ID: 1103525150

View in Genome Browser
Species Human (GRCh38)
Location 12:121562646-121562668
Sequence ATGGAGGAGGAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10312
Summary {0: 4, 1: 93, 2: 704, 3: 2356, 4: 7155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103525142_1103525150 4 Left 1103525142 12:121562619-121562641 CCCAGTAAATCTGTAAGGGAAGA 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG 0: 4
1: 93
2: 704
3: 2356
4: 7155
1103525139_1103525150 15 Left 1103525139 12:121562608-121562630 CCATACAGACACCCAGTAAATCT 0: 1
1: 0
2: 2
3: 14
4: 149
Right 1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG 0: 4
1: 93
2: 704
3: 2356
4: 7155
1103525143_1103525150 3 Left 1103525143 12:121562620-121562642 CCAGTAAATCTGTAAGGGAAGAA 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG 0: 4
1: 93
2: 704
3: 2356
4: 7155
1103525138_1103525150 27 Left 1103525138 12:121562596-121562618 CCAGGCTAGACACCATACAGACA 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG 0: 4
1: 93
2: 704
3: 2356
4: 7155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103525150 Original CRISPR ATGGAGGAGGAGGAGGAGGA AGG Intronic
Too many off-targets to display for this crispr