ID: 1103546336

View in Genome Browser
Species Human (GRCh38)
Location 12:121704284-121704306
Sequence GACTCACCCATGTTGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103546336_1103546338 -9 Left 1103546336 12:121704284-121704306 CCTGGCCTCAACATGGGTGAGTC No data
Right 1103546338 12:121704298-121704320 GGGTGAGTCACAAATGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103546336 Original CRISPR GACTCACCCATGTTGAGGCC AGG (reversed) Intergenic
No off target data available for this crispr