ID: 1103525793

View in Genome Browser
Species Human (GRCh38)
Location 12:121567316-121567338
Sequence ATGTAGCCATATTTGGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2645
Summary {0: 1, 1: 2, 2: 64, 3: 508, 4: 2070}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103525785_1103525793 30 Left 1103525785 12:121567263-121567285 CCTATAAGGTGTATATATTAATA 0: 1
1: 0
2: 3
3: 50
4: 384
Right 1103525793 12:121567316-121567338 ATGTAGCCATATTTGGAGATAGG 0: 1
1: 2
2: 64
3: 508
4: 2070
1103525790_1103525793 -10 Left 1103525790 12:121567303-121567325 CCAGCACCTCAGAATGTAGCCAT 0: 1
1: 2
2: 29
3: 155
4: 788
Right 1103525793 12:121567316-121567338 ATGTAGCCATATTTGGAGATAGG 0: 1
1: 2
2: 64
3: 508
4: 2070
1103525789_1103525793 -9 Left 1103525789 12:121567302-121567324 CCCAGCACCTCAGAATGTAGCCA 0: 1
1: 3
2: 31
3: 184
4: 899
Right 1103525793 12:121567316-121567338 ATGTAGCCATATTTGGAGATAGG 0: 1
1: 2
2: 64
3: 508
4: 2070
1103525788_1103525793 -8 Left 1103525788 12:121567301-121567323 CCCCAGCACCTCAGAATGTAGCC 0: 1
1: 6
2: 75
3: 392
4: 1243
Right 1103525793 12:121567316-121567338 ATGTAGCCATATTTGGAGATAGG 0: 1
1: 2
2: 64
3: 508
4: 2070
1103525786_1103525793 -2 Left 1103525786 12:121567295-121567317 CCTCACCCCCAGCACCTCAGAAT 0: 2
1: 30
2: 306
3: 976
4: 2044
Right 1103525793 12:121567316-121567338 ATGTAGCCATATTTGGAGATAGG 0: 1
1: 2
2: 64
3: 508
4: 2070
1103525787_1103525793 -7 Left 1103525787 12:121567300-121567322 CCCCCAGCACCTCAGAATGTAGC 0: 1
1: 7
2: 98
3: 529
4: 1210
Right 1103525793 12:121567316-121567338 ATGTAGCCATATTTGGAGATAGG 0: 1
1: 2
2: 64
3: 508
4: 2070

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103525793 Original CRISPR ATGTAGCCATATTTGGAGAT AGG Intronic
Too many off-targets to display for this crispr