ID: 1103541993

View in Genome Browser
Species Human (GRCh38)
Location 12:121672618-121672640
Sequence GCGCGCGCCGCGGGCCCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 748
Summary {0: 1, 1: 0, 2: 14, 3: 82, 4: 651}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103541988_1103541993 -5 Left 1103541988 12:121672600-121672622 CCTCAATGTCCGTCAGCTGCGCG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG 0: 1
1: 0
2: 14
3: 82
4: 651
1103541985_1103541993 27 Left 1103541985 12:121672568-121672590 CCTGCGCTCACCTGCGGGATCGC 0: 1
1: 0
2: 1
3: 8
4: 63
Right 1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG 0: 1
1: 0
2: 14
3: 82
4: 651
1103541986_1103541993 17 Left 1103541986 12:121672578-121672600 CCTGCGGGATCGCAGCATCCAGC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG 0: 1
1: 0
2: 14
3: 82
4: 651
1103541987_1103541993 -1 Left 1103541987 12:121672596-121672618 CCAGCCTCAATGTCCGTCAGCTG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG 0: 1
1: 0
2: 14
3: 82
4: 651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103541993 Original CRISPR GCGCGCGCCGCGGGCCCGGC CGG Intronic