ID: 1103520945

View in Genome Browser
Species Human (GRCh38)
Location 12:121536902-121536924
Sequence TCGGGGTTGCGGGGAGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 498}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103520945_1103520957 16 Left 1103520945 12:121536902-121536924 CCTCCAGCTCCCCGCAACCCCGA 0: 1
1: 0
2: 4
3: 46
4: 498
Right 1103520957 12:121536941-121536963 AGAAAAGAATCGCTGCAAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 233
1103520945_1103520958 30 Left 1103520945 12:121536902-121536924 CCTCCAGCTCCCCGCAACCCCGA 0: 1
1: 0
2: 4
3: 46
4: 498
Right 1103520958 12:121536955-121536977 GCAAGCTGGCTGCAGTGTGCAGG 0: 1
1: 0
2: 1
3: 35
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103520945 Original CRISPR TCGGGGTTGCGGGGAGCTGG AGG (reversed) Intronic