ID: 1103541993

View in Genome Browser
Species Human (GRCh38)
Location 12:121672618-121672640
Sequence GCGCGCGCCGCGGGCCCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 748
Summary {0: 1, 1: 0, 2: 14, 3: 82, 4: 651}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103541985_1103541993 27 Left 1103541985 12:121672568-121672590 CCTGCGCTCACCTGCGGGATCGC 0: 1
1: 0
2: 1
3: 8
4: 63
Right 1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG 0: 1
1: 0
2: 14
3: 82
4: 651
1103541988_1103541993 -5 Left 1103541988 12:121672600-121672622 CCTCAATGTCCGTCAGCTGCGCG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG 0: 1
1: 0
2: 14
3: 82
4: 651
1103541987_1103541993 -1 Left 1103541987 12:121672596-121672618 CCAGCCTCAATGTCCGTCAGCTG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG 0: 1
1: 0
2: 14
3: 82
4: 651
1103541986_1103541993 17 Left 1103541986 12:121672578-121672600 CCTGCGGGATCGCAGCATCCAGC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG 0: 1
1: 0
2: 14
3: 82
4: 651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103541993 Original CRISPR GCGCGCGCCGCGGGCCCGGC CGG Intronic
900113776 1:1020187-1020209 GCGGCCGCAGCGGGCCCGGGTGG - Exonic
900155318 1:1201414-1201436 GCGCGCGGGGCGGGCCCGGGAGG + Intergenic
900284063 1:1890902-1890924 GCGCGCTCCGCGGGCGCTGCGGG + Exonic
900314555 1:2050436-2050458 GCGCGCGGGGCGGGACCGTCCGG - Intergenic
900349543 1:2228150-2228172 GGGCGGGCCGCGGAGCCGGCGGG + Intergenic
900414697 1:2529581-2529603 GCGGGCGCGGCGGGCGCGGCCGG + Exonic
900671299 1:3856808-3856830 GCGCGGGGCGCGGGCGCCGCGGG - Intronic
901433825 1:9234548-9234570 GCGCGCGTCTCGGACGCGGCAGG + Intergenic
901433938 1:9234865-9234887 GCGGCCGCCGCGGGCTCCGCGGG + Exonic
901540076 1:9910043-9910065 CGGCGCGGCGCGGGCCCGGGCGG + Intronic
901836359 1:11926324-11926346 GTGGGCGCCGCGGTCCGGGCCGG - Exonic
902214172 1:14924224-14924246 GCGCGCGCCGCCGGCCGGGCGGG + Intronic
902509930 1:16961003-16961025 GCGCGCGGCGGAGGCCCAGCTGG + Exonic
902586212 1:17439847-17439869 GCGCGCGGCGCAGGCTCGGGTGG - Intergenic
902916744 1:19644284-19644306 CCCCGCGCCGCGCGCCCGCCCGG + Intronic
903044156 1:20553269-20553291 GGGCTCGCTGCGGGCCTGGCGGG + Exonic
903072178 1:20731977-20731999 GCGAGCGCCGGGAGCCGGGCAGG - Intronic
903078110 1:20787345-20787367 GCGCGGGAGGCGGGGCCGGCGGG - Intergenic
903233936 1:21937499-21937521 GCGCGGGCCGCGGCCCGGCCCGG + Intergenic
903349810 1:22710900-22710922 GCGCGCGCCCCGGGCTCGGGGGG - Intronic
903413788 1:23168154-23168176 GCGCGGGCCGCGGGCCGGGCGGG - Intronic
903738190 1:25543618-25543640 CCGCGCGCCGCAGGGCCGGGCGG + Exonic
903750249 1:25616944-25616966 GCGCGCTCCGCGGAGCCGGCGGG + Intergenic
903925173 1:26826759-26826781 CCGCGCCCCGCGGGCCGGCCGGG - Exonic
904039436 1:27575654-27575676 GGGCGGGCCGCGCGGCCGGCCGG - Intronic
904215336 1:28914535-28914557 GGGCGGGCTGCGGGCCGGGCTGG + Intronic
904744515 1:32702769-32702791 GCGCCCGGCCCGGGGCCGGCCGG - Exonic
904772141 1:32886445-32886467 GCGCGCGCGGCAGGGGCGGCAGG - Exonic
904773287 1:32893023-32893045 GCCCGCGCCGCGCCCCCTGCCGG + Intronic
904822888 1:33256657-33256679 CCGCGCGCCCCGGGCCCGCACGG - Intronic
905183190 1:36178854-36178876 GCGGGCGCCGCGGGCCGGGAGGG + Intronic
905223406 1:36464290-36464312 GGCCGCGGCGCGGGCCCCGCGGG - Exonic
905442729 1:38005383-38005405 GCGCGCGGCGCAGGCGGGGCCGG + Exonic
905449372 1:38046903-38046925 GCGCGGGGCGGGGGCCGGGCAGG - Intergenic
905569252 1:38991146-38991168 GGGGGCGCCCCGGGCCGGGCCGG + Intergenic
905803734 1:40861779-40861801 GCGCCGGCTGCGGGCCCGGGGGG + Exonic
905890574 1:41516235-41516257 GAGCGCGCGGCGGGCGCCGCTGG + Intronic
907406666 1:54258023-54258045 CCGCGCCCCGCGTCCCCGGCGGG + Intronic
907486418 1:54781257-54781279 CAGCGCGCCGCGGGACCGCCGGG - Exonic
907540888 1:55214910-55214932 GCCCCAGCCCCGGGCCCGGCGGG - Exonic
907889567 1:58623816-58623838 GCGCACGGCGCGGGACTGGCAGG + Intergenic
907980122 1:59472470-59472492 GCGCACGGCGCGGGACTGGCAGG + Intronic
908131963 1:61082907-61082929 ACGCACGCCCTGGGCCCGGCCGG - Intronic
908888659 1:68818093-68818115 GTGCGCGGCGCGGGACTGGCAGG + Intergenic
910550367 1:88467454-88467476 GGGCGCACCGCGGGACTGGCAGG + Intergenic
910981243 1:92961546-92961568 GCGCGCGCCGCGGCGGGGGCGGG - Intergenic
911633951 1:100213245-100213267 GCGTGCGCCGCGTCCCCGCCGGG + Intronic
912381309 1:109249636-109249658 GCGGGCGGCGCGGGACCGTCGGG + Intergenic
912619421 1:111140129-111140151 GAGCGCGCCCCGGGGCCGGCCGG - Intronic
916666943 1:166975398-166975420 GCCTGCGCGGCCGGCCCGGCGGG - Intronic
917438621 1:175045708-175045730 GACATCGCCGCGGGCCCGGCGGG + Intergenic
917974716 1:180231142-180231164 GCGCACGCGGCGGGCGCCGCGGG - Intronic
917974719 1:180231148-180231170 GCGCCCGCCGCGTGCGCCGCGGG + Intronic
918709013 1:187704005-187704027 GCGCACGGCGCGGGACTGGCAGG + Intergenic
918732235 1:188013296-188013318 GCGCACGGCGCGGGACTGGCAGG - Intergenic
920912675 1:210233028-210233050 GCGCGGGCCGCGGGGGCGGGAGG + Intronic
921384072 1:214551815-214551837 GCGCGCGCCGGGGGCGCCGCGGG + Intronic
922250639 1:223846001-223846023 GGGCGCGCCGCGGGCGGGGTCGG - Intergenic
922306983 1:224352744-224352766 GCCGGCCCCGCGGGCCCCGCCGG - Intergenic
922306984 1:224352747-224352769 GCGGGGCCCGCGGGGCCGGCTGG + Intergenic
922440530 1:225652654-225652676 GCGCGGGGCGGGGGCCGGGCGGG - Intronic
922496499 1:226062224-226062246 GCGCGCGCCGGGGCCCGCGCGGG + Intronic
922739366 1:228006871-228006893 GCCCGGGCCCCGGCCCCGGCGGG + Intergenic
922744931 1:228038289-228038311 GCCCGCGCCCCGGTCCCCGCCGG - Intronic
922766249 1:228158106-228158128 GCGCGCGGCGTGGCCCCGGGCGG - Exonic
923008005 1:230067381-230067403 GCGCGGGCGGCGGCGCCGGCAGG + Exonic
923126810 1:231040354-231040376 GCGCGGGCCCCGGGTCCGGGTGG + Intergenic
924117593 1:240762873-240762895 ACGCACGCCGCGGGACTGGCAGG + Intergenic
924801512 1:247332000-247332022 GCGCGCGGAGCGGGGCGGGCCGG - Intergenic
1064208922 10:13347640-13347662 GTGCGCGCGGCGGGAGCGGCCGG - Intronic
1064552849 10:16520744-16520766 GCGCCCCGGGCGGGCCCGGCAGG + Exonic
1064790290 10:18951254-18951276 GCGCACGGCGCGGGACTGGCTGG - Intergenic
1065020806 10:21500476-21500498 GCGCGCGCCCCGGGCCCTGCAGG - Intergenic
1065342897 10:24723403-24723425 GCCCGCGGCGGGCGCCCGGCGGG - Intronic
1065342954 10:24723613-24723635 GCGCGCCCCGCCCGCCCGCCCGG + Exonic
1065802675 10:29366564-29366586 GCGCACGGCGCAGGCCTGGCAGG + Intergenic
1066022836 10:31319811-31319833 CCGCGCGCCGCGGCCCCGGCCGG + Intronic
1066296167 10:34055900-34055922 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1067337058 10:45374507-45374529 GGGGGCGCCGAGGGCCCGTCGGG + Intronic
1067363265 10:45601126-45601148 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1068216752 10:53991197-53991219 GCGCGCGGTGCGGGACTGGCAGG + Intronic
1068866819 10:61903317-61903339 GCGCTCGCCGCGCTCCCGGGAGG + Intronic
1068902187 10:62280763-62280785 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1069988133 10:72297972-72297994 GGGCGCGCCTCGGGCGGGGCTGG - Intergenic
1070156630 10:73839544-73839566 GCGAGCGCCGCCGGCCTGGCCGG - Intronic
1070162552 10:73874661-73874683 GGGCGGGCCGGGGGCCGGGCGGG - Intergenic
1070564023 10:77590256-77590278 GCGCACGGCGCGGGACTGGCAGG - Intronic
1071037408 10:81264889-81264911 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1072710768 10:97714407-97714429 GCGCCCGCCGCGGCCCCGATCGG + Exonic
1072930617 10:99659250-99659272 GAGCTCTCCGCGGGCCCTGCAGG + Intergenic
1072982976 10:100115226-100115248 GCGGGCGCCCCGGACCCGGCCGG + Intergenic
1073242159 10:102065910-102065932 GCCCGGGCCGAGGGCCCGTCAGG + Exonic
1073251074 10:102120597-102120619 GCGTGCGCCGCGCGGCGGGCGGG + Intergenic
1073305820 10:102502683-102502705 GCGCTAGCGGCGGACCCGGCTGG - Exonic
1074088395 10:110226028-110226050 GCGGGCGCGGCTGGCGCGGCTGG + Intronic
1074121679 10:110498075-110498097 CCCCGCGCCGCGCGCCCCGCGGG - Exonic
1074182902 10:111078807-111078829 GAGCGCAGCGCGGGCCCGGGGGG + Exonic
1074618451 10:115093370-115093392 GCGCGGGCCGCGGGCGAGGCGGG + Intronic
1075054483 10:119207455-119207477 GCTCGCGGCGCGGGGCCTGCTGG - Intergenic
1075375431 10:121974837-121974859 CCGGGCGGCGCGGGCCCGGACGG - Intronic
1075521812 10:123147952-123147974 GAGCGCGCCGAGGGCCTGGCGGG - Intergenic
1076116966 10:127907450-127907472 GGGCGCGCCGCGGGGGCGGCGGG - Intronic
1076750046 10:132537953-132537975 GGGCGCATCGCGGGCTCGGCGGG - Exonic
1076792628 10:132785321-132785343 GCGCGCGCTCCGGGCCCGCCAGG + Exonic
1077053155 11:576705-576727 GCGCTGGCCGCGGGCCGGGAGGG + Intronic
1077419936 11:2445297-2445319 GGGGGCGCGGCGGGCGCGGCCGG - Exonic
1077491405 11:2862554-2862576 GCGCGAGGAGCGGGCGCGGCCGG - Intergenic
1077495274 11:2884206-2884228 GCGCGGGGCGCGGGCCGGCCGGG + Intronic
1077602156 11:3581321-3581343 GCGCGCACCGCGGACACGCCGGG + Intergenic
1077635767 11:3840734-3840756 GCGGGCGCGGCCGGCCGGGCGGG - Intronic
1078180089 11:9004064-9004086 GCGCGCGCGGGGGGCGGGGCCGG + Intergenic
1078561726 11:12378054-12378076 GCGCCCGCCCACGGCCCGGCGGG - Intronic
1078800900 11:14643669-14643691 GCGCTGGGCGCGCGCCCGGCCGG + Intergenic
1080551433 11:33376480-33376502 GAGCCCGCCCCGGGCGCGGCAGG + Intergenic
1080606634 11:33869626-33869648 GGGCGCGCCGCGGCCGAGGCGGG + Intronic
1081705654 11:45180857-45180879 CCGCGCGCCCCCGGCCCTGCTGG + Intronic
1081804984 11:45885612-45885634 GCGCGCCCCCGGGACCCGGCCGG - Intergenic
1081812838 11:45922980-45923002 GTGAGCGCCGCGAGCCTGGCGGG + Exonic
1083147004 11:60767460-60767482 ACGCTCTCCGCGGGGCCGGCAGG + Intronic
1083571244 11:63763276-63763298 GCGCCCCCCGCTGGCCGGGCCGG - Exonic
1083579076 11:63813514-63813536 GCGCCGGTCGCAGGCCCGGCCGG + Exonic
1083741471 11:64713718-64713740 GCGGGGGCCGGGGGCCGGGCGGG - Exonic
1084028496 11:66467199-66467221 CCGCACGCCCCGGGCCCGGACGG - Intronic
1084107482 11:66989178-66989200 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1084112519 11:67023292-67023314 GCGCGGGCCGGGGGCTCGGCCGG - Intronic
1084128610 11:67118005-67118027 GCGGGCGCGGGAGGCCCGGCCGG - Intergenic
1084169066 11:67391820-67391842 GCGGGCGCCGCGGGCCTCCCCGG + Intronic
1084310275 11:68312680-68312702 GAGCGCGGCGCGGGCCCGTCCGG + Exonic
1084387722 11:68854725-68854747 GCGCGGGCGCCGGGGCCGGCAGG - Intergenic
1084526909 11:69703603-69703625 GTGCGCGCGGCGGGGCGGGCGGG + Intronic
1084979592 11:72822086-72822108 GCGGGCGCAGCAGGCCCAGCAGG + Exonic
1085205817 11:74731329-74731351 GCGGGGGCCTGGGGCCCGGCGGG + Intronic
1086808090 11:91269141-91269163 GCGCAGGGCGCGGGCCTGGCAGG + Intergenic
1087076244 11:94129210-94129232 GCGAAAGCCGCGCGCCCGGCCGG + Exonic
1088869009 11:113875604-113875626 GCGCGCGCTGCGGGCGGGGGCGG - Intergenic
1089499819 11:118925506-118925528 CCCCGCGCCCCGGCCCCGGCGGG - Intronic
1089520024 11:119057178-119057200 GCGCGCGCCGCGTCCGGGGCCGG - Intronic
1089800315 11:121022045-121022067 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1090229298 11:125089882-125089904 GCGCACGGCGCGGGACTGGCAGG + Intronic
1090616750 11:128522219-128522241 GGGCGCGGCGCGGGCGAGGCTGG - Intronic
1090636943 11:128695124-128695146 GCCCGCGCCCCGCGCCCGCCCGG + Intronic
1090699073 11:129278912-129278934 GCGCGGGGCGCGGGCGCGGGAGG + Intronic
1090780380 11:130002191-130002213 GCGGGCGCTCCGGGCGCGGCGGG - Intronic
1090799098 11:130159715-130159737 GCGAGCGCGGCGGGCTGGGCGGG + Exonic
1092045944 12:5431987-5432009 GCGCGCGGCGCGGCGCGGGCCGG + Intergenic
1092256229 12:6928050-6928072 GGGCGGGCCGCGGGGCCGGGCGG + Intronic
1092617077 12:10225588-10225610 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1093335531 12:17900554-17900576 GCGCACGCCGCAGTCCCAGCCGG + Intergenic
1093435308 12:19129630-19129652 GCCCGCCCCGCCGCCCCGGCAGG - Intergenic
1094704035 12:32897103-32897125 GAGCGGGGCGCGGCCCCGGCAGG - Intergenic
1095776773 12:46018402-46018424 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1097007866 12:55931951-55931973 GCGCCGGGCGCGGGCGCGGCGGG + Intronic
1097863984 12:64543639-64543661 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1098168145 12:67719207-67719229 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1101365189 12:104064431-104064453 GCGGGCGCCGGCGGCCAGGCTGG - Intergenic
1101371854 12:104137947-104137969 GCTCCCGCAGCGGGCCGGGCCGG - Intronic
1101606080 12:106248215-106248237 GCGCGGGGCGGGGTCCCGGCGGG + Intronic
1101940834 12:109098032-109098054 CCGCGCGCCGCAGGCCCTCCTGG + Intronic
1103325418 12:120116905-120116927 GTGCGCGACCCGGGCGCGGCCGG - Intronic
1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG + Intronic
1103562727 12:121800655-121800677 GCGGCCGCCGCGCGCCGGGCGGG - Intronic
1103604807 12:122078761-122078783 GCGCGCGGGCCGGGCCGGGCCGG + Exonic
1103649660 12:122422716-122422738 GCCCGCCCGGCCGGCCCGGCCGG + Intergenic
1103649698 12:122422811-122422833 GCGCCCACCGCGGCCCCGGGAGG + Intergenic
1103764656 12:123271630-123271652 GCGGGCGCGCCGGGCGCGGCGGG + Exonic
1103779576 12:123389590-123389612 GCTCGCGGCCCCGGCCCGGCGGG - Intronic
1103800431 12:123533983-123534005 GGGCGCGCCCCTGGCCAGGCCGG - Intergenic
1104049630 12:125186728-125186750 CCGGGAGCCGCGGGCCGGGCCGG + Intergenic
1104929309 12:132329665-132329687 GCGCGCGGGGCGGTCCCGGGGGG - Intergenic
1105389192 13:19959154-19959176 GCGGGGGTCGCGGGGCCGGCGGG + Intronic
1105437869 13:20392180-20392202 GCGGGCGCCGCGTGTCCCGCCGG - Intergenic
1105830224 13:24157578-24157600 GCGTGAGCCACGTGCCCGGCTGG + Intronic
1106308345 13:28532653-28532675 GGGCGCGCGGCGCCCCCGGCCGG - Intergenic
1106308348 13:28532659-28532681 GGGGGCGCCGCGCGCCCGGTCGG + Intergenic
1107133525 13:36920361-36920383 GGGGGCTGCGCGGGCCCGGCGGG + Intronic
1108313910 13:49220231-49220253 CCGCACGCTGCGGGCGCGGCAGG - Intergenic
1108362242 13:49678308-49678330 GCGCGCGGCGCAGGACTGGCGGG - Intronic
1108478449 13:50843463-50843485 AGGCCCGCCGCGGGCCCGGCCGG - Exonic
1108751468 13:53452369-53452391 GCGCGCAGCGCGGGACTGGCAGG - Intergenic
1109037664 13:57286588-57286610 GCTCGCGGCGCGGGACTGGCGGG - Intergenic
1110024001 13:70511886-70511908 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1112533098 13:100224024-100224046 GCGCACGGCGCGGGACTGGCAGG - Intronic
1112652754 13:101416469-101416491 GCGTGAGCCGCGGCCCCAGCCGG - Intronic
1113614020 13:111668701-111668723 GGGGGAGCCGCGGGCCCTGCGGG - Intronic
1113820419 13:113209200-113209222 GCGCGCGCCCCGGGGCCCTCAGG + Intronic
1113936906 13:113999696-113999718 GCGGGCCCCGCTGTCCCGGCTGG + Intronic
1114485162 14:23057646-23057668 CCCCGCCGCGCGGGCCCGGCTGG - Intergenic
1114516169 14:23301623-23301645 GCGCGCGGCGGGGGCGGGGCCGG + Exonic
1115284332 14:31700935-31700957 GTGCGCGGCGCGGGACTGGCGGG + Intronic
1115855054 14:37622234-37622256 GCGCGCGGGGCGGGCCGGGCCGG - Intronic
1117039876 14:51760073-51760095 GCGCTCCCCGCGGCCCCCGCTGG - Intergenic
1117131978 14:52695762-52695784 GCGGGCGCAGCGGACCGGGCGGG - Intronic
1118627881 14:67675225-67675247 GCGCGAGCCACTCGCCCGGCCGG - Intronic
1118849461 14:69573012-69573034 GCACGCGGCGCGGGCGAGGCCGG + Exonic
1119303620 14:73590453-73590475 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1119306634 14:73612961-73612983 GCTCGCGCCGCACCCCCGGCCGG - Intronic
1119438486 14:74612681-74612703 GCGCCCTCCGCAGGGCCGGCCGG + Intergenic
1119870636 14:78013955-78013977 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1120167848 14:81220234-81220256 GGGGCCGCCGCGGGCCGGGCCGG - Intronic
1120788032 14:88554752-88554774 GAGCGCGCCGCGGCCCGGGCTGG - Intergenic
1120809951 14:88792912-88792934 GTGCGCGGCGCGGGTCCGCCAGG - Intergenic
1121074947 14:91060289-91060311 GCCCCCGCGCCGGGCCCGGCCGG + Intronic
1122081815 14:99272049-99272071 CCTGGCGCCGCGGGCCCGGGGGG + Intergenic
1122108645 14:99480457-99480479 GCGCGCGCCTCTCGCCCCGCAGG + Intronic
1122220854 14:100238626-100238648 TCACGCGCCGCGGGCCAGCCAGG + Intronic
1122220978 14:100239072-100239094 GCGGGCGCCGCGGCGGCGGCGGG - Exonic
1122505468 14:102229118-102229140 GCGCGGGCCGCGGGTGCGGCAGG + Exonic
1122517132 14:102317001-102317023 GCCAGCGGCGCCGGCCCGGCAGG + Intergenic
1122894755 14:104751499-104751521 GCGCACGGCGCGGGACTGGCGGG - Intergenic
1122947957 14:105021755-105021777 GCGCCTGCAGCAGGCCCGGCAGG + Intergenic
1123024836 14:105419736-105419758 GCGCGGGCCGCGGGCGGCGCGGG + Intronic
1123630741 15:22258202-22258224 GCGGGCGCCGCGGGCCGGGCGGG - Intergenic
1125608010 15:40953164-40953186 GTGCCCGCCCTGGGCCCGGCGGG + Exonic
1126102854 15:45130021-45130043 GAGGGCTCCGCGGGCCCAGCTGG + Exonic
1126766909 15:52019073-52019095 GCGCGCGCCGCGGAGGCGGTGGG - Intronic
1127165818 15:56243943-56243965 GTGCGGGCCGCGGGCGCGACGGG + Intergenic
1127433289 15:58933200-58933222 CCCCGCGCCCCGGGCCGGGCCGG - Intronic
1127982708 15:64046341-64046363 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1127982711 15:64046350-64046372 GCGGGCGCGGCGGGCGCGGCGGG + Intronic
1127982714 15:64046359-64046381 GCGGGCGCGGCGGGCGCGGCGGG + Intronic
1127982717 15:64046368-64046390 GCGGGCGCGGCGGGCGCGGCGGG + Intronic
1128067776 15:64775358-64775380 GAGCGCGGCGCCGGCCCCGCGGG + Exonic
1128374793 15:67066744-67066766 GCGCGGGCCGCGGGGGCGGGAGG - Intronic
1129162161 15:73752977-73752999 GGGCGAGCGGCGGGCCGGGCCGG + Intergenic
1129208701 15:74052885-74052907 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1129410794 15:75349217-75349239 GGGCGAGCCGGGGGCCAGGCGGG - Exonic
1129414622 15:75368357-75368379 GTGCCCGCCGCGGGCAGGGCAGG - Intronic
1129540258 15:76342572-76342594 GCGGGCGGGGCGGGCCCGGTGGG + Intergenic
1129710717 15:77819173-77819195 GCGCGCGCCGCGCCGCCGGCGGG + Intronic
1129827084 15:78641121-78641143 GCGCGCGCCTCATGGCCGGCGGG + Exonic
1129986962 15:79926460-79926482 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1130076632 15:80695395-80695417 GTGCCCGCCGCCGGCCCGGCTGG - Exonic
1130132936 15:81159007-81159029 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1131144503 15:90002244-90002266 GAGCGCGCCGCTGGCGGGGCTGG + Intronic
1131892116 15:96984149-96984171 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1132604633 16:788564-788586 GCGCGCGCCGCCGGGCACGCCGG + Intergenic
1132983678 16:2752589-2752611 ACGCGCGTCGCGGGGCCTGCCGG - Exonic
1133227859 16:4351112-4351134 GCGCCCCCTGCGTGCCCGGCGGG - Intronic
1133325035 16:4937087-4937109 GCGCGCACCGAGGGGCGGGCGGG + Exonic
1134290795 16:12901829-12901851 CCGCGCGCCGAGGGGCCGGCCGG - Exonic
1135429827 16:22374071-22374093 GCGGGATCCGCGGGCACGGCCGG + Intronic
1136364925 16:29805627-29805649 GCGCGCGCCGGGGGCACGGACGG - Intergenic
1137300498 16:47143884-47143906 ACGCGCGGCGCGGGACCGGCAGG + Exonic
1137426384 16:48384857-48384879 GCCCGGGAGGCGGGCCCGGCCGG - Intronic
1137442580 16:48509073-48509095 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1137788231 16:51153950-51153972 GTGCGCGCCGCGTGCGCAGCAGG + Intergenic
1138106506 16:54289696-54289718 GCGCGCGCCGCAGCGCCTGCAGG - Intergenic
1138471961 16:57245143-57245165 GCGCGCGCCGCCGACGCCGCAGG - Exonic
1138471966 16:57245158-57245180 GCGCGCGCAGAGGGCCAGGCGGG + Exonic
1138595201 16:58025995-58026017 GGGAGCGCCGCGGGACCGGGCGG + Exonic
1139477123 16:67208362-67208384 GCTCACGCTGCGGGCCCTGCAGG - Exonic
1139505132 16:67394812-67394834 GTGCACGCCGCTGGCCCTGCCGG - Exonic
1139603034 16:67998306-67998328 GAGCGGCCCGCGGGCCCTGCTGG + Intronic
1139664519 16:68447104-68447126 GCCTGCGCCGCGGGCTGGGCGGG - Intronic
1139826697 16:69762586-69762608 GGGCGCGCCGCGGCCCGCGCGGG + Intronic
1139890683 16:70251653-70251675 GAGCGCGGCGGCGGCCCGGCCGG - Exonic
1141132390 16:81445051-81445073 GCGCGTGCGGCGGGCTGGGCCGG - Intergenic
1141830848 16:86509490-86509512 TCGGGCGCCGCGGGCCTGACGGG - Intergenic
1141889552 16:86917651-86917673 GCGCTCGGCGCGGGACGGGCGGG + Intergenic
1141972304 16:87492371-87492393 GCGGGCGCCGCGGGCCGGGCGGG + Intergenic
1142136347 16:88453561-88453583 GCGGGCGGCGGGGGCGCGGCGGG - Exonic
1142417034 16:89948815-89948837 GTGAGCGGCGCGGGGCCGGCGGG + Intronic
1142631536 17:1229302-1229324 CCGGCCGCCCCGGGCCCGGCGGG + Intergenic
1142762546 17:2050614-2050636 GTGGGCGCCGCGGGACCCGCTGG + Intergenic
1142810696 17:2394242-2394264 GCGCGCGACCCGGGCCCCGGCGG - Intronic
1143030366 17:3964147-3964169 GCGCGCGGGCCGGGCCGGGCCGG - Intronic
1143664206 17:8347093-8347115 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1143747274 17:9003595-9003617 GCCCGGGGCGCGGGCGCGGCAGG - Intergenic
1144021078 17:11240781-11240803 GAGCGCGCTGCGGGGCCGGGCGG + Intergenic
1144107205 17:11997162-11997184 CTGCGCCCCGCGGGACCGGCCGG - Intronic
1144339975 17:14302692-14302714 CCGCGCGCCGCCCGCCCGCCAGG - Intronic
1145243594 17:21253290-21253312 CCGCGCGCCCCGGCCCCCGCCGG - Exonic
1145878140 17:28335339-28335361 GCTGCCGCCGCGGGGCCGGCAGG - Exonic
1146057694 17:29589423-29589445 GCGCGGGCGGCGGGCCCGGGCGG + Exonic
1146492653 17:33293231-33293253 CCGCGCGACGCTGGCGCGGCTGG + Intronic
1147429624 17:40363417-40363439 GCGCGCGCGGCGGGCGCGCAGGG + Exonic
1147643579 17:42020162-42020184 GCGAGCTCGGAGGGCCCGGCTGG + Intronic
1147994523 17:44353658-44353680 GCGCGCCCCGGGGGCCCGCGGGG - Exonic
1147994646 17:44354102-44354124 CCGCGCGCCGCCGGCCCGCGAGG - Exonic
1148016945 17:44528359-44528381 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1148090321 17:45019353-45019375 GCGAGCGCGGCGCGCCGGGCGGG + Intergenic
1148437118 17:47693825-47693847 GCGCGGGCCGCTGGCGCCGCAGG + Intergenic
1148549704 17:48543287-48543309 GCGCGCTGCGCGGGGCCGGCGGG - Exonic
1148562312 17:48613130-48613152 GCGCGCGGCGGCGGCGCGGCCGG + Exonic
1148697506 17:49570108-49570130 GAGCGCGCGGCGGGCGCGGCGGG + Intergenic
1148818272 17:50346115-50346137 GCGCGCCCCGCGTCCCGGGCAGG + Exonic
1149610505 17:57955265-57955287 GGCCGGGCCGCGGGCCGGGCGGG + Exonic
1149994614 17:61400091-61400113 GCGCGCGCCGCCGCCCGGGCCGG + Exonic
1150168389 17:62966314-62966336 GCGCGAGCCGCCCGCCCGGCGGG + Intergenic
1150239944 17:63622919-63622941 TCGCGCGCCGCGGCCCGGGCGGG + Intronic
1150643553 17:66964862-66964884 GCGGGCGCGGCGGGCCGGGCCGG + Intergenic
1150643595 17:66965072-66965094 GAGGTCGCCGCGGGCGCGGCGGG - Exonic
1150764681 17:67993742-67993764 GCGCCAGGCGCGGGCCCGGCGGG + Intergenic
1150778750 17:68101965-68101987 GGGGGCGCGGCGGGCCGGGCTGG + Intergenic
1150790603 17:68198182-68198204 GGGGGCGGGGCGGGCCCGGCTGG + Intergenic
1151625044 17:75271143-75271165 GCGCGCGCCACCGGCCCGGCAGG - Exonic
1151890413 17:76947964-76947986 GCACGCCCTGCGGGCCTGGCTGG + Exonic
1151938931 17:77281120-77281142 GCGGGCGCGGCGGGCCACGCAGG + Intronic
1152069802 17:78128835-78128857 GGGGGCGCCGCGGGCCGGGCCGG - Intronic
1152349792 17:79778170-79778192 GGGCGCGCGGCGGTCCGGGCGGG + Exonic
1152433322 17:80261072-80261094 GTGGGCGCCGCGGGCGGGGCTGG - Intronic
1152467971 17:80476421-80476443 GTGCGCGCGGCGCGGCCGGCCGG + Exonic
1152627334 17:81393701-81393723 CGGCGCTCCGCGGGCCGGGCCGG - Intergenic
1152654291 17:81512846-81512868 GCGCGCGCCGCCGGGCCGCGCGG - Intronic
1152801612 17:82333440-82333462 GCGTGCGTCGCAGGCCAGGCGGG - Intronic
1152824960 17:82458831-82458853 GTGAGCGCCGCGGGCCGGGGAGG + Intronic
1152924390 17:83080531-83080553 GCGCGCGCCGCGGCCAAGGGCGG - Intronic
1153006276 18:500810-500832 GCGCGGGCCGAGGGCGGGGCGGG - Intergenic
1153997529 18:10454833-10454855 CCGCGCGCCCCATGCCCGGCGGG - Exonic
1154218768 18:12434222-12434244 ATGCGCGGCGCGAGCCCGGCCGG + Intergenic
1155199353 18:23503595-23503617 GCGGGCGCCGCGCCCGCGGCGGG - Exonic
1156099733 18:33578719-33578741 GGGCGAGCGGCGGGGCCGGCGGG - Intronic
1156338112 18:36187495-36187517 GCGCACTTCCCGGGCCCGGCCGG + Intergenic
1157353988 18:46917116-46917138 GCGGGCGGCGCGGGGGCGGCGGG - Intronic
1157464414 18:47931140-47931162 GCGGGCGCCGCCGGTCCGGCCGG - Intronic
1157529539 18:48409502-48409524 GCCCGCGCCGCCGGCTCGGGGGG + Intronic
1157609645 18:48948665-48948687 CCGCGCTCGGCTGGCCCGGCTGG + Intronic
1157784463 18:50469526-50469548 GGGTGCCCCGCTGGCCCGGCTGG + Intergenic
1157849107 18:51030653-51030675 GCGGGGTGCGCGGGCCCGGCCGG - Intronic
1158434975 18:57428901-57428923 GGGCGTCCCGCCGGCCCGGCTGG - Intergenic
1158705685 18:59790430-59790452 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1160024714 18:75208491-75208513 GTGCGCGCGGGCGGCCCGGCGGG + Intronic
1160100501 18:75916248-75916270 GCGCTGGACGCGGGCCCGGCGGG - Intergenic
1160164129 18:76495356-76495378 GCTCGCGCCGGGGCCCCCGCGGG - Intergenic
1160453453 18:78980178-78980200 CCCCGCGCCGCGCGCCCGCCAGG + Intergenic
1160453763 18:78981279-78981301 GCGCGCCCCGCGGGGCCCCCAGG + Intronic
1160499755 18:79395852-79395874 GCGGGAGCCGCCGGGCCGGCGGG + Intronic
1160613946 18:80109688-80109710 GGGCGGGCCGCGGGCGCGTCGGG - Intronic
1160719194 19:590074-590096 GCGCGGGCCCGGGGCCCGGGGGG - Exonic
1160722939 19:605223-605245 GTGAGCGCCGCGGGCCCTGACGG + Intronic
1160738710 19:676336-676358 CCGCGGGCCGCGGGCGGGGCGGG - Intergenic
1160754671 19:751180-751202 GGGGGCGCCCCGGGCCGGGCCGG + Intronic
1160856327 19:1219444-1219466 GCGGGGGCCGGGGGCCAGGCAGG + Intronic
1160858977 19:1229707-1229729 GCGCGGGCTGCGGGGCCGGGCGG + Exonic
1160861233 19:1237973-1237995 GCGAGCGCAGCGGGGGCGGCGGG - Exonic
1160909900 19:1469559-1469581 GCGCGCGCCCGCCGCCCGGCCGG + Exonic
1160909973 19:1469833-1469855 TTGCGCGGCGGGGGCCCGGCCGG - Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161175629 19:2841011-2841033 GCGGGCGGCCCGGGCCTGGCAGG - Intergenic
1161265116 19:3360215-3360237 GAGCGCGCCGCGGCCGCCGCCGG + Intronic
1161401187 19:4066751-4066773 GCGAGCGCCGCGGACCCCGGAGG - Exonic
1161443313 19:4304705-4304727 GCGGGGCCCGCGGGCCGGGCCGG + Exonic
1161925067 19:7293925-7293947 GCGCGCGGCGCTGGCCCGCGGGG + Exonic
1161959552 19:7516203-7516225 GCGGCCGGCGCGGGCGCGGCGGG + Exonic
1161959556 19:7516212-7516234 GCGGGCGCGGCGGGCCGGGCAGG + Exonic
1162914138 19:13865357-13865379 GCAGGCGCCTCGGGCCCGGGGGG + Intronic
1163012242 19:14433441-14433463 GCGTGCGCCCCGGGCGTGGCGGG - Intronic
1163218919 19:15900069-15900091 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1163807064 19:19405866-19405888 GCGAGCGCCGCGGGCCCGGGCGG + Intronic
1164639337 19:29812585-29812607 GCCCGCGCCGCGGGGCCGGACGG + Intronic
1164643925 19:29844711-29844733 GCGCGCGCCGCGGGAGGGGCAGG + Intergenic
1165079989 19:33301658-33301680 GCGCGCTGCCAGGGCCCGGCAGG + Exonic
1165129443 19:33622659-33622681 GCGAGCGCCGAGGGCCAGGCAGG + Intronic
1165157267 19:33796247-33796269 CCGGGCGCCGCGTGGCCGGCCGG + Intronic
1165459515 19:35936462-35936484 GCCCCCGCCTCGGCCCCGGCGGG + Intronic
1165745988 19:38229647-38229669 GCGGGCGGCGCAGGCCGGGCTGG - Intronic
1165816874 19:38647910-38647932 GCGCGGCCCGCGGGCCGGACGGG + Intronic
1166091583 19:40512815-40512837 GCGGGCGCAGCGGGCGCAGCGGG + Exonic
1166294651 19:41883113-41883135 GCCCGCGCCCCGCGCCCGCCCGG - Intergenic
1166358705 19:42242601-42242623 GCGCCCGCCGCGGGGCACGCCGG + Intronic
1166367390 19:42284435-42284457 GCGCGCGCCGGGGGGCGGGGCGG + Intronic
1166375695 19:42325751-42325773 GCTCGCGCCCCGCCCCCGGCTGG + Intronic
1166694485 19:44844898-44844920 CCGCGCTGCGCTGGCCCGGCCGG - Intergenic
1166706053 19:44908641-44908663 GCAGGCGGCGCAGGCCCGGCTGG + Exonic
1166785291 19:45363703-45363725 GCGCGGGGTGGGGGCCCGGCAGG - Intronic
1167007933 19:46787594-46787616 GAGCGCGCCGGGGTCCAGGCTGG + Exonic
1167040331 19:47019931-47019953 GGGCGCGGCGTGGGGCCGGCCGG - Exonic
1167743917 19:51340134-51340156 GCGGGCACCGCGGCCTCGGCCGG + Exonic
1168636775 19:58002822-58002844 GAGCGCGCCGCGGGGTCTGCTGG + Exonic
925098907 2:1229573-1229595 GCGCACGGCGCGGGACTGGCAGG - Intronic
925537741 2:4935289-4935311 GCGCACGGCGCGGGACTGGCAGG - Intergenic
926139511 2:10359898-10359920 GCGGGCGCTGTGGACCCGGCGGG - Intronic
926139517 2:10359916-10359938 GCGGGCGCTGTGGACCCGGCGGG - Intronic
926980192 2:18560319-18560341 GCGCGCGCCGAGGAGGCGGCGGG - Exonic
927215774 2:20667205-20667227 GCCCGCGCCGCCCGCCCGCCCGG + Exonic
927606427 2:24491046-24491068 CCTCGCTCGGCGGGCCCGGCAGG + Intergenic
927606430 2:24491055-24491077 GCGGGCCCGGCAGGCCCGGCGGG + Intergenic
931355817 2:61537422-61537444 GGGCGGGCCGGGGGCGCGGCGGG - Intronic
932567356 2:72918150-72918172 GCGCCCGCGGCGGCCGCGGCAGG - Exonic
932621899 2:73269634-73269656 CCGCGTGCCGCGGGGGCGGCGGG - Exonic
932699768 2:73984812-73984834 CCGAGCCCCGCCGGCCCGGCCGG - Intergenic
934079012 2:88452156-88452178 CCGGGCCCCGCGGGCGCGGCGGG + Exonic
934079018 2:88452165-88452187 GCGGGCGCGGCGGGCGAGGCGGG + Exonic
934079021 2:88452174-88452196 GCGGGCGAGGCGGGCGCGGCGGG + Exonic
934966906 2:98731226-98731248 GCGCGGGGCGCGGGGCCCGCGGG - Intergenic
935237486 2:101151054-101151076 CTGGGGGCCGCGGGCCCGGCGGG + Intronic
936104825 2:109614814-109614836 TCGCGCGCCTCGGGCCCGGCAGG - Exonic
936278668 2:111120582-111120604 GCGCACGCCGCGGCCGCCGCCGG + Intronic
936346959 2:111682236-111682258 GCGCACGGCGCGGGACTGGCAGG + Intergenic
937624191 2:124025208-124025230 GAGCGCGGGGCGGGCCTGGCTGG + Intergenic
938397771 2:130963678-130963700 GTGCGGGTCGCGGGCCCGGTCGG - Intronic
939153828 2:138501824-138501846 CCCCCCGCCGCGGGCCCGTCTGG - Exonic
942799654 2:179861107-179861129 GCGCGGGCCGCGGGCGCGTGGGG + Exonic
942890300 2:180980396-180980418 GAGCGCGGCGGGGACCCGGCGGG - Intronic
942965779 2:181891672-181891694 GCGCCCCGCGCGGCCCCGGCCGG + Intergenic
943645877 2:190408028-190408050 GCGTGCTCCCCGGGCCCGGCTGG + Intergenic
944221684 2:197310293-197310315 GCGGCGGCCGCGGGCCCGGCGGG - Intronic
944831191 2:203535232-203535254 GCGCGCGGCGCGGGAGCTGCTGG - Exonic
946921311 2:224584805-224584827 GCTCGCGCCCCGCGGCCGGCGGG + Intronic
947353625 2:229271294-229271316 GCGCGCTCGCCGGGCCCGGGCGG - Intergenic
947549632 2:231037377-231037399 GCCCGCATCGCGGGCCCGGGTGG - Intergenic
947605625 2:231483604-231483626 GCGCGCGGCGAGGCCCGGGCGGG + Intronic
947800938 2:232928219-232928241 GCGCGCGGCGGGGGCGAGGCCGG + Intronic
947860500 2:233354482-233354504 GCGCGCACCGCGGGCGGGGGCGG - Intergenic
948115857 2:235494068-235494090 CCGCCCGCCGCCTGCCCGGCCGG - Intronic
948140491 2:235669541-235669563 CCGCGGGCCGCGCGCCCAGCCGG - Intronic
948645259 2:239400516-239400538 CCGCGCGCCGTGGGACCCGCCGG - Exonic
1169132534 20:3173533-3173555 GCCCGCGCAGCGCGCCCCGCCGG - Exonic
1169164111 20:3407678-3407700 GCGCGGCGCGCGGGCCCGGCGGG + Intergenic
1169214811 20:3786715-3786737 GCGGGCGGCGCGGGCGCGGAAGG + Intergenic
1169367191 20:5001267-5001289 GGCCGCGCCGCGGGGCCGGTGGG + Intronic
1169849258 20:10032064-10032086 GCGCACGGCGCGGGACTGGCAGG + Intronic
1170026077 20:11891027-11891049 GCGCGCGCCCTGCGGCCGGCCGG + Intronic
1170649569 20:18227150-18227172 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1170889994 20:20368504-20368526 GCGCGGCCCGCGGGCCCTGCGGG - Exonic
1172100689 20:32482991-32483013 GTGCGCGCCGCGGGTCCTGGGGG - Intronic
1172118436 20:32584541-32584563 GCGCGCGCGGCGGCCGCGGGCGG - Intronic
1172277177 20:33686101-33686123 GCGGGCGCCGCGGGGCCGGTGGG + Exonic
1172661790 20:36573645-36573667 GCGCGCGCCGCGTACCTGCCCGG - Exonic
1173494356 20:43507930-43507952 GAGCGCGCAGGGGGCCAGGCGGG + Intronic
1173516239 20:43667257-43667279 GAGCGCGGCGCGGTCCGGGCCGG + Exonic
1173672916 20:44810422-44810444 GCGGGCGCGGCGGGGCCGGCGGG + Intergenic
1173778837 20:45736277-45736299 GCGCATGGCGCGGGACCGGCAGG + Intergenic
1174246886 20:49188248-49188270 GCGGGCGCCGCCGGGCCGGGGGG + Exonic
1174373967 20:50113080-50113102 GCGGGGGCGCCGGGCCCGGCCGG - Intronic
1175215320 20:57389383-57389405 GCGGGCGAGGCGGGCCCGGGCGG + Intergenic
1175215749 20:57391146-57391168 GCTGCCCCCGCGGGCCCGGCCGG - Intergenic
1175267004 20:57709323-57709345 GGGCGCGCCCGGGGCGCGGCGGG + Intronic
1175374447 20:58514790-58514812 GCGGGCGCCGGCGGCCAGGCTGG + Exonic
1175421071 20:58834086-58834108 GAGCGCGCCTCGAGCCCGGAGGG - Intergenic
1175428745 20:58888782-58888804 GCGCGCGCCGCTGGGAGGGCGGG + Intronic
1175439545 20:58981196-58981218 CCGCGCGCCTCGGCCCGGGCGGG - Exonic
1175715485 20:61252352-61252374 GCGAGCGCGGCGGGCGCAGCGGG + Intergenic
1175847212 20:62065311-62065333 GCCAGCGCGGCGGGGCCGGCGGG + Exonic
1175847261 20:62065443-62065465 GCGGGCGGCGCGGGCCCTGCGGG + Exonic
1175859490 20:62142878-62142900 GCGCGACCCACGCGCCCGGCCGG + Intronic
1175902941 20:62367134-62367156 GGGCGCGGCGCGGGCGCGGGAGG - Exonic
1175902988 20:62367287-62367309 GCGCGCGGCGGGAGCCCGGCGGG + Exonic
1175911468 20:62407209-62407231 GCGGGTGGCGGGGGCCCGGCGGG + Exonic
1176048052 20:63102810-63102832 GGGCGCGCAGCGGGGCCGGGTGG - Intergenic
1176125378 20:63472590-63472612 GCGCGCGGCCCAAGCCCGGCAGG - Exonic
1176237970 20:64063098-64063120 GCGGGCGCGGCGGGCGCGGCAGG + Intronic
1176382002 21:6118341-6118363 GCGCCCGCCCCGGGCCTGCCAGG + Exonic
1176414790 21:6468036-6468058 GCGTGTGTCGCGGGCCCGGGAGG + Intergenic
1176547887 21:8209265-8209287 GCGCGCGCCCCGGCGCCCGCGGG - Intergenic
1176548414 21:8211735-8211757 GCGCGTGTCGTGGGGCCGGCGGG + Intergenic
1176550500 21:8218959-8218981 GTGCGTGCGGGGGGCCCGGCGGG + Intergenic
1176556306 21:8255941-8255963 GCGCGTGTCGTGGGGCCGGCGGG + Intergenic
1176567345 21:8394770-8394792 GCGCGTGTCGTGGGGCCGGCGGG + Intergenic
1176569430 21:8401998-8402020 GCGCGTGCGGGGGGCCCGGCGGG + Intergenic
1176575245 21:8438983-8439005 GCGCGTGTCGTGGGGCCGGCGGG + Intergenic
1176577342 21:8446229-8446251 GTGCGTGCGGGGGGCCCGGCGGG + Intergenic
1179133621 21:38660759-38660781 GTGCGCGCCGGGGGCGGGGCAGG + Intronic
1179375477 21:40846806-40846828 GGCCGCGCCGCGTGCCCGGGCGG - Exonic
1179479906 21:41670421-41670443 GCGTGCGGGGCGTGCCCGGCTGG + Intergenic
1179512050 21:41879486-41879508 GCGCGCGGGGCGGGTCTGGCCGG + Intergenic
1179690290 21:43076358-43076380 GCGTGTGTCGCGGGCCCGGGAGG + Intronic
1179741470 21:43419898-43419920 GCGCCCGCCCCGGGCCTGCCAGG - Exonic
1179893702 21:44350283-44350305 GCCCTCGCCCCGGCCCCGGCGGG - Intronic
1180086517 21:45510145-45510167 GCGCGGGCCGTGGGGCTGGCGGG + Exonic
1180736999 22:18024550-18024572 GCGCGCGCTGCTGGCTGGGCGGG + Exonic
1180755156 22:18155873-18155895 GCGCACGGCGCGGGACTGGCAGG + Intronic
1180876845 22:19178657-19178679 GCGCGGGGCGCGGGCATGGCGGG + Exonic
1181147535 22:20859204-20859226 GCGGGCGCGTCGGGCCCGTCGGG - Exonic
1182664096 22:31944823-31944845 GAGCGCGCCGGGAGCCCGGGCGG + Intronic
1183452967 22:37906591-37906613 GCGGGCGGCGCGGGGCGGGCTGG + Intronic
1183546292 22:38456049-38456071 CTCCGCGCCGCGGGCCCCGCGGG - Intergenic
1183586402 22:38755601-38755623 GCGCGGGCCGCGGACCCGGGTGG + Intronic
1183667382 22:39253667-39253689 GCCCGGGCCGCCGCCCCGGCAGG + Intergenic
1183788376 22:40045095-40045117 GCGCGCGGCGCGGCCCGGGGCGG + Intronic
1183924664 22:41197400-41197422 GAGCGCGGCGCGGGCCAGCCGGG - Intergenic
1183990424 22:41593904-41593926 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1184412223 22:44331860-44331882 GCGCGGGGCTCGGGGCCGGCGGG - Intergenic
1184439084 22:44497926-44497948 GCGCCCGCCCCGCGCCCGCCCGG + Intronic
1184620465 22:45672365-45672387 GCGCCCGCCCCAGGCCCCGCGGG - Intronic
1184676252 22:46044974-46044996 GAGCGCGCCGCGGTCCAGGCGGG - Intergenic
1184759404 22:46536465-46536487 GCCGGCGCGACGGGCCCGGCGGG - Exonic
1185055230 22:48575768-48575790 TCGATCGCCGCGGGCTCGGCCGG + Intronic
1185413501 22:50697773-50697795 GCGCGCGGTGCTGGCCGGGCCGG + Intergenic
1203253296 22_KI270733v1_random:128038-128060 GCGCGTGTCGTGGGGCCGGCGGG + Intergenic
1203255397 22_KI270733v1_random:135300-135322 GTGCGTGCGGGGGGCCCGGCGGG + Intergenic
1203261351 22_KI270733v1_random:173117-173139 GCGCGTGTCGTGGGGCCGGCGGG + Intergenic
950404564 3:12796693-12796715 CTGCGCGCCGCGGAGCCGGCCGG - Exonic
950509919 3:13420015-13420037 GCGGGCGCCGTGGGCCGGGCTGG - Intronic
951078691 3:18425775-18425797 GCGCGCGGCGCGCGGGCGGCAGG + Intronic
951332888 3:21387226-21387248 GCGCACGGCGCGGGACTGGCAGG - Intergenic
952058021 3:29473479-29473501 GCGCACGGCGCGGGACTGGCAGG - Intronic
953027438 3:39153252-39153274 TCGGGGGCCGGGGGCCCGGCCGG - Intronic
953099265 3:39809498-39809520 GCGCGTGCAGGGCGCCCGGCGGG - Intronic
953165072 3:40457552-40457574 GAGCGCGTGGAGGGCCCGGCAGG + Intronic
953447369 3:42979605-42979627 GAGCGCGCCGAGGAGCCGGCCGG + Exonic
954333560 3:49903536-49903558 TCGCCCGCCGCGGGCTTGGCAGG + Exonic
954632882 3:52056524-52056546 GTGCGCGCGGAGGGCCGGGCGGG - Exonic
954812308 3:53255799-53255821 GCCCGAGCCGCGTCCCCGGCCGG + Intronic
956678027 3:71753681-71753703 GCGGCGGCGGCGGGCCCGGCGGG + Intronic
957804834 3:85133835-85133857 GCGCACGGCGCGGGACTGGCAGG - Intronic
957829941 3:85504650-85504672 GCGCACGGCGCGGGACTGGCAGG - Intronic
958810695 3:98857947-98857969 GCGCACGGCGCGGGACTGGCAGG - Intronic
961340423 3:126213522-126213544 GCGCGCTGCCCGGGCCCCGCAGG + Intergenic
961736293 3:129003946-129003968 GCGCGCGGAGGAGGCCCGGCAGG + Exonic
962222336 3:133574129-133574151 GCGAGTGCCGCGGGCGCAGCGGG + Exonic
962283681 3:134070235-134070257 GCGCACGGCGCGGGACTGGCAGG - Intronic
963035163 3:141019499-141019521 GCCCGGGCCGCGGGCGCAGCTGG - Intergenic
963168170 3:142225628-142225650 GCGCGCGCCGGCGGCCGCGCGGG + Intergenic
963651759 3:147989351-147989373 GCGCACGGCGCGGGACTGGCAGG - Intergenic
964014454 3:151928542-151928564 GCGCACGGCGCGGGACTGGCAGG + Intergenic
964117902 3:153155723-153155745 GCGCACGGCGCGGGACTGGCAGG - Intergenic
964118972 3:153162650-153162672 GCGCCTGCCGCGGCCCCGTCGGG - Exonic
965200276 3:165649291-165649313 GCGCACGGCGCGGGACTGGCAGG - Intergenic
966725359 3:183103721-183103743 GCGCACGGCGCGGGACTGGCAGG - Intronic
966860692 3:184229775-184229797 GCGCGGGCCGCGGCCACTGCAGG + Intronic
966886526 3:184380380-184380402 GCCGGCGCCGCGGGCCGGCCGGG - Exonic
967858339 3:194134534-194134556 GCGGGCGCCCAGGGCCCCGCGGG + Intergenic
967859589 3:194141278-194141300 GCCCCCGCCGCGCGCCCGCCGGG + Intergenic
967880806 3:194299894-194299916 GCGGGAGCCGCCCGCCCGGCCGG + Intergenic
968010438 3:195270850-195270872 GCGGGCGGCGAGGGCGCGGCGGG + Exonic
968093009 3:195909681-195909703 GCGCGGGGCGGGCGCCCGGCGGG - Intronic
968506530 4:973590-973612 GCGCGGGCCGCGGGGCGGGGCGG + Intronic
968660024 4:1795001-1795023 GCGGGCGCGGCGGGCCGGGGAGG + Intronic
968756483 4:2418696-2418718 CCGCGCGCTGCGGGCGGGGCGGG + Intergenic
968787147 4:2631064-2631086 GCGCTTGCGGCGGGCCCTGCAGG - Exonic
969344728 4:6563625-6563647 GCGGGCGCGGCGGGCGCGGCGGG + Intergenic
969379420 4:6783692-6783714 GCGCGGGGGGCGGGCCTGGCGGG + Intronic
969417188 4:7068357-7068379 GCGCGCGTCGCGGGCCGGGAGGG + Intergenic
969715855 4:8867796-8867818 GGGGGCGGCGCGGGCGCGGCGGG + Exonic
969716687 4:8871378-8871400 TCGCGGGCACCGGGCCCGGCGGG - Exonic
969737353 4:9000634-9000656 GCGCGCACCGCGGACACGCCGGG - Intergenic
969796561 4:9532222-9532244 GCGCGCACCGCGGACACGCCGGG - Intergenic
971030759 4:22634823-22634845 GCGGGCTCGGCGGGCCCCGCGGG + Intergenic
971244140 4:24913110-24913132 GGGCGCGGGGCGGGCCCGGCGGG - Intronic
973894238 4:55396163-55396185 CCGTGCGCGGCCGGCCCGGCAGG + Exonic
974055392 4:56978218-56978240 GCGTGAGCCACGCGCCCGGCCGG - Exonic
975870683 4:78776074-78776096 GCGGGCGGCGCGGGTTCGGCCGG + Intergenic
976743391 4:88379266-88379288 CTGGGCGCCGCGGGCCAGGCAGG + Intronic
977607232 4:98995582-98995604 GCGCGCTGCGTGGTCCCGGCCGG + Intergenic
978080321 4:104582367-104582389 GCGCACGGCGCGGGACTGGCAGG + Intergenic
980913702 4:139015739-139015761 GCGCTCGCCGGGCGCCCTGCAGG + Intergenic
981146652 4:141332992-141333014 GCGCACGGCGCGGGACTGGCAGG - Intergenic
983940197 4:173529333-173529355 GCCCGGGCCGAGGGCGCGGCGGG - Exonic
984966366 4:185143513-185143535 GCGGGCGCGGCGGGCCGGGCGGG + Intronic
985723050 5:1500870-1500892 GCGGGTGCCGTGGGCCCGGGAGG - Intronic
985844596 5:2334903-2334925 GCCTGGGCAGCGGGCCCGGCAGG - Intergenic
986695881 5:10353973-10353995 TCGAGCGCCGCGGACCTGGCCGG - Intronic
987340446 5:16935471-16935493 GCGCGCGCCGGGGCGCGGGCGGG - Intronic
987896362 5:23951683-23951705 GCGCGCGGCGCGGGACTGGCAGG + Exonic
988547659 5:32173785-32173807 GCGGGCGCGGCGGGCTGGGCGGG - Intronic
988726955 5:33936061-33936083 CCTCGCGGCGCGGGCGCGGCTGG + Intergenic
989178853 5:38556635-38556657 CCGCGCGCCGCAGTCCCGGCTGG - Intronic
989643239 5:43603332-43603354 GCGCGCGCCTAGGGCGCAGCTGG + Intronic
990461590 5:56035876-56035898 GCGCACGCCGCAGGACTGGCAGG + Intergenic
992124358 5:73626012-73626034 GCGGCCGCCGCGAGCCGGGCCGG + Intergenic
992296806 5:75334072-75334094 GCGCACGGCGCGGGACTGGCAGG + Intergenic
992939512 5:81750032-81750054 GCGGGAGGGGCGGGCCCGGCGGG - Intronic
994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG + Intronic
995048153 5:107672380-107672402 GCGCGGGACGCGGGACGGGCGGG + Intergenic
997453978 5:134004486-134004508 GCGGCCGGCGCGGGCCTGGCTGG - Intronic
997654430 5:135544767-135544789 GCACGCCCCGCGGCCCGGGCTGG + Intergenic
998331622 5:141332562-141332584 GCGCACGGCGCGAGCCCTGCTGG + Exonic
998332447 5:141340849-141340871 GCGCACGGCGCGAGCCCTGCTGG + Exonic
998333003 5:141345911-141345933 GCGCACGGCGCGAGCCCTGCTGG + Exonic
998336414 5:141375961-141375983 GCGCACGGCGCGCGCCCTGCTGG + Exonic
998337358 5:141384777-141384799 GCGCACGGCTCGGGCCCTGCTGG + Exonic
998338431 5:141394691-141394713 GCGCACGGCGCGAGCCCTGCTGG + Exonic
998340707 5:141415065-141415087 GCGCACGGCGCGAGCCCTGCTGG + Exonic
998342791 5:141432637-141432659 GCGCACGGCGCGAGCCCTGCTGG + Exonic
1000318882 5:160118663-160118685 GCGCGCGCCACGCGCCGCGCAGG + Intronic
1001818701 5:174693056-174693078 GCGCGGGCCCCGAGCCCAGCGGG + Intergenic
1002559434 5:180071656-180071678 GCGAGCGCGGCGAGCCGGGCAGG + Exonic
1002691364 5:181052982-181053004 GGGCGCGCCGCGGGGCGTGCGGG - Intronic
1002906958 6:1456944-1456966 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1003049331 6:2765752-2765774 GCGGGCTCCGCGTGCCCCGCCGG - Exonic
1003139394 6:3457518-3457540 GCGCGGGCAGCGGGACCGCCGGG - Intergenic
1003290489 6:4775722-4775744 GCCCGGGCCGCGCGCCCCGCGGG - Intronic
1003736966 6:8887552-8887574 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1003748083 6:9024653-9024675 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1003770080 6:9290417-9290439 GCGCACGGCGCGGGACCGGCAGG - Intergenic
1003885494 6:10517842-10517864 GCATGAGCCGCTGGCCCGGCTGG + Intronic
1004224463 6:13772876-13772898 GCGCACGGCGCGGGACTGGCTGG + Intergenic
1004272865 6:14211035-14211057 GGGCGCGCCACGGGCCCGGTGGG - Intergenic
1004627929 6:17393942-17393964 GCGCGGGGCGCGGGCGCGGGCGG + Intronic
1005596139 6:27381041-27381063 GCGCACGGCGCGGGACTGGCAGG - Intronic
1005913028 6:30327118-30327140 CCGCCCGCCTCGGGCCCGGGCGG + Intronic
1006472681 6:34237399-34237421 GCGCGCGCTGCAGCCCCGGGCGG - Intronic
1006860696 6:37170101-37170123 GCGCGCGGGGAGGGCGCGGCGGG - Intergenic
1007451270 6:41941598-41941620 GCACGCGCCCCGGGCCGGGCCGG - Exonic
1007722176 6:43891554-43891576 GCGGGCGCCCAGGGCCGGGCGGG + Intergenic
1008027391 6:46653322-46653344 GCGCGTGCCACTGGCCCGGGAGG - Intronic
1008378695 6:50819899-50819921 GGGCGCGCGGCGGGCCAGGCTGG + Intronic
1008545128 6:52577132-52577154 GTGCGGGCCGCGGGCTGGGCGGG - Intergenic
1010703322 6:79077824-79077846 GCGCGCGGCGCGGGCCGGGCCGG - Intronic
1011193702 6:84762620-84762642 GCCCTCGCCGCAGGCCCCGCGGG - Exonic
1012939668 6:105403214-105403236 CCGGGCGGCGCGGGCGCGGCCGG - Intergenic
1012997976 6:105992632-105992654 GCGCGCGGCGAGGGCCCGCTGGG - Intergenic
1013803469 6:113971523-113971545 CCACGTGCCGCGAGCCCGGCGGG + Intronic
1014507831 6:122280967-122280989 GCGCGCGGCACGGGACTGGCAGG + Intergenic
1015149231 6:130019868-130019890 GCGCGGGCCGCGGGCCGGGCCGG + Intronic
1016092757 6:139999557-139999579 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1016400726 6:143677814-143677836 GCGGGTGCGGCGGGGCCGGCTGG + Intronic
1016590166 6:145735353-145735375 TCGCCCGCCGCGGTGCCGGCCGG + Exonic
1016996216 6:149963949-149963971 CTGCGCGCGGCGGGCCGGGCTGG + Intergenic
1017662381 6:156687313-156687335 CCGCGCGCCCCGCGCCGGGCGGG - Intergenic
1017672044 6:156777942-156777964 GCGGGCGCCGCGGCCGCCGCCGG + Exonic
1017793753 6:157823454-157823476 GCGCGCGGCGCAGGCCGGGCCGG + Intronic
1017839424 6:158209724-158209746 GCGCACGGCGCGGGACTGGCGGG - Intergenic
1017877544 6:158536919-158536941 GGGCGCGCCGGGGTCCCGGAGGG - Intronic
1018696125 6:166393325-166393347 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1018956396 6:168413170-168413192 GTGAGCGCGGCGGGCCCTGCGGG + Intergenic
1018956431 6:168413298-168413320 GTGAGCGCGGCGGGCCCTGCGGG + Intergenic
1018960086 6:168441628-168441650 GTGCGCGCCTGGGACCCGGCTGG + Intronic
1019352505 7:561604-561626 GCCCGCTCCTCAGGCCCGGCTGG + Intronic
1019381605 7:727059-727081 GCGCGGGCAGCAGGCGCGGCAGG - Exonic
1019381611 7:727078-727100 GCGCTCGCCGCGCGCTTGGCCGG + Exonic
1019472666 7:1229735-1229757 GCGCGCGCGCCCGGCCCAGCCGG - Intergenic
1019474173 7:1236156-1236178 GCGCACGCCTCGGGCGCCGCGGG + Exonic
1020085551 7:5308306-5308328 GCGCGCGCTGCGGGCACGCGGGG + Exonic
1020162213 7:5781383-5781405 GCGCGGGCCGAGGCCCGGGCGGG - Intronic
1020225009 7:6272748-6272770 GCAGACGCCGCCGGCCCGGCCGG - Intergenic
1020270119 7:6589903-6589925 GGGCGCGCCGCGGTCCCAGGTGG - Intergenic
1020274340 7:6615614-6615636 GTGCGGGCCGCTGGCCGGGCCGG - Exonic
1020278232 7:6637291-6637313 GCGGGCGGGGCGGGGCCGGCCGG + Intergenic
1021731261 7:23597629-23597651 GCGAGAGGTGCGGGCCCGGCTGG - Intronic
1021828004 7:24573629-24573651 GGTCGCGCCGCGCGCCGGGCCGG + Intronic
1022089143 7:27096467-27096489 GGGCGCGCTGCGGGCTGGGCCGG - Intergenic
1024262418 7:47582207-47582229 GCCCGCGCCCCGAGCCTGGCGGG + Intronic
1024639396 7:51316963-51316985 ACGCTCGCCGCGGGCCGGGTCGG - Intergenic
1026048024 7:66921422-66921444 CTGCGCGCCCCGGGCCCAGCCGG - Exonic
1026458882 7:70596156-70596178 GGGCGCTCCGCGGGCCGGGGCGG + Intronic
1026471138 7:70694684-70694706 CCGCGCGCCGCAGGAGCGGCGGG + Intronic
1027138242 7:75639303-75639325 GCGCGCGCCGGGGGCGGGGGAGG + Intronic
1027421136 7:78019425-78019447 CCGGGGGTCGCGGGCCCGGCCGG + Exonic
1027561743 7:79739688-79739710 GCGCACGGCGCGGGACCGGCAGG + Intergenic
1028231059 7:88306836-88306858 GTGCGCGCCGCGGGCCGGGCGGG + Exonic
1031372885 7:120988718-120988740 GCGCCCGCTGCACGCCCGGCGGG - Exonic
1031378860 7:121060322-121060344 GCGCACGGCGCGGGACTGGCAGG + Intronic
1032074567 7:128830335-128830357 CCGGGGGCCGCGGGCGCGGCGGG + Intergenic
1032090803 7:128910600-128910622 GCGCTGGCCGCGGGCGCGGAAGG - Exonic
1032090868 7:128910828-128910850 CCACCCGCCCCGGGCCCGGCCGG + Intergenic
1032561536 7:132898580-132898602 GCGCACGGCGCGGGACTGGCAGG - Intronic
1033220456 7:139523828-139523850 GCGCGCCCTGCGGGCCCCCCAGG - Intergenic
1033299643 7:140175773-140175795 GCGGACGCTGCGGGGCCGGCTGG - Intronic
1034167688 7:149038672-149038694 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1034508931 7:151519233-151519255 GCGCCCTCCGCGGGCCGGGCGGG - Intronic
1034632073 7:152538861-152538883 GCGCGCGGCGCAGGACTGGCGGG - Intergenic
1034911714 7:155003095-155003117 GCGCTCGGCGCGGGCGCGGGCGG - Intergenic
1035833974 8:2728184-2728206 GCGCACGACGCGGGACTGGCCGG + Intergenic
1036830286 8:12015234-12015256 GCGCGCACCGCGGACACGCCGGG + Intronic
1037263776 8:17036791-17036813 GCGCACGGCGCGGGACTGGCAGG - Intronic
1037815356 8:22109097-22109119 GCGCGCTCCCGAGGCCCGGCGGG + Intronic
1038644945 8:29353070-29353092 GCGCCAGGCGCGGGTCCGGCGGG - Intergenic
1038963635 8:32548542-32548564 GAGCGCGGCGCGGACGCGGCGGG - Intronic
1039512811 8:38105347-38105369 GCGGTGGCCGCGGGCCTGGCAGG - Exonic
1039903168 8:41767293-41767315 CCCCGCGCCCCGGCCCCGGCCGG + Intronic
1039947151 8:42140086-42140108 GAGCGCGACGCGCGCCCGCCTGG - Intergenic
1039948944 8:42153036-42153058 GCGCGCGCGGCGGGCGGGGCGGG + Exonic
1040701753 8:50074891-50074913 GCGTGCGCCGCGAGTGCGGCCGG - Intronic
1041059436 8:54022031-54022053 GCGAGCGGCGCGGGCCGGGAGGG - Intronic
1041107655 8:54458301-54458323 GCTCGGCCCGCGGCCCCGGCCGG - Exonic
1041108913 8:54467352-54467374 GCTCGGCCCGCGGCCCCGGCCGG - Intergenic
1041552763 8:59119504-59119526 GCGAGCGTCCCGGGCCGGGCGGG + Intergenic
1041918996 8:63162376-63162398 GCGCACGACGCGGGACTGGCAGG + Intergenic
1042155420 8:65840914-65840936 GCGAGCGCCGCGGGGCGCGCGGG + Intronic
1042903020 8:73746935-73746957 GCGCGCGGCGCGAGCGCGGGAGG - Exonic
1042962873 8:74321513-74321535 GCGCGCGGCGCTGGCCCAGGCGG - Intronic
1044229460 8:89757774-89757796 GCGCGCGCCGGGGGGAGGGCCGG + Exonic
1044248996 8:89984527-89984549 CTGCCCGCCGCGGGCCCGGCAGG - Exonic
1044698858 8:94949047-94949069 GGGCGCGCGGCCGGCCCCGCCGG + Intronic
1045231421 8:100310214-100310236 CCGCCCGCAGCGGGCCCGGTGGG - Intronic
1045510866 8:102810889-102810911 CCGCTCGCCGAGCGCCCGGCAGG - Intergenic
1048009299 8:130443417-130443439 GCGCGCTCGGCGGGGCCGGGCGG - Intronic
1048655349 8:136530426-136530448 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1048789243 8:138084522-138084544 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1049237172 8:141518209-141518231 GGGGGCGCCGCGGGACCTGCGGG - Exonic
1049457336 8:142700395-142700417 GCGCGCGCCCCGGGGCGGGCGGG + Exonic
1049463184 8:142739461-142739483 GCGCGCGCAGCTGGGCCGCCTGG - Intergenic
1049585397 8:143430490-143430512 CCGCGGGCGGCGGTCCCGGCGGG + Intergenic
1049746825 8:144266536-144266558 GCGGCCGCCGCGGGCCTCGCGGG - Intronic
1051174013 9:14346114-14346136 GGGCGCGCCGCGGGCGCGGGGGG + Intronic
1052996728 9:34555192-34555214 GCGCGGGCAGCTGGCCAGGCGGG + Intronic
1053547845 9:39042331-39042353 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1055461394 9:76523702-76523724 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1056386256 9:86099502-86099524 GCGCACGGCGCGGAGCCGGCCGG - Exonic
1057139732 9:92719138-92719160 CCGCGAGCTGCTGGCCCGGCTGG - Exonic
1057208078 9:93184981-93185003 GGGCGCGGCGCGGGGCCCGCGGG + Exonic
1057488937 9:95507372-95507394 GCGCTGGCCGCGGCCCCGGCGGG + Intronic
1057628565 9:96700862-96700884 GCGCCCGGCGCGGGACTGGCAGG - Intergenic
1057773027 9:97984039-97984061 CCGCGCGCCCCGGGCCGGCCGGG + Intronic
1059102499 9:111483926-111483948 GGGCGCGCGAGGGGCCCGGCGGG - Intronic
1059145697 9:111897177-111897199 GCGGCCGCAGCGGGCCGGGCCGG + Exonic
1059375169 9:113875998-113876020 GGGCGCGCCCCTGGACCGGCCGG + Intergenic
1060087410 9:120714703-120714725 GGGGCCGCCGCGAGCCCGGCGGG - Intergenic
1060305313 9:122406173-122406195 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1060477962 9:123999728-123999750 GCGCGGGCCGCGGCGCGGGCTGG - Intergenic
1060478167 9:124000266-124000288 GCGCGCCCCGGGGGCCTGGAGGG + Intergenic
1060514661 9:124258169-124258191 GCGCCCGCCCTCGGCCCGGCTGG - Intronic
1060770110 9:126326611-126326633 GCCCGCGCCGCCGCCCCGGCCGG - Intergenic
1060811060 9:126611773-126611795 GAGCGCGGCTCGGGGCCGGCGGG - Intergenic
1060811789 9:126614419-126614441 GGGCGCGCTGCGGACCCCGCCGG - Intergenic
1060812079 9:126615628-126615650 GGGCGCGGGCCGGGCCCGGCAGG - Intronic
1060814360 9:126626919-126626941 GCGGACGCTGCGGGCCCGGCCGG - Intronic
1060825086 9:126683208-126683230 GCGCGCTCTGCGGGCCTCGCGGG - Intronic
1060825112 9:126683303-126683325 GCGGCGGCCGCGGGCCGGGCGGG - Intronic
1061015945 9:127980839-127980861 ACCCGCGCCGCGGGCCCCGGCGG + Intergenic
1061128199 9:128689724-128689746 GCGCGCGCCCCGGGCCCCGCCGG - Intronic
1061285424 9:129620037-129620059 GCCCGCCCCCCGGGCCCCGCGGG + Intronic
1061542101 9:131283019-131283041 CGGCGCGCCCCTGGCCCGGCCGG - Intergenic
1061584042 9:131554964-131554986 GCGGGCGGCGTGGGCGCGGCTGG - Intergenic
1061610026 9:131739984-131740006 GCGGGCGCGGCGGGAGCGGCTGG - Intronic
1061802761 9:133121181-133121203 GCCCCCGCCGCGCGCCGGGCCGG - Intronic
1061828324 9:133275259-133275281 GCGGGCGGCGCGGGCCGGGAGGG - Intergenic
1061975711 9:134067355-134067377 CCGCGCGCCGCGGCCGGGGCGGG - Intronic
1062341190 9:136094683-136094705 GGGCGAGGCGCGGGCCCGGCTGG + Intronic
1062341556 9:136095712-136095734 GCGCGCGCCGGGGGCGGGGTAGG - Intergenic
1062471852 9:136709641-136709663 CCGCGTCCCGCGGGCCCTGCTGG + Intergenic
1062472490 9:136712586-136712608 GCGGCCGCTGCGGGCCGGGCCGG + Exonic
1062596422 9:137301940-137301962 GCGCGGGCCGCGGGCCGGGCCGG + Exonic
1062613812 9:137387141-137387163 GCGGGGGCCGAGGGCCAGGCAGG - Intronic
1062651175 9:137578600-137578622 GCGCGCGCCGCGGCTTCGGGAGG - Intronic
1203469696 Un_GL000220v1:111185-111207 GCGCGTGTCGTGGGGCCGGCGGG + Intergenic
1203471795 Un_GL000220v1:118435-118457 GCGCGTGCGGGGGGCCCGGCGGG + Intergenic
1203477517 Un_GL000220v1:155157-155179 GCGCGTGTCGTGGGGCCGGCGGG + Intergenic
1185469396 X:373672-373694 GGGCTCTCCGCGGGCCGGGCCGG + Intronic
1185610524 X:1391684-1391706 GCGTGCGCACTGGGCCCGGCGGG - Intronic
1185877684 X:3713526-3713548 GCGGGGGCCGCGGCCCGGGCTGG + Exonic
1186496365 X:10015282-10015304 GGGCGCGCCGCGGGAACGGAGGG + Intergenic
1187018217 X:15351407-15351429 CCGCGCCCGGCCGGCCCGGCTGG + Intronic
1187172995 X:16869995-16870017 GCGCGCGCCGGGGCCGCGGGGGG - Intronic
1187341650 X:18426036-18426058 GCTCGTGCCGCGGGAGCGGCGGG - Intronic
1187669850 X:21657280-21657302 GCGCGGGGCGCGGGCCCCGCGGG - Exonic
1188005953 X:25015902-25015924 GCTCGGGCCGCGGGCAGGGCGGG - Exonic
1189821327 X:44872785-44872807 GCGCCCGCCGCGGGCGGTGCCGG + Intergenic
1189988662 X:46575004-46575026 TCGCGCGCGGCGCGCCCGCCTGG + Exonic
1190024664 X:46912539-46912561 GCGCGGGGGGCGGCCCCGGCGGG + Exonic
1190045803 X:47110978-47111000 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1195060695 X:101191443-101191465 GCGCGGGGCCCGGGCCTGGCCGG + Intergenic
1195625163 X:106999790-106999812 GCGCGCGGGGAGGGCCCGGCGGG - Intronic
1195909541 X:109875869-109875891 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1196781403 X:119387559-119387581 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1196793918 X:119487838-119487860 GCGCACGGCGCGGGACTGGCAGG - Intergenic
1197774674 X:130111179-130111201 GCGCACGACGCGGGCTCTGCGGG - Intergenic
1197774682 X:130111194-130111216 TCGTGCGCCGCGGCCCGGGCGGG + Intergenic
1198480219 X:137033916-137033938 GCGGGCGCTGCGGGCGCGGCAGG + Intergenic
1199628169 X:149758911-149758933 GCGCACGGCGCGGGACTGGCAGG + Intergenic
1199699061 X:150363278-150363300 GCGCGCGGCGCGGAGCCGGGCGG + Intronic
1200107747 X:153724307-153724329 GCGGGCTCCGCGCGCCGGGCTGG - Intronic
1200224866 X:154411820-154411842 GCGCCGGCCGCGGGCCGGGTGGG + Exonic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic
1202137027 Y:21676638-21676660 GCGCACGGCGCGGGACTGGCAGG - Intergenic