ID: 1103538615

View in Genome Browser
Species Human (GRCh38)
Location 12:121650978-121651000
Sequence TGTTAGGCTGAGAAGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103538610_1103538615 5 Left 1103538610 12:121650950-121650972 CCATGGGATTTCAAGGTTGAGAG 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1103538615 12:121650978-121651000 TGTTAGGCTGAGAAGTGGTCAGG 0: 1
1: 0
2: 1
3: 12
4: 147
1103538606_1103538615 24 Left 1103538606 12:121650931-121650953 CCACAGCTTTGCAAAGTTTCCAT 0: 1
1: 0
2: 3
3: 25
4: 278
Right 1103538615 12:121650978-121651000 TGTTAGGCTGAGAAGTGGTCAGG 0: 1
1: 0
2: 1
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103538615 Original CRISPR TGTTAGGCTGAGAAGTGGTC AGG Intergenic
903551034 1:24157455-24157477 TATTTGGCTGAGAAGGGGCCAGG - Exonic
906712471 1:47941138-47941160 GGTTAGGATGAGGAGTGGCCAGG - Intronic
907776625 1:57522197-57522219 TCTCAGGCTGAAAAGAGGTCTGG + Intronic
910295676 1:85642563-85642585 AGTTAGGCTGCTCAGTGGTCAGG - Intergenic
912866587 1:113263141-113263163 TGTCAGGCTGAGAGCTGGCCTGG - Intergenic
914899935 1:151706462-151706484 TGCAGGGCTGAGAGGTGGTCAGG + Intronic
915267886 1:154731809-154731831 TGGCGGGGTGAGAAGTGGTCAGG - Intronic
915319758 1:155050320-155050342 AGTGAGGCTGAGAAGTGAGCAGG - Intronic
916317780 1:163469603-163469625 AGGAAGGGTGAGAAGTGGTCAGG + Intergenic
921602775 1:217124103-217124125 TCTTAGGCTCAGAGGTAGTCAGG - Intronic
1066033020 10:31448712-31448734 AGTTAGGCTGCTAAGGGGTCAGG + Intronic
1066276067 10:33870157-33870179 TGTCTGGCTTAGAAGTGGTTCGG - Intergenic
1067067916 10:43113909-43113931 TGTCAGGCTGACAAGTTGTTTGG - Intronic
1072019153 10:91381436-91381458 TAATAGGCTGAGAGGTGGTAGGG - Intergenic
1079075604 11:17383821-17383843 TGCTGGGCTGAGTAGTGCTCAGG + Intergenic
1082267188 11:50131721-50131743 TGTCAGGCTGGGGGGTGGTCAGG + Intergenic
1085460675 11:76691370-76691392 GGTCAGGATGAGAAGTGATCTGG + Intergenic
1089743221 11:120599408-120599430 TGTGAGCCTGAGAAGAGGGCAGG - Intronic
1090538667 11:127676032-127676054 TGGTAGGCTGCGAAGAGGTTGGG - Intergenic
1090809404 11:130223571-130223593 TGTGTGGCTGAGAAGTGGTTTGG + Intergenic
1091515715 12:1179333-1179355 TTTTAAGCACAGAAGTGGTCTGG - Intronic
1091862196 12:3795829-3795851 TGTTAGGGTGGGAGGTTGTCAGG - Intronic
1094475527 12:30837801-30837823 TGTTAGTCTGAGAAGAGGACAGG + Intergenic
1100348602 12:93756454-93756476 TGTGTGGCTTACAAGTGGTCTGG - Intronic
1100394834 12:94175928-94175950 TGTTCAGCGGAGAAGTGATCAGG + Intronic
1103538615 12:121650978-121651000 TGTTAGGCTGAGAAGTGGTCAGG + Intergenic
1109077969 13:57862361-57862383 TCTTAGGATGAGAAGTGTTTTGG + Intergenic
1112108937 13:96273460-96273482 TCTTAGTCTCAAAAGTGGTCTGG - Intronic
1113492704 13:110705174-110705196 TGTGAAGCTAAGAAGTGGTGGGG + Intronic
1114364137 14:22008925-22008947 TTTGAAGCTGAGAAGTGGTTAGG + Intergenic
1116292654 14:43063040-43063062 AGTTAGGCTGCTCAGTGGTCAGG - Intergenic
1116331130 14:43598593-43598615 AGTTAGGCTGCTCAGTGGTCAGG - Intergenic
1118186617 14:63543468-63543490 TGTTCGGCTGAGACCTGATCAGG + Intergenic
1119851513 14:77869839-77869861 TGTGAAGCTGAGAAGAGGTGAGG - Intronic
1119866215 14:77977318-77977340 TGTTATGCAGAGAAGTGGATAGG - Intergenic
1119924421 14:78479219-78479241 AGTGAGTCTGAGAAGTGGCCTGG + Intronic
1120560573 14:85987410-85987432 TGTTAGAGATAGAAGTGGTCAGG + Intergenic
1120869265 14:89322600-89322622 AGTAAGGCTGAGAAGGGGACCGG + Intronic
1120885888 14:89451567-89451589 TGTCAGCTTGAGAACTGGTCAGG + Intronic
1120902642 14:89589269-89589291 TGTAAGTCTGGGTAGTGGTCTGG - Intronic
1122939581 14:104975254-104975276 GGTGAGGCTCAGAAGTGGACAGG - Intronic
1125682017 15:41536907-41536929 TGTGAGGCTGAGAAGTAGAGAGG - Intronic
1131517263 15:93087974-93087996 TCTTAGGCTGCGAAGTTGTTGGG - Intronic
1131737268 15:95347044-95347066 TGTTTGGCTTGGAAGTGCTCTGG - Intergenic
1132254741 15:100365973-100365995 TGTTAGGCTGCTCAGGGGTCAGG - Intergenic
1132416945 15:101627153-101627175 TGTTAGGCTGCTCAGGGGTCAGG - Intronic
1134747998 16:16602717-16602739 AGTGAGGCTGAGAAGTGGGCAGG - Intergenic
1134997469 16:18750942-18750964 AGTGAGGCTGAGAAGTGGGCAGG + Intergenic
1137512174 16:49111022-49111044 TGTTAGGGTCACAAGTGGCCAGG + Intergenic
1139440279 16:66963310-66963332 TGTGGGGCTGAGAACCGGTCAGG - Exonic
1141342516 16:83216004-83216026 GGTTAGGCTGAGAAGCAGTTGGG - Intronic
1141700750 16:85640979-85641001 TGCTATGCGGAGAAGGGGTCGGG - Intronic
1142813299 17:2406631-2406653 AGCTAGGTTGAGAAGTGGCCTGG + Intronic
1143258986 17:5584357-5584379 TGCAAGGCTGAGAAGAGGTGGGG + Exonic
1145999959 17:29125121-29125143 AGCTAGGCTGAGAAATGCTCTGG - Intronic
1146089624 17:29863329-29863351 TGTTAGCCTGAGTACTGGACTGG - Intronic
1148877124 17:50695751-50695773 TGAACAGCTGAGAAGTGGTCTGG - Exonic
1150503203 17:65671096-65671118 TGTTTGGCTGAGAAGGGGGGTGG + Intronic
1152635422 17:81428800-81428822 TGAGGGGCTGAGAAGTGGTGGGG - Intronic
1162493673 19:11010685-11010707 TGTAAAGCAGAGATGTGGTCTGG + Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1165540617 19:36490125-36490147 TGTGAGACTCAGAAGTGGTTGGG + Intergenic
1165821491 19:38679209-38679231 TGTGGGGCTGAGAAGTATTCGGG - Intronic
1166888468 19:45975301-45975323 GATTAGGCTCAGAAGGGGTCTGG + Intergenic
1167827039 19:51983349-51983371 TGTTGGGCTGGGAGATGGTCAGG - Intronic
925409309 2:3630665-3630687 TGTTGGGGTGAGAAGGGCTCTGG + Intronic
925867430 2:8241112-8241134 TTTTAGGCAGATAAGTGGCCAGG - Intergenic
925920732 2:8636169-8636191 TGTGAGGCTGAGAAGGGGCCTGG + Intergenic
927326583 2:21812329-21812351 TGTTAGGGTAAAAAGTGTTCAGG - Intergenic
928585219 2:32753023-32753045 GGTTTGACTGAGCAGTGGTCTGG + Intronic
929876524 2:45801236-45801258 TGTTAAGCTGACCAGTGGCCAGG + Intronic
932012845 2:67995178-67995200 TGATGGGCTGGGAAGTGGTGTGG - Intergenic
932644249 2:73485374-73485396 TGTTAGGCTGCTCAGGGGTCAGG + Intronic
932999561 2:76905064-76905086 AGTTAGGCTGCTCAGTGGTCAGG - Intronic
934649835 2:96084585-96084607 TGTGAGCCTGAGAAGTGGTAGGG + Intergenic
938556662 2:132430685-132430707 TGTGAGGCTGAGATGAGGGCAGG + Intronic
939392750 2:141590144-141590166 TTTTAGGCTGTGAAGTGGTAGGG - Intronic
942089072 2:172471192-172471214 TTCTAGGCTGAGAAGAGGCCAGG + Intronic
947872605 2:233447776-233447798 TGTCAGGATGAGTAGGGGTCAGG + Intronic
1168948928 20:1783272-1783294 TGCTTGGCTGAGTAGTGGTGGGG - Intergenic
1172664100 20:36587245-36587267 TGCTAGGCTGCCAAGTGATCTGG + Intronic
1172924570 20:38521001-38521023 AGTAAGGATGAGAAGTGGGCAGG - Intronic
1175057612 20:56212367-56212389 TGTTGGGCTGAGGGATGGTCAGG + Intergenic
1178080032 21:29053638-29053660 TCTCAGGCTGAGAAGAGGTATGG + Intronic
1180202618 21:46234564-46234586 GATTAGGCAGAGAAGTGATCTGG - Intergenic
1181772944 22:25139942-25139964 AGTGAAGCTGAGAAGTGGTGTGG + Intronic
1183922026 22:41177318-41177340 GCTGAGGCTGAGAAGTGGGCTGG - Exonic
1184110018 22:42389037-42389059 TGTGAGACTTAGAAGGGGTCTGG - Intronic
1185391478 22:50563642-50563664 TGTTTGGCTGAGTGGTGGACAGG + Intergenic
1203293946 22_KI270736v1_random:22501-22523 TGTCAGGCTGGGGAATGGTCAGG - Intergenic
950084886 3:10249898-10249920 TATTGGGCTGAGGTGTGGTCTGG + Intronic
950969824 3:17175054-17175076 TCTTAGATTGAGAAGTGGTAGGG + Intronic
951877663 3:27445209-27445231 TGTTTGGCTGATCACTGGTCTGG - Intronic
952052830 3:29406480-29406502 TGTCTGGCTGAAAGGTGGTCTGG + Intronic
954088643 3:48267346-48267368 AGTTAGGCTGATAAAGGGTCTGG - Intronic
954715817 3:52526276-52526298 TGGGAGGCAGAGAAGTGGGCAGG + Intronic
956078461 3:65531977-65531999 TGAGAGAGTGAGAAGTGGTCAGG - Intronic
960534066 3:118797337-118797359 TAATAGGTTGAGAAGTGGTTTGG + Intergenic
961357910 3:126350531-126350553 AGTGAGGCTGAGCTGTGGTCAGG - Intronic
963124286 3:141800768-141800790 TGTTTGCCTGAGAAGTGGCGAGG + Intronic
963597752 3:147349295-147349317 TGTTAGGCTGAGAATTGGCCTGG - Intergenic
967238532 3:187412828-187412850 AGTTAGGCTGCTCAGTGGTCAGG - Intergenic
969159803 4:5247000-5247022 TGTTAGGCTCCTTAGTGGTCAGG + Intronic
969950565 4:10831208-10831230 TGTCAACCTGAGGAGTGGTCTGG - Intergenic
972733891 4:41821155-41821177 AGTTAGGCTGAGATCTGGACTGG + Intergenic
976107227 4:81631991-81632013 TCTTAGCCTGAGAAGTGCTAGGG + Intronic
979457927 4:120947606-120947628 GGTTTGGCTGTGAATTGGTCTGG - Intergenic
982968715 4:161950690-161950712 TTGTAGGCTGAGAACAGGTCAGG - Intronic
983094294 4:163543444-163543466 TGTTAGAGTGAGAAGTGGTAGGG + Intronic
987216805 5:15746018-15746040 TGAGAGGGTGAGAAGTGGTTCGG + Intronic
988321793 5:29707484-29707506 AGTTAGGCTAAGAAGTGGAAGGG + Intergenic
989968146 5:50489410-50489432 TGTTAGGCTGCTCAGGGGTCAGG + Intergenic
990484577 5:56245324-56245346 TATCAAGGTGAGAAGTGGTCTGG - Intergenic
990804091 5:59638421-59638443 TGTTAGGCATAGAACTGCTCAGG - Intronic
995098448 5:108269037-108269059 TTTTAGGCAGAGAAGTGACCAGG + Intronic
995603549 5:113825688-113825710 TGTGAGGGCAAGAAGTGGTCTGG + Intergenic
996002766 5:118383675-118383697 AGTTAGGCTGCTCAGTGGTCAGG - Intergenic
998007545 5:138666915-138666937 TGTTAGGGTGAGATGTGAGCTGG - Intronic
998891638 5:146752392-146752414 TGATAGGATGAGGGGTGGTCAGG - Intronic
998953941 5:147419179-147419201 TGATTGGCTGATAAATGGTCAGG - Intronic
1000253645 5:159518140-159518162 TGTCTGTCTCAGAAGTGGTCTGG + Intergenic
1001716103 5:173817750-173817772 TGTTGGGCTGAGAAGAGGGGAGG + Intergenic
1003144493 6:3498526-3498548 AGTAAGGCAGAGAACTGGTCAGG + Intergenic
1003672956 6:8176727-8176749 GGTTGGGCTGGGACGTGGTCTGG + Intergenic
1008079857 6:47182444-47182466 CGCTAGGCTGTGAAGTGCTCAGG + Intergenic
1010078706 6:71832009-71832031 AGTTAGGCTGCTCAGTGGTCAGG + Intergenic
1010132485 6:72510686-72510708 TTTTAGGCTTAAAAATGGTCAGG + Intergenic
1010195957 6:73240573-73240595 TGGGAGGCTGAGAAGGGCTCAGG - Intronic
1011056878 6:83214556-83214578 AGTTAAGAAGAGAAGTGGTCAGG - Intronic
1025998394 7:66542939-66542961 TGTAAGGCTGAGGGGTGGTTGGG - Intergenic
1031257318 7:119470568-119470590 GGTCAGGCTGAGAACTGTTCTGG + Intergenic
1031956434 7:127947197-127947219 TGTCAGGCTGAGATGTTATCAGG + Intronic
1032146887 7:129391633-129391655 TGTTATATTGAGCAGTGGTCTGG + Intronic
1032583281 7:133123476-133123498 TGTTTGCCTGGGAAGTGGTGGGG - Intergenic
1032902226 7:136322236-136322258 AGTTAGGCTTAGAAATGGCCGGG - Intergenic
1033272787 7:139947692-139947714 TGTGAGGCTGAGCAGCTGTCTGG - Intronic
1036173869 8:6517588-6517610 TGCCAGGCAGAGAAGTTGTCTGG + Intronic
1038821916 8:30959796-30959818 TGTTAGGCCAAGCAGTGATCAGG - Intergenic
1039410192 8:37348442-37348464 TGTTAGACAGAGAAGTGTCCTGG - Intergenic
1040479963 8:47816266-47816288 TGCTAGCCTGAGAAGTATTCTGG + Intronic
1041367027 8:57117296-57117318 AGGTAGGGTGAGAAGTGGTAGGG + Intergenic
1041485442 8:58370864-58370886 AGTTAGGCTGCAAGGTGGTCAGG - Intergenic
1041697573 8:60752436-60752458 TGGTGGGCTGTGAAGTGTTCTGG + Intronic
1042642478 8:70951448-70951470 TGTTCTGCTGAGGAGTGGCCAGG - Intergenic
1048236387 8:132694873-132694895 GTTTAGGCAGAGAAGAGGTCTGG + Intronic
1050709102 9:8439857-8439879 TTATAGACTGAGCAGTGGTCAGG - Intronic
1056766511 9:89447630-89447652 GGTTAGGCTGTGAGGTGGTCTGG - Intronic
1057233111 9:93337044-93337066 TGTCAGGCTGAGAACTGGACTGG + Intronic
1058922077 9:109626751-109626773 TGTGAGGCTGAGAAAGGTTCTGG + Intergenic
1059191371 9:112330092-112330114 TGGGAGGCTGAGAGGTGGGCGGG - Intronic
1059376673 9:113887417-113887439 TGGTAGGCAGAGAAATTGTCAGG - Intronic
1062343794 9:136105497-136105519 AGCAAGGCTGAGAAGTGGCCGGG - Intergenic
1062391546 9:136335920-136335942 GGTCAGGCTGAGGACTGGTCAGG - Intronic
1186210050 X:7241037-7241059 TGTGAGGTGGAGAAGAGGTCAGG - Intronic
1188039038 X:25350667-25350689 TGCTACGCTGAGAAGTGATCAGG - Intergenic
1188442856 X:30230453-30230475 TTCTAGGCTGAGAAGAGGTTTGG - Exonic
1189737948 X:44090365-44090387 TGCTTGGCTGGGAAGTGGTCAGG + Intergenic
1194487614 X:94505198-94505220 AGTTAGGTTGAGATGTGGTGAGG + Intergenic
1195363347 X:104105904-104105926 GGTTAGGCTTAGAAGTTGCCAGG - Intronic
1197228777 X:123980644-123980666 GTTTAAGCTGGGAAGTGGTCAGG + Intronic
1197406766 X:126063520-126063542 AATTAGGCTGTGAATTGGTCTGG - Intergenic