTGGG - Intronic
1159013888 18:63085655-63085677 CTCATGTCCCTGAAATCTCCTGG - Intergenic
1160415345 18:78706081-78706103 GGCAGGTCCCTCACCTCTCTGGG - Intergenic
1161280857 19:3444771-3444793 GGCAGCTCCCTGCAAGCGCAGGG - Intronic
1161495167 19:4582368-4582390 GGAAGGTCTCTGAAACCTCTAGG - Intergenic
1161615380 19:5267244-5267266 CTCAGGTCCCTGGAATCTCCTGG + Intronic
1161842607 19:6692042-6692064 GGCAGGACCCAGGAATCTGAGGG - Intronic
1162819515 19:13214113-13214135 GGCAGGTCCCTGAAAAGTAGGGG - Intronic
1162910773 19:13847002-13847024 GCCAGGTGCCTGAAATCCCCGGG + Intergenic
1163237108 19:16036276-16036298 GGCAGGGCCTTGAAACCTCTGGG + Intergenic
1165376663 19:35447784-35447806 GGCAGGTGCCTGTCATCCCAGGG + Intronic
1166269831 19:41707122-41707144 GGCAGCTCCCTGTGATCTCCAGG + Intronic
926690551 2:15730516-15730538 GGGAACTCCCTGAAACCTCAGGG - Intronic
927217912 2:20679777-20679799 GGTAAGTCTCTGAAATCCCAAGG + Intergenic
932134984 2:69220496-69220518 GGCATTGCCCTGAAATCTCTGGG + Intronic
932419354 2:71592352-71592374 GGCAGTGCCCTCAAAGCTCAAGG - Intronic
932501108 2:72183404-72183426 GGCAGCTCCAGGAAATCTCAGGG - Intronic
933299408 2:80525334-80525356 GGCAGGTCCCGGAAGTCTTTGGG + Intronic
937840262 2:126518233-126518255 GGCAGCTACCTGAATTGTCATGG + Intergenic
938381710 2:130839827-130839849 GGCAGGTCCCTGTATTTTCATGG + Intronic
941675153 2:168336374-168336396 TGCAGGCCACTGAGATCTCAAGG - Intergenic
946941722 2:224776227-224776249 AGGAGGTCCCTCAAATCTCTGGG - Intronic
948566908 2:238893107-238893129 GCCAGGTCCCAGAAATCCCTGGG - Intronic
948868535 2:240786984-240787006 GGCAGGTGCCTCAGAGCTCAGGG - Intronic
948946665 2:241223994-241224016 GGCAGGGCCCTGTGACCTCAGGG - Intronic
1168891449 20:1297520-1297542 AGCAGCTCCCTGAAGTGTCAGGG + Intronic
1170391774 20:15882622-15882644 GGAAGGTCCCTCATATTTCAGGG + Intronic
1171142557 20:22755633-22755655 GGCATTTCCCTGTGATCTCAAGG + Intergenic
1172127222 20:32631927-32631949 CGCAGGTCCCTGCAATCTGGAGG + Intergenic
1172148119 20:32771507-32771529 GGCATGTGCCTGTAATCCCAAGG + Intronic
1172694487 20:36812822-36812844 GGCAGGTCCCTGAAGTCAGGTGG + Exonic
1178286083 21:31326597-31326619 GGCAAGTCCCTAGTATCTCAGGG + Intronic
1178452360 21:32714490-32714512 GGCAGTTGCATGGAATCTCAAGG + Intronic
1178980537 21:37260134-37260156 GGCATGTCCCTGAATTCTCTGGG + Intronic
1179934392 21:44592939-44592961 GGCAGGTCAATGAAGGCTCATGG - Intronic
1181656353 22:24303146-24303168 GGCAGGGCCCTGATAGATCATGG + Intronic
1183346902 22:37313036-37313058 GGCAGGTCCCTCCCATCTCTGGG - Intronic
1184005215 22:41702849-41702871 GGCAGGTGCCTGTAAACCCAGGG - Intronic
1184742927 22:46439570-46439592 GGCAAGTCCTTGAGAACTCAGGG - Intronic
949360208 3:3223710-3223732 GGCAGGTCCCCAAATTCTCTGGG + Intergenic
949460506 3:4288059-4288081 AGCAGGTGCCTGAACTCTCTGGG - Intronic
950687485 3:14628916-14628938 GGCTGGTGCCTGAACTCTCTTGG - Intergenic
951699325 3:25478901-25478923 GGCAGCACCCTGAAAACGCAAGG - Intronic
952295004 3:32053840-32053862 GGCATGTGCCTGTAATCTCAAGG + Intronic
953793265 3:45964656-45964678 GGCAGGTACCAGAATTCCCAGGG + Intronic
953906052 3:46868738-46868760 GGCATGGCCCTGACTTCTCAGGG + Intronic
954705380 3:52477692-52477714 GTCAGTCTCCTGAAATCTCAGGG - Intronic
956614390 3:71156588-71156610 GGCAGGACCCTGAACTCTCCAGG - Intronic
961028989 3:123585526-123585548 GGCTGGTCCCTGCAGCCTCAAGG - Intergenic
961683364 3:128613604-128613626 GGCAAGTCCCTGACCTCTCTGGG - Intergenic
965963690 3:174459236-174459258 TACAGGTCCATGAAATCTGATGG + Intronic
968888726 4:3353992-3354014 GGCAGGTCCCTGTAACACCAAGG - Intronic
969703938 4:8782012-8782034 GGCAGGTCACTGACCTCTCTGGG + Intergenic
976198574 4:82557858-82557880 GGCAGGTACCTGTAATCCCAGGG - Intronic
979054099 4:115975316-115975338 CGCAGATCCCTGAATGCTCAGGG - Intergenic
980660540 4:135852947-135852969 TGCAAGTCTCTGAAATCTCTTGG + Intergenic
982805205 4:159754921-159754943 GGAAGGTCTCTGAAATGTCTTGG - Intergenic
987277987 5:16382724-16382746 GGCATCTCCCTGATATCTCCAGG - Intergenic
990714298 5:58619458-58619480 GGAAGGTTCCTTAATTCTCAGGG + Intronic
991994980 5:72377977-72377999 GGAGGGCCCCTGTAATCTCAGGG - Intergenic
992615650 5:78543659-78543681 TGCAGGTCCCAGAAATCCCCAGG + Intronic
992971610 5:82065355-82065377 GGCAGGTGCCTGTAATCCTAGGG + Intronic
999394509 5:151218613-151218635 GGCTGCCCCCTGACATCTCAGGG - Intronic
1001415768 5:171544010-171544032 GGCAGGTCACTGCACTCTCTGGG + Intergenic
1002459944 5:179368358-179368380 GGCAGGTCCCTAAAATACCCAGG - Intergenic
1003040998 6:2687122-2687144 GGCAGGCCCCTGAATTTTCCTGG - Intronic
1005836277 6:29711832-29711854 GGAAGGACCCTGAAACCTCATGG + Intergenic
1007106285 6:39285359-39285381 CACATCTCCCTGAAATCTCATGG - Intergenic
1007375321 6:41452298-41452320 GGCAAGTCCTTGAACTCTCCTGG - Intergenic
1007566980 6:42858998-42859020 GGCAGGGACCTCTAATCTCAGGG + Intronic
1009966513 6:70584146-70584168 GGCAGGTGCCTGTAATCCCAGGG - Intronic
1012424121 6:99095618-99095640 TGGAGGGCCCTGAATTCTCAGGG + Intergenic
1012873383 6:104697445-104697467 GGAAGGCCCCTGACATCTGAGGG + Intergenic
1015832217 6:137383032-137383054 GGCACGTCAGTGAGATCTCAAGG - Intergenic
1017266168 6:152449153-152449175 GGCAGGTCACAGAAAGATCAGGG - Intronic
1019148744 6:169990590-169990612 GGCAGTTGCCTGCAATCTCCTGG + Intergenic
1019577479 7:1744479-1744501 GGGAGGTGCCTGCACTCTCAGGG - Exonic
1025020000 7:55473221-55473243 GGCAGGTCCCTGCCCTCTCGGGG + Intronic
1025611772 7:63080923-63080945 GGCAGGTCACTGACACCTCCTGG + Intergenic
1026083003 7:67238909-67238931 GGCTGCTCCATGAAATCTAAGGG - Exonic
1026682573 7:72478611-72478633 AGAAGGCCCCTGAGATCTCAGGG + Intergenic
1027969440 7:85059515-85059537 GACAGGACACTGAAATTTCAAGG - Intronic
1029677689 7:102081755-102081777 GGCAGGCGCCTGTAATCCCAGGG - Intronic
1031591634 7:123599551-123599573 GGCAGGTGCCTAAAATATGAAGG + Intronic
1034443026 7:151096914-151096936 GGCATGTGCCTGTAATCCCAAGG - Intronic
1036015107 8:4774323-4774345 GGCAGGTCTCTCAAAACTGAAGG + Intronic
1038706653 8:29900107-29900129 TGCAGGTCCATGAAATCTCCTGG - Intergenic
1041377369 8:57217490-57217512 AGCAGCTCCCCGAGATCTCAGGG - Intergenic
1044482523 8:92708727-92708749 TGCAGCTCCTTGAAAACTCATGG + Intergenic
1045801268 8:106104018-106104040 GGCGGGTCCCTGAATCTTCATGG + Intergenic
1046667352 8:117018789-117018811 GGCAGGCCCCTGTAGTCCCAGGG - Intronic
1048723717 8:137358012-137358034 GGAAGGACCCTGAAATACCATGG + Intergenic
1048846882 8:138610649-138610671 GGCATGGCCCTGAAATCCCAAGG - Intronic
1048988106 8:139746189-139746211 GGCAGTTCCCTGCTCTCTCATGG + Intronic
1049291779 8:141807076-141807098 GGCAGGTGTCTGAGGTCTCAGGG + Intergenic
1050021834 9:1292512-1292534 GGCAGCTTTTTGAAATCTCAGGG - Intergenic
1052940362 9:34127386-34127408 GGCAGGTCATGGAAATCTAAAGG - Intronic
1054833989 9:69657148-69657170 GGCAGGTCTCTTAGATCTCCCGG - Intronic
1056382315 9:86066319-86066341 GGCAGCTCCCTGAAACCACCTGG + Intronic
1056604688 9:88076795-88076817 GGCAGGGCCCTGGAAGCTCCAGG - Intergenic
1057874168 9:98740753-98740775 GGCAGGTCCTTTGAAACTCAGGG - Intronic
1059518241 9:114915524-114915546 AGCAGGTCACTGGCATCTCATGG + Intronic
1061988913 9:134147036-134147058 GCCAGGTCTCTGAAATCTGCAGG - Intronic
1189731482 X:44025531-44025553 GGCAGCTCCCTGAAATCACATGG - Intergenic
1189982450 X:46524562-46524584 GGCAGGTGCCTGTAATCCCAGGG + Intronic
1193657089 X:84211496-84211518 GGCATGTGCCTGTAATCCCAGGG - Intergenic
1193730342 X:85095439-85095461 GGCAGCTCCTTTAAATCTCCTGG - Intronic
1196645764 X:118116481-118116503 GGCAGGGTCCTGAAGTCACAGGG - Intronic
1196811110 X:119629606-119629628 TGCAGGACCCTGGAACCTCAGGG + Intronic