ID: 1103550099

View in Genome Browser
Species Human (GRCh38)
Location 12:121730565-121730587
Sequence CACTTCAATCCAGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142759
Summary {0: 3, 1: 512, 2: 9337, 3: 41491, 4: 91416}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103550093_1103550099 9 Left 1103550093 12:121730533-121730555 CCCAACTACTTGGAAGGCTGAGA 0: 7
1: 721
2: 14601
3: 125266
4: 233031
Right 1103550099 12:121730565-121730587 CACTTCAATCCAGGAGGCGGAGG 0: 3
1: 512
2: 9337
3: 41491
4: 91416
1103550092_1103550099 10 Left 1103550092 12:121730532-121730554 CCCCAACTACTTGGAAGGCTGAG 0: 3
1: 160
2: 2236
3: 4676
4: 6470
Right 1103550099 12:121730565-121730587 CACTTCAATCCAGGAGGCGGAGG 0: 3
1: 512
2: 9337
3: 41491
4: 91416
1103550090_1103550099 17 Left 1103550090 12:121730525-121730547 CCTGTAGCCCCAACTACTTGGAA 0: 2
1: 113
2: 3920
3: 56831
4: 177094
Right 1103550099 12:121730565-121730587 CACTTCAATCCAGGAGGCGGAGG 0: 3
1: 512
2: 9337
3: 41491
4: 91416
1103550094_1103550099 8 Left 1103550094 12:121730534-121730556 CCAACTACTTGGAAGGCTGAGAC 0: 7
1: 547
2: 11353
3: 109877
4: 220548
Right 1103550099 12:121730565-121730587 CACTTCAATCCAGGAGGCGGAGG 0: 3
1: 512
2: 9337
3: 41491
4: 91416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103550099 Original CRISPR CACTTCAATCCAGGAGGCGG AGG Intronic
Too many off-targets to display for this crispr