ID: 1103535776

View in Genome Browser
Species Human (GRCh38)
Location 12:121633038-121633060
Sequence GCATGGGAGGGCTGCCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103535770_1103535776 -7 Left 1103535770 12:121633022-121633044 CCTGAGGTCAGGCCCAGCATGGG 0: 1
1: 1
2: 7
3: 78
4: 680
Right 1103535776 12:121633038-121633060 GCATGGGAGGGCTGCCTCAGAGG 0: 1
1: 0
2: 2
3: 25
4: 233
1103535766_1103535776 16 Left 1103535766 12:121632999-121633021 CCAGGGGAAGGAAGGCTGTGGGA 0: 1
1: 1
2: 4
3: 63
4: 482
Right 1103535776 12:121633038-121633060 GCATGGGAGGGCTGCCTCAGAGG 0: 1
1: 0
2: 2
3: 25
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103535776 Original CRISPR GCATGGGAGGGCTGCCTCAG AGG Intronic
900093290 1:929849-929871 GCAGGGGAGGGCTGAGCCAGTGG + Intronic
900287012 1:1906682-1906704 GCATGGGGAGGGTGTCTCAGGGG + Intergenic
900469333 1:2845343-2845365 GCAAGGGAGGGTTCCCCCAGAGG - Intergenic
900981227 1:6047437-6047459 CTCTGGGAGGGCTGCCCCAGGGG - Intronic
901127286 1:6938478-6938500 GCAGGGGAGGGATGCGTCTGGGG + Intronic
901942397 1:12673314-12673336 GCATGGTAGGGGTGCATCACAGG - Intergenic
902708929 1:18225659-18225681 CCAGGGGAGGGCAGCCTCACTGG + Intronic
903166105 1:21521552-21521574 GCCTGGGAGGGATGCCCCACTGG + Intronic
904431613 1:30468155-30468177 GCGTGGAAGGGCTGACTTAGGGG - Intergenic
904684180 1:32248671-32248693 GAAAGGGAGGGGTGCCCCAGAGG + Exonic
905179767 1:36158159-36158181 GGCGGGGAGGGCTGCGTCAGGGG + Intronic
905632373 1:39525792-39525814 GGCTGGGCGGGCTGACTCAGTGG - Exonic
905944578 1:41890865-41890887 GAATGGGAGAGCTGCCTGAGTGG - Intronic
906515777 1:46438101-46438123 GCATGGGAGGCCTGTGTCACTGG - Intergenic
907457583 1:54585361-54585383 GCAGGGAAGGGATGCCTGAGGGG + Intronic
909197731 1:72648665-72648687 GCATGGGAGGGGAGGCTGAGGGG + Intergenic
914944673 1:152053414-152053436 GCATGAGAGGGCTGGGTGAGGGG + Intergenic
920060496 1:203223780-203223802 CACTGGGAGGGCTGCTTCAGAGG + Intronic
921097758 1:211901724-211901746 GCATGGGAGGGAAGCCTAGGTGG + Intergenic
921597131 1:217066526-217066548 CCATGGGAGGCCAGGCTCAGTGG - Intronic
923978313 1:239290345-239290367 GCATTTGAGTGCTGCCTCAGAGG - Intergenic
1065046986 10:21753910-21753932 GCATGGGGAGGCCTCCTCAGTGG + Intergenic
1067384267 10:45804376-45804398 GCATGTGAGGGGCTCCTCAGAGG - Intergenic
1067563053 10:47317419-47317441 GCATGGGAGGCCTGCCCTGGAGG + Intergenic
1068780677 10:60916294-60916316 CATTGGCAGGGCTGCCTCAGCGG - Intronic
1069608694 10:69757801-69757823 GTGTGGGATGGCTGTCTCAGGGG - Intergenic
1069830069 10:71277523-71277545 GCCTGGCAGGGAGGCCTCAGTGG + Intronic
1072332682 10:94369175-94369197 GCTGGGGAGCGCTGCCTTAGAGG - Intergenic
1077958609 11:7048789-7048811 GAATGGGAGGGTTGCATCAGTGG + Intronic
1078334938 11:10455807-10455829 CCTTGGGAGGGCTGCTTTAGGGG + Intronic
1079103005 11:17553045-17553067 GCCTGAGAGGGCTGCCTCCCTGG + Intronic
1079138239 11:17788601-17788623 GAATGGGAAGCATGCCTCAGGGG - Intronic
1081753422 11:45528110-45528132 GCAGGGTAGGGATGACTCAGTGG - Intergenic
1081782740 11:45724397-45724419 GCATGGGAGGGAGGAGTCAGTGG - Intergenic
1082965174 11:58959592-58959614 GCATTGGAAGGGTGCCTGAGCGG - Intronic
1083258979 11:61513081-61513103 GGATGGATGGGCTGCCTCTGCGG + Intergenic
1084009212 11:66338413-66338435 GCATGGGAGCTCTGCCTGGGTGG - Intronic
1084400912 11:68942426-68942448 ACATGGCAGGGCTACCTCAGGGG - Intergenic
1084731842 11:71078864-71078886 GCAGAGCAGGGCTGCCCCAGAGG - Intronic
1084903362 11:72327134-72327156 CCATGGAGGGGCTGCCTTAGAGG - Intronic
1085967373 11:81544119-81544141 GCCAGGGAGAGATGCCTCAGAGG + Intergenic
1086316419 11:85599138-85599160 TCATGGGAGGGAGGCCTCAAGGG - Intronic
1087363547 11:97191199-97191221 GAATGGGATGGCTGCCTCTAGGG - Intergenic
1088741719 11:112773075-112773097 GCATGGGTCTCCTGCCTCAGTGG - Intergenic
1090907754 11:131092029-131092051 GCAGGAGGGGGCTGCCTCAGTGG - Intergenic
1091585183 12:1811838-1811860 GGATGGGAGGACTGAGTCAGAGG + Intronic
1092217632 12:6694150-6694172 GGAAGGGAGGACTGGCTCAGGGG + Exonic
1096678042 12:53236219-53236241 GCATGGTAGAGCAGGCTCAGAGG - Intergenic
1096695455 12:53345528-53345550 GACTGGGAGGGCTGCCTAATTGG - Intergenic
1097493734 12:60301561-60301583 GCAAGGGAGGAATGCCTCAATGG + Intergenic
1098404248 12:70107715-70107737 GCATGGCTGGGAGGCCTCAGTGG + Intergenic
1101882287 12:108633756-108633778 GCATGGGACAGCTGCCTCGTGGG + Intronic
1103515562 12:121505951-121505973 GGGTGGGAGTGCTGCCACAGAGG - Intronic
1103535776 12:121633038-121633060 GCATGGGAGGGCTGCCTCAGAGG + Intronic
1103961123 12:124609888-124609910 GCCTGGGAGGCTAGCCTCAGAGG + Intergenic
1104356499 12:128091234-128091256 GCATGGGAGGCCAGCCCCAGGGG - Intergenic
1104409986 12:128549920-128549942 ACCTGGGAGGTCTGCCTCGGAGG + Intronic
1104771966 12:131369234-131369256 GCCTGGCAGGGCTGCCTCTGGGG - Intergenic
1104976283 12:132553352-132553374 CCTTGAGAGGGCTGGCTCAGTGG + Intronic
1106228082 13:27800010-27800032 GCAAGCCAGGGCTCCCTCAGGGG + Intergenic
1110456284 13:75693767-75693789 GCATGGGTGGCCTGGCTGAGAGG + Intronic
1113267458 13:108634909-108634931 AGAAGGGAGGGCTGCCTAAGGGG - Intronic
1113708920 13:112451724-112451746 GGCTGGCGGGGCTGCCTCAGGGG + Intergenic
1113914354 13:113861923-113861945 GGATGGGAGGGATGCCTCCCGGG + Intronic
1115484965 14:33901609-33901631 GCATGGGAGGGAAGCCTAGGGGG + Intergenic
1116313792 14:43360417-43360439 GCATGGGAGGGAGGCCAAAGTGG - Intergenic
1117554753 14:56872594-56872616 TCATGGCATGGCAGCCTCAGGGG + Intergenic
1119646045 14:76349250-76349272 GCATGCCAGGGCTCCCTCTGTGG + Intronic
1124436159 15:29651513-29651535 GCCTGGGAGGGCAGCTGCAGAGG - Intergenic
1124856153 15:33391248-33391270 GCATGAGAGTGAAGCCTCAGTGG - Intronic
1125343146 15:38694250-38694272 GGGTGGGTGGGCTACCTCAGAGG + Intergenic
1127788957 15:62381199-62381221 GCTGGGGAGGAGTGCCTCAGCGG + Intergenic
1127993057 15:64134814-64134836 CCCTGGCTGGGCTGCCTCAGTGG - Intronic
1128378631 15:67094876-67094898 GGATGGCAGGGCTGCATGAGGGG + Intronic
1128674054 15:69595842-69595864 GAAGGCCAGGGCTGCCTCAGGGG + Intergenic
1129069912 15:72942148-72942170 CCATGGAATGGCTGCCTGAGTGG + Intergenic
1129368052 15:75069096-75069118 GCAGGGAAGAGCAGCCTCAGGGG + Intronic
1129521230 15:76187470-76187492 GCTTGGGAGGGTTGCCTTATGGG + Intronic
1129524588 15:76205754-76205776 GCATGGGAGGACAGCCAGAGGGG - Intronic
1130461287 15:84159707-84159729 GCAGCGGCGGGCTGGCTCAGGGG - Intergenic
1131034826 15:89215263-89215285 GGATGGGATGGCTCCCTGAGGGG - Intronic
1131999344 15:98163491-98163513 GCACGGGAGGGAGGCCACAGGGG - Intergenic
1132790106 16:1681251-1681273 GCAGGGCTGGGCTGCCTCAAAGG - Intronic
1133277246 16:4646474-4646496 GCATGGAGGGGCTGCCTCCCTGG + Intronic
1133928249 16:10211205-10211227 AGATGGGTGGGGTGCCTCAGGGG + Intergenic
1134689934 16:16184647-16184669 CCAAGGGAGGGCTGGCTGAGAGG - Intronic
1135113937 16:19710379-19710401 GCAGGCTAGGGCTGCCTCTGGGG + Intronic
1135793369 16:25419146-25419168 GCAGAGCAGGGCTGCCTCATAGG + Intergenic
1136007287 16:27339769-27339791 GCATGGCTGGGCAGCCGCAGTGG + Intronic
1136994168 16:35176802-35176824 GGAAGGCAGGGCTCCCTCAGGGG - Intergenic
1137549435 16:49427285-49427307 GCTTGGCTGGGCTGCCTCTGTGG + Intergenic
1138586954 16:57976714-57976736 GCATGGGGAAGCTGCCTTAGGGG - Intronic
1139911033 16:70397894-70397916 CCATGGGGGGCCTGCCCCAGAGG - Intronic
1141432079 16:83975463-83975485 GGATGGATGGGATGCCTCAGGGG + Intronic
1143145081 17:4769998-4770020 GCAAGGAGGGGCTGCATCAGGGG + Intergenic
1146938643 17:36828200-36828222 GCATGGGAGGGCCACCTAAGGGG + Intergenic
1147052224 17:37803802-37803824 GCTTGGGAGGGCTGCCTCTCAGG + Intergenic
1148156299 17:45426936-45426958 GCATGAGAGTGCTGGCTCAGAGG - Intronic
1148456421 17:47813832-47813854 ACATGGCAGGGCGGCCCCAGGGG - Exonic
1150387963 17:64775557-64775579 GCATGAGAGTGCTGGCTCAGAGG - Intergenic
1150439554 17:65180100-65180122 GCATGCTGGGGCTGCCTGAGGGG - Intronic
1151673800 17:75588099-75588121 GCCCGGGAGGCCGGCCTCAGGGG + Intergenic
1155168629 18:23250573-23250595 GTCTTGGAGGGCTGCCACAGGGG + Intronic
1157315846 18:46589003-46589025 GCAGGGAAGGGCTGGCTAAGTGG + Intronic
1158285761 18:55880821-55880843 GCAAGGCAGGGCTGCCCCATAGG + Intergenic
1158389196 18:57030101-57030123 GCATGGGTTGGCTGCCTCTCGGG + Exonic
1158420563 18:57289286-57289308 GAATGGGAGGGATGGCTGAGGGG - Intergenic
1159973812 18:74685759-74685781 GCATGTGAGTGGAGCCTCAGAGG - Intronic
1160665302 19:325354-325376 GCAGGGCAGGGCTGGGTCAGAGG + Intronic
1162087604 19:8257983-8258005 CCATGGGAGGGCTGACTCACTGG - Exonic
1162568405 19:11457042-11457064 GCTGGGGAGGGGTGCATCAGGGG + Intronic
1162956420 19:14101078-14101100 GAAAGTGAGGGCTGGCTCAGAGG + Intronic
1163111800 19:15165825-15165847 GCAGGGGAGTGCGGCCTGAGTGG + Exonic
1163233319 19:16017878-16017900 TCATGGGAGGGGTCCCTCTGGGG + Intergenic
1164604060 19:29583244-29583266 GCATAGGAGGGCTGCAAAAGTGG + Intergenic
1166141087 19:40805673-40805695 GCATTGTAGGGCTGGGTCAGGGG + Intronic
1166369838 19:42294563-42294585 GCATGGCAAGGCTGCAGCAGCGG - Intronic
1166977083 19:46611047-46611069 GCATGATGGGCCTGCCTCAGAGG - Intergenic
1166994950 19:46715922-46715944 GCAGGGGTGGGGTGCCCCAGAGG - Intronic
1167853499 19:52219885-52219907 GCCAGGCAGTGCTGCCTCAGGGG + Intronic
1168725289 19:58577928-58577950 GCCTGGGAGGGCTCCAACAGAGG + Intergenic
925012516 2:496420-496442 ACAGGGGAGGGCTGCGTCTGGGG - Intergenic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
926976423 2:18520923-18520945 GCATGGGCAGGCTGGCCCAGAGG - Intergenic
926987464 2:18639961-18639983 GCAGGGGAGGGCTGCCACCTTGG - Intergenic
927684478 2:25161185-25161207 CCTTGGGCGGGCTGCCCCAGCGG + Exonic
928908759 2:36397007-36397029 GCCTAGGAGGGCTGGCACAGAGG - Intronic
933201144 2:79450348-79450370 GCATGGGAGGGTTGACTCAGTGG - Intronic
935336404 2:102021131-102021153 GCATGGCAGGACAGCCTGAGGGG - Intronic
936345120 2:111669847-111669869 CCAAGGGAGGGCTGAGTCAGGGG + Intergenic
937256584 2:120560359-120560381 GGCTGGGATGGCAGCCTCAGAGG + Intergenic
938065251 2:128278496-128278518 ACATGGCAGGGCTGCCTCAGAGG + Intronic
940460722 2:153959722-153959744 GTTTGGCAGGGCTGCCTCAGAGG + Intronic
943179483 2:184524822-184524844 GCATGGGAAGGCAGCCTAAGGGG - Intergenic
943442964 2:187948383-187948405 GCAGAGCAGGGCTGCCTCATAGG - Intergenic
943581935 2:189694357-189694379 GCATGGGAAGGGTACCTCATGGG + Intronic
945395172 2:209307557-209307579 GCATGGGAGGGAGGCCTAAGGGG - Intergenic
945968180 2:216210259-216210281 GCAGGGGAGGGCAGCTTTAGGGG + Intergenic
947796125 2:232895046-232895068 GCCTGGGATGGCTGCTGCAGGGG + Intronic
948434490 2:237943938-237943960 GCATGGGAGGGAAGCCAAAGGGG + Intergenic
948742596 2:240057405-240057427 GACTGGCCGGGCTGCCTCAGAGG - Intergenic
948763954 2:240210128-240210150 TCAGGGGAGAGCTGCCCCAGAGG - Intergenic
1169383172 20:5126681-5126703 GCATTGGACGGCAGCGTCAGGGG - Intergenic
1169387922 20:5166782-5166804 ACCTGGGAGAGCTGCTTCAGTGG + Intronic
1169710887 20:8562108-8562130 GTACGGAGGGGCTGCCTCAGTGG + Intronic
1170662803 20:18359238-18359260 GGATGGTAGGGCTTCCTCTGTGG - Intergenic
1171285966 20:23938253-23938275 GCATGGGAGGGCTGCTGGTGGGG + Intergenic
1172095894 20:32460375-32460397 GCATGCCGGGGCTGCCTGAGCGG - Intronic
1173192113 20:40884607-40884629 GATGGGGAGGGCAGCCTCAGAGG + Intergenic
1176090027 20:63314630-63314652 CCATGGGAAGGCTGCCTCGCCGG - Intronic
1176275797 20:64267956-64267978 GAATGGCAGGGCTGGATCAGAGG - Exonic
1176512420 21:7758869-7758891 GTATGGGAGGGCAGCCTATGAGG - Intronic
1178646532 21:34389393-34389415 GTATGGGAGGGCAGCCTATGAGG - Intronic
1179559944 21:42209184-42209206 GCATGGAGGAGCTGCCTCTGAGG + Intronic
1179723955 21:43331428-43331450 GGATGGGGGGACTGCCACAGAGG + Intergenic
1179960940 21:44766706-44766728 GCATGGGCCAGCTGCCTCGGGGG + Intergenic
1180061532 21:45387824-45387846 GCATGTGATGGCAGCCTCATGGG + Intergenic
1180117980 21:45724670-45724692 GCAAGGGTGGGGTGCCTCGGTGG + Intronic
1181363787 22:22358237-22358259 GCATGGGATGACAGCCTGAGTGG + Intergenic
1183271049 22:36862796-36862818 GATGGGGAGGGCTGCCTTAGGGG + Intronic
949300898 3:2582668-2582690 GCAAAGGAGGGCAGCCTCTGTGG + Intronic
950137212 3:10590059-10590081 CCATGGGAGGGATGCACCAGAGG - Intronic
951264761 3:20552645-20552667 GCATGGGAGGGAAGCCGAAGTGG - Intergenic
952853002 3:37744376-37744398 TCTGGGCAGGGCTGCCTCAGAGG + Intronic
953769138 3:45765455-45765477 ACAGGGGAGAGCTCCCTCAGGGG - Intronic
953972097 3:47355763-47355785 GGAGGGCATGGCTGCCTCAGAGG + Intergenic
954416576 3:50396195-50396217 GGGTGGGTGGCCTGCCTCAGAGG - Intronic
954863330 3:53708409-53708431 AAGTGGGAGGGCTGACTCAGGGG + Intronic
956065753 3:65395709-65395731 GCAAGGGAGGGTGGCCTGAGAGG + Intronic
957567755 3:81906704-81906726 GCTTGGAAGGTATGCCTCAGAGG - Intergenic
959128991 3:102328432-102328454 TCTTTGGAGGGCTGGCTCAGTGG - Intronic
960813894 3:121653762-121653784 CCATAGGATGTCTGCCTCAGTGG - Intronic
960870716 3:122247112-122247134 GCTTGGAAGGGCTGACTGAGTGG - Intronic
961814553 3:129542831-129542853 GGATTAGAGGGCCGCCTCAGCGG + Intergenic
963051491 3:141147462-141147484 ACTTGGGAGGGCTGCCTCGAGGG - Exonic
967650310 3:191977615-191977637 GCATTGGAGGACTGGCACAGTGG + Intergenic
968566559 4:1316566-1316588 GCATGGGAGGGAGGCCTGTGGGG - Intronic
969439099 4:7206919-7206941 CCATGGGAGGGCTTTCCCAGGGG + Intronic
969580539 4:8062098-8062120 GTGTGGGAGGGCTGCTCCAGTGG - Intronic
974016495 4:56653791-56653813 AAATGGGAGGACTGCCTGAGAGG + Intronic
977146392 4:93446253-93446275 GCATTGGAGGGCTGGCACAATGG - Intronic
978149406 4:105415342-105415364 GCATGGGAGGGAGGCCAAAGAGG - Intronic
978347692 4:107788759-107788781 GCATGGGAGGGAGGCCAAAGTGG - Intergenic
978377382 4:108089223-108089245 GCATGGGATGGCTGCACCACGGG + Exonic
978816752 4:112914969-112914991 GCAAGTGACGGCTGCCTCTGGGG + Intronic
979844575 4:125491249-125491271 CCATGGGAGGTCTTCTTCAGAGG + Exonic
982220567 4:153121662-153121684 GGAGAAGAGGGCTGCCTCAGAGG + Intergenic
983491852 4:168398397-168398419 GCATGGGAGGGAGGCCAAAGTGG + Intronic
990441367 5:55848750-55848772 AGATGGGGGGGCTGCCTCAGGGG + Intergenic
995867428 5:116706628-116706650 GCATGAAAGCTCTGCCTCAGGGG - Intergenic
997472339 5:134123937-134123959 GCAAGGCAGGGGTACCTCAGAGG + Intronic
997583460 5:135031201-135031223 GCTTTGGAGGGCTGCAGCAGAGG + Intronic
997977748 5:138450100-138450122 GCGTGGGAGGGATGCCTGCGAGG + Intergenic
999288222 5:150406881-150406903 CCATGGGAGCCCTGCCCCAGGGG - Exonic
1000328207 5:160188105-160188127 AATTGGGAGGGCTGCCCCAGAGG - Intronic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1006480964 6:34293862-34293884 GGATGGGTGGGCTACCACAGAGG + Intronic
1007665775 6:43512244-43512266 GCATGGCAGGGATGTCTCTGGGG + Exonic
1007727249 6:43923980-43924002 GCATGGCAGGGCTGGCAGAGGGG - Intergenic
1010189341 6:73178983-73179005 TCGAGTGAGGGCTGCCTCAGGGG + Intronic
1012861021 6:104559616-104559638 GCATGGGAGGGCTGAGGCAGAGG - Intergenic
1013484857 6:110587116-110587138 GCATGGGAGCCCTGGCTAAGGGG + Intergenic
1016495686 6:144659395-144659417 GCAGGGGAGAGCAGCCTCAGTGG - Intronic
1017470530 6:154733717-154733739 GCGGGGAAGGGCTCCCTCAGCGG - Intronic
1017756326 6:157532182-157532204 GGATGGGAGGAGAGCCTCAGTGG + Intronic
1017820847 6:158048215-158048237 GCCTGGGAGAGCTGCCCCCGGGG - Intronic
1019187486 6:170229294-170229316 GCAGGGGAGGCCTGGTTCAGAGG - Intergenic
1019575450 7:1735515-1735537 GGCTGGGAGGGCTGACTCGGCGG - Intronic
1019689655 7:2403580-2403602 GCCGGCGAGGGCTGCCTCTGGGG + Exonic
1020192553 7:6011190-6011212 GAATGGGACTGCTGGCTCAGCGG + Intronic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1021021169 7:15600114-15600136 GCATGGGAGGGAGGGCTGAGAGG - Intergenic
1024683395 7:51717932-51717954 GCATTGGAGCCCTGCCTGAGGGG + Intergenic
1027920142 7:84382392-84382414 GCATATGAGGGCTGGCACAGTGG - Intronic
1028367799 7:90054668-90054690 GCAATGGTGGGCTGCCTCTGAGG + Intergenic
1029716704 7:102332240-102332262 GAATGGGACTGCTGGCTCAGTGG - Intergenic
1034872123 7:154694322-154694344 ACATGGGAGGCCAGGCTCAGTGG + Intronic
1034941022 7:155230354-155230376 GAATGGCAGGGTTCCCTCAGTGG - Intergenic
1035644783 8:1210601-1210623 GCATGGAGGGGCTCCCTCTGGGG + Intergenic
1036653597 8:10661542-10661564 GCCTGGGAGGGCTGGCACACTGG - Intronic
1039400488 8:37265152-37265174 GAAAGGAAGGGCTGCCTCATGGG + Intergenic
1041572379 8:59352149-59352171 ACATGGGAGGCCTGGCACAGTGG - Intergenic
1043702888 8:83313025-83313047 GCATGGGAGGGAGGCCTATGGGG - Intergenic
1048067390 8:130984131-130984153 GCATGGGCGGGCTCCCTGTGTGG + Intronic
1048261732 8:132950850-132950872 TCAGAGCAGGGCTGCCTCAGAGG - Intronic
1048798138 8:138170739-138170761 GAATGACTGGGCTGCCTCAGGGG + Intronic
1049040821 8:140110800-140110822 GCAGGGGGGGGCTGCTACAGGGG - Intronic
1049148910 8:141021811-141021833 CCATGGGAGGGCTGCAGCAGTGG - Intergenic
1049272697 8:141704387-141704409 GCCTGGGAGGGCTGTCTGGGTGG - Intergenic
1052028014 9:23596166-23596188 GCAGGGGCGGGCAGCTTCAGAGG - Intergenic
1053477968 9:38395807-38395829 GCTTGGGAGGGCTGCTGCCGAGG - Exonic
1054918086 9:70514283-70514305 GAATGGGAGGACTGCCTCTGAGG + Intergenic
1056395776 9:86180008-86180030 CCATGGGAGATCTGCCTCACCGG + Intergenic
1057702638 9:97374927-97374949 GAAAGGGAGGCCTGGCTCAGTGG + Intronic
1059116019 9:111600299-111600321 TGATGGGTGGGGTGCCTCAGTGG - Intergenic
1059567823 9:115400866-115400888 GGATGTGAGGCCTGTCTCAGGGG - Intronic
1059932813 9:119278227-119278249 CCATGGGAGGGCTGGAGCAGGGG - Intronic
1060718275 9:125955126-125955148 GGATGGGAGGGCAGCCTCACTGG + Intronic
1061069500 9:128300419-128300441 GCCTGGGAGGGCTGCTGCAGTGG + Intergenic
1061224429 9:129272565-129272587 GCATGGCTGGGCTGGCTGAGCGG - Intergenic
1061328525 9:129878503-129878525 GCAGGGGAGGGCTGGCACACAGG + Intronic
1061926102 9:133806791-133806813 GCATGGGTGGGCTTCCTCCGGGG - Intronic
1062058751 9:134483262-134483284 GCATGGGGAGGCAGCCTCAGGGG - Intergenic
1062116253 9:134810836-134810858 TCCTGGGAGGCCTGCCACAGAGG + Intronic
1062288079 9:135782327-135782349 GCAGGGGAGGTGGGCCTCAGGGG - Intronic
1062502701 9:136858154-136858176 GCAGGGCAGGGCAGCCTCAGCGG - Intronic
1186454613 X:9701325-9701347 GCATGGGAGGGAGGGCACAGAGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1190055573 X:47179405-47179427 GCCTGGTAGGGCTGCGGCAGGGG - Exonic
1191936959 X:66436973-66436995 GGATGAGAGGGATGCCTCACTGG - Intergenic
1195232541 X:102865232-102865254 GCATGTGAGGTCGGCCACAGAGG + Intergenic
1195750672 X:108159774-108159796 GCAGGGGAGGTCTGGCTGAGGGG + Intronic
1195931531 X:110082102-110082124 TGCTGGAAGGGCTGCCTCAGTGG + Intronic
1196950914 X:120875166-120875188 GCAGGGGAGGGTTGTCCCAGAGG + Exonic
1198078096 X:133213338-133213360 GCAAAGGAGGGCTGCTCCAGTGG - Intergenic
1199604955 X:149569865-149569887 TCATGGGAAGCCTGCCTAAGGGG - Intergenic
1199641395 X:149865999-149866021 TCATGGGAAGCCTGCCTAAGGGG + Intergenic
1199759125 X:150891858-150891880 GCCTGGGAGGACTGGCTCAAGGG - Intronic
1202377968 Y:24255437-24255459 GCAGCGGCGGGCTGGCTCAGGGG + Intergenic
1202492814 Y:25414684-25414706 GCAGCGGCGGGCTGGCTCAGGGG - Intergenic