ID: 1103546338

View in Genome Browser
Species Human (GRCh38)
Location 12:121704298-121704320
Sequence GGGTGAGTCACAAATGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103546331_1103546338 26 Left 1103546331 12:121704249-121704271 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1103546338 12:121704298-121704320 GGGTGAGTCACAAATGCATTTGG No data
1103546330_1103546338 27 Left 1103546330 12:121704248-121704270 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1103546338 12:121704298-121704320 GGGTGAGTCACAAATGCATTTGG No data
1103546333_1103546338 -1 Left 1103546333 12:121704276-121704298 CCACTGCACCTGGCCTCAACATG No data
Right 1103546338 12:121704298-121704320 GGGTGAGTCACAAATGCATTTGG No data
1103546336_1103546338 -9 Left 1103546336 12:121704284-121704306 CCTGGCCTCAACATGGGTGAGTC No data
Right 1103546338 12:121704298-121704320 GGGTGAGTCACAAATGCATTTGG No data
1103546328_1103546338 30 Left 1103546328 12:121704245-121704267 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1103546338 12:121704298-121704320 GGGTGAGTCACAAATGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103546338 Original CRISPR GGGTGAGTCACAAATGCATT TGG Intergenic
No off target data available for this crispr