ID: 1103532488

View in Genome Browser
Species Human (GRCh38)
Location 12:121612047-121612069
Sequence CTGTGAAAGGGGAATATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103532488_1103532498 -1 Left 1103532488 12:121612047-121612069 CCATCAATATTCCCCTTTCACAG No data
Right 1103532498 12:121612069-121612091 GATGGGGCTCAGAGAGGCTGGGG No data
1103532488_1103532497 -2 Left 1103532488 12:121612047-121612069 CCATCAATATTCCCCTTTCACAG No data
Right 1103532497 12:121612068-121612090 AGATGGGGCTCAGAGAGGCTGGG No data
1103532488_1103532499 15 Left 1103532488 12:121612047-121612069 CCATCAATATTCCCCTTTCACAG No data
Right 1103532499 12:121612085-121612107 GCTGGGGTGCTTGCCCAAAGTGG No data
1103532488_1103532495 -7 Left 1103532488 12:121612047-121612069 CCATCAATATTCCCCTTTCACAG No data
Right 1103532495 12:121612063-121612085 TTCACAGATGGGGCTCAGAGAGG No data
1103532488_1103532496 -3 Left 1103532488 12:121612047-121612069 CCATCAATATTCCCCTTTCACAG No data
Right 1103532496 12:121612067-121612089 CAGATGGGGCTCAGAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103532488 Original CRISPR CTGTGAAAGGGGAATATTGA TGG (reversed) Intergenic
No off target data available for this crispr