ID: 1103551881

View in Genome Browser
Species Human (GRCh38)
Location 12:121743931-121743953
Sequence AGTGACACCAATCCAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103551881_1103551885 13 Left 1103551881 12:121743931-121743953 CCTTCCTCTGGATTGGTGTCACT 0: 1
1: 0
2: 0
3: 26
4: 237
Right 1103551885 12:121743967-121743989 TCCCCTTCACCAGCAGTGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103551881 Original CRISPR AGTGACACCAATCCAGAGGA AGG (reversed) Intronic
900416946 1:2539740-2539762 AGTGAGACAAACCCTGAGGATGG + Intergenic
902141667 1:14361778-14361800 AGTGAGATCAATCCAGAAGGTGG - Intergenic
902282468 1:15384468-15384490 AGAGACACCAAACCACAGAATGG + Intronic
902845068 1:19103983-19104005 AGTTCCACAGATCCAGAGGAGGG - Intronic
902966435 1:20007793-20007815 AGTGAGACCAACACAGAAGATGG - Intergenic
903710202 1:25317691-25317713 AGAGACCCCAATGAAGAGGAGGG + Intronic
903716914 1:25374715-25374737 AGAGACCCCAATGAAGAGGAGGG - Intronic
908188307 1:61673972-61673994 AGGAACACCAATTTAGAGGATGG + Intergenic
908319668 1:62967330-62967352 AGGGACACCAGTTCACAGGAAGG - Intergenic
911284714 1:95975306-95975328 AGTGAGACCAACCCAGAAGGTGG - Intergenic
911530609 1:99039301-99039323 AGTGAGACCAATGCAGAAGGTGG + Intergenic
911689751 1:100820005-100820027 AGTGATATCAATGCAGAAGATGG + Intergenic
912235235 1:107844068-107844090 AGTGAAACCAATGCAGAAGGCGG + Intronic
913036394 1:114970037-114970059 AGTGAGACCAATGCAGAAGGTGG - Intronic
916186519 1:162138812-162138834 AGTGAAACCATTCTCGAGGAAGG + Intronic
916403325 1:164472095-164472117 AATCAAACCAATGCAGAGGAAGG - Intergenic
917405877 1:174708392-174708414 AATGAGACCAATGCAGAGGGTGG + Intronic
918601212 1:186365029-186365051 AGTGGAACCAATTCAGAGAAGGG - Intronic
919584513 1:199419613-199419635 AGTGAGACCAATACAGAGGGAGG - Intergenic
920740015 1:208571838-208571860 AGTGCTACCAATCCAGAAGAAGG - Intergenic
921925121 1:220704939-220704961 AGTGACTCCATTACAGAGTAAGG - Intergenic
922253513 1:223871538-223871560 AGTGAGACCAATGCAGAAGGGGG - Intergenic
922623049 1:227006004-227006026 GCTGACACAAGTCCAGAGGAGGG + Intronic
923644473 1:235802925-235802947 AGTGAAAGCAATCCTGAAGATGG - Exonic
924878127 1:248128354-248128376 AGTGAGGCCAATGCAGAAGATGG + Intergenic
1065177263 10:23090828-23090850 AATGACACGAATACAGGGGAGGG - Intergenic
1065434737 10:25694770-25694792 TGTGACTCCTATCCACAGGAAGG + Intergenic
1066159562 10:32714149-32714171 AGTGATACCAATGCAGAAGGTGG + Intronic
1066615484 10:37289154-37289176 AGTGAGACCAATGCAGAAGGTGG - Intronic
1067902831 10:50259859-50259881 AGGGTCACCAAGGCAGAGGAAGG - Intergenic
1068417773 10:56746226-56746248 AGTGACAAGAAACCCGAGGAAGG - Intergenic
1069093564 10:64230335-64230357 AGTGAGACCAATGCAGAAGGCGG - Intergenic
1069195240 10:65543370-65543392 AGAGACACAAATCCAGAGAAAGG - Intergenic
1070323561 10:75372973-75372995 AGTGCCTCCCTTCCAGAGGAAGG + Intergenic
1072953681 10:99870366-99870388 AGTGAGACCAATGCAGAAGGCGG - Intergenic
1073564946 10:104526920-104526942 AGTGACAACAGTGCAAAGGATGG - Intergenic
1074372827 10:112913993-112914015 AGTGGCATAAATACAGAGGAAGG - Intergenic
1074912474 10:117924194-117924216 AGTGAAACAAATCCAGAACATGG + Intergenic
1075947094 10:126443624-126443646 ATTGACACTATTCCAGAAGATGG + Intronic
1077034651 11:488792-488814 AGTGACACCAGGTCAGAGGGAGG - Intronic
1077655742 11:4017141-4017163 AGTGAGATCAATGCAGAAGACGG - Intronic
1078686291 11:13535058-13535080 AGTGAGACCAATGCAGAAGGTGG - Intergenic
1080709963 11:34737573-34737595 AGTGAGACCAATGCAGAAGGTGG + Intergenic
1082825102 11:57571785-57571807 TGTGAGACTAACCCAGAGGAAGG - Intergenic
1084343210 11:68523266-68523288 AGTGCAACCAGTACAGAGGAAGG - Intronic
1087262906 11:96030688-96030710 AGTGACCCAGTTCCAGAGGAAGG + Intronic
1087508364 11:99057507-99057529 ACTGAAACCTATCCAGAGGATGG + Intronic
1087831074 11:102820309-102820331 AGTGAGACCAATGCAGAAGCTGG - Intergenic
1088152225 11:106758570-106758592 AGTGAGATCAATGCAGAAGATGG - Intronic
1088702445 11:112425821-112425843 AGTGAGACCAATGCAGAAGGTGG + Intergenic
1089021909 11:115224633-115224655 ATTCACCCCAGTCCAGAGGAAGG + Intronic
1090352594 11:126116622-126116644 TGTGAAAAGAATCCAGAGGATGG - Intergenic
1095984323 12:47989365-47989387 AGTGAAATCAGTACAGAGGAGGG - Intronic
1096030593 12:48410505-48410527 AGTGAGATCAATGCAGAAGATGG - Intergenic
1100416726 12:94385451-94385473 AGTGACAGCATGGCAGAGGATGG + Intronic
1101193671 12:102360934-102360956 AGAGAGACCACTCCAGAGGAAGG + Intergenic
1101937339 12:109069180-109069202 AGGGACAGCACTGCAGAGGAGGG - Intronic
1102131861 12:110537757-110537779 AGTCCCACAAAGCCAGAGGAAGG + Intronic
1103551881 12:121743931-121743953 AGTGACACCAATCCAGAGGAAGG - Intronic
1105231833 13:18503521-18503543 AGTGTCAGCAATGCAGAAGACGG + Intergenic
1106429320 13:29665332-29665354 AGTGAGACCAATGCAGAAGGTGG + Intergenic
1106435327 13:29718430-29718452 AGTGACAAGAATAGAGAGGAAGG - Intergenic
1108064247 13:46561714-46561736 AATGAAGGCAATCCAGAGGAAGG - Intronic
1111095824 13:83514117-83514139 AGTGACATCGATCCAGAGATTGG - Intergenic
1111512011 13:89278532-89278554 CTTGACGCCCATCCAGAGGATGG - Intergenic
1111576860 13:90165845-90165867 ATAGACACAAATCCATAGGAAGG - Intergenic
1111746344 13:92274506-92274528 AGGGACACAAATCCAGAGAATGG - Intronic
1112915057 13:104538111-104538133 AGTGACACCAAAGTAGTGGAAGG - Intergenic
1113381787 13:109811530-109811552 GGGGACACACATCCAGAGGAGGG - Intergenic
1113693563 13:112328952-112328974 GGTGAGACAAATCCAGAGCAAGG - Intergenic
1115273633 14:31582340-31582362 GGTGGCACCTATCCAGGGGAAGG + Intronic
1117172299 14:53113498-53113520 AGTGAGACCAATGCAGAAGGAGG + Intronic
1117850162 14:59959001-59959023 AGTGAGACCAATGCAGAAGGTGG - Intronic
1119689142 14:76657019-76657041 AGTGTTACCACTCCAGAGGGAGG + Intergenic
1121926445 14:97931500-97931522 GGAGACACCACTCAAGAGGAAGG + Intronic
1122457331 14:101864644-101864666 AGTGAAAGCAATATAGAGGAGGG + Intronic
1123540651 15:21286262-21286284 AATGATACCCATCCAGAGGAAGG - Intergenic
1124620022 15:31268415-31268437 AATGACTGCAATCCAGAAGAGGG + Intergenic
1126159015 15:45592140-45592162 AGTGACACTTCTCCAGATGAAGG + Exonic
1126476261 15:49068600-49068622 AGTGAAATCAATGCAGAAGATGG + Intergenic
1126538331 15:49793902-49793924 GGTTACACCAAGACAGAGGAAGG + Intergenic
1129789845 15:78333507-78333529 AGTGAGACCAACCCAGATGGTGG - Intergenic
1132390474 15:101434813-101434835 AGTGACTGGAACCCAGAGGAAGG - Intronic
1202948962 15_KI270727v1_random:13405-13427 AATGATACCCATCCAGAGGAAGG - Intergenic
1132500093 16:281257-281279 AGAGACCCCAGTCCAGAGCAGGG + Intronic
1133296972 16:4758730-4758752 AGTGACAGGCATCCAGAGCAGGG - Intronic
1138186095 16:54978723-54978745 AGTGACCCCCATGTAGAGGAGGG + Intergenic
1139166596 16:64573210-64573232 AGTGGCACCAATACAGAAGATGG - Intergenic
1139260565 16:65589589-65589611 AGACACACCAATCCAGTGCAGGG + Intergenic
1141049886 16:80751315-80751337 AGTGCCAAAAATCCGGAGGAAGG + Intronic
1143591647 17:7888685-7888707 AGGCCCACAAATCCAGAGGATGG - Intronic
1145756891 17:27398722-27398744 AATAACCCCAATACAGAGGAGGG - Intergenic
1146589439 17:34115969-34115991 AGAGACACAAACCCAGAGAAGGG + Intronic
1148075605 17:44933804-44933826 AGTGTCCCCAAGGCAGAGGAAGG - Intronic
1148567539 17:48642447-48642469 AGTCCCAGCAGTCCAGAGGAGGG - Intergenic
1148671718 17:49415418-49415440 ACTGAGACCAACCGAGAGGAAGG + Intronic
1151161638 17:72170961-72170983 AGTCTCACCAATTCAGAGGATGG - Intergenic
1153381230 18:4441732-4441754 AGTGAAATAAAACCAGAGGAGGG + Intronic
1154411826 18:14145855-14145877 AGTGACAACAACCGAGAGGCAGG + Intergenic
1157058311 18:44256366-44256388 AGTGAGATCAATGCAGAAGAAGG - Intergenic
1158399134 18:57104897-57104919 AGTGAGACCAACGCAGAAGATGG - Intergenic
1158659383 18:59372181-59372203 AGTGAGACCAATGCAGAAGGCGG - Intergenic
1159242218 18:65756070-65756092 AATGACACCATTCCACAGCAAGG - Intronic
1160293266 18:77614819-77614841 AGTGTCACCAATGAAGAGAAAGG - Intergenic
1161248442 19:3267879-3267901 AGTGAAACCAAACCTGAGAATGG + Intronic
1164543855 19:29142780-29142802 ATTGATACCACTCCATAGGAAGG + Intergenic
1165877613 19:39020304-39020326 GGTGGAACCAATCCAGAAGAAGG - Intronic
1166263090 19:41656788-41656810 AGTGAGACCAATGCAGAAGGTGG + Intronic
927238157 2:20896967-20896989 AGCAACAACAAGCCAGAGGAAGG - Intergenic
927703461 2:25282578-25282600 AGTGAGCCCCAGCCAGAGGAGGG - Exonic
928274251 2:29885092-29885114 AAGGACACCAATCCAGAAAAAGG - Intronic
929257847 2:39831367-39831389 AGTGAGAACAATCCAGAAGGTGG - Intergenic
931596465 2:63950543-63950565 AATGGCACCAATCCAGAAAAAGG + Intronic
932022580 2:68102587-68102609 AGTGACACAATTCCAGACTAAGG + Intronic
935565892 2:104607386-104607408 AGTGTGACCAATGCAGAAGATGG + Intergenic
937302635 2:120852547-120852569 AGTGCCAGCATTCCAGAGGCAGG + Intronic
938520852 2:132068951-132068973 AGTGTCAGCAATGCAGAAGATGG - Intergenic
938952419 2:136267132-136267154 AGTGAGACCAATGCAGAAGGTGG - Intergenic
939193435 2:138943048-138943070 AGTGAGATCAATGCAGAAGATGG - Intergenic
940124758 2:150311066-150311088 AGTGAGACCAATGCAGAAGGTGG + Intergenic
940565259 2:155351924-155351946 AGTGAGACCAATGCAGAAGGTGG - Intergenic
941398120 2:164996094-164996116 AATGATACCCATCCAGAGGAAGG - Intergenic
942898656 2:181088969-181088991 AGTGAGACCAATGCAGAAGGCGG + Intergenic
943748226 2:191484501-191484523 AGTCACCACAATCCAGAGAAAGG - Intergenic
943879888 2:193130304-193130326 ACTGATACCAAACCAGATGAGGG - Intergenic
944373449 2:199012146-199012168 AGTGAGAACAATCCAGAGAAAGG + Intergenic
944415668 2:199477277-199477299 AGAGACACAAAGCCACAGGACGG - Intergenic
946172329 2:217902766-217902788 AGTGACCCCAGTGCAGAGGATGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947311674 2:228809703-228809725 AGTGAGACCAATGCAGAAGGTGG - Intergenic
947864109 2:233384358-233384380 AGGGACACCAATACCAAGGAAGG - Intronic
1169984204 20:11423511-11423533 AGAGAGACCAATGCAGAAGAGGG - Intergenic
1173262530 20:41449516-41449538 AGGGAAATCAATTCAGAGGATGG + Intronic
1174665459 20:52253863-52253885 AAGGACACCAACACAGAGGAGGG - Intergenic
1176775805 21:13131822-13131844 AGTGTCAGCAATGCAGAAGATGG + Intergenic
1182432613 22:30309165-30309187 AGAGACACCAATACACTGGATGG + Intronic
1182491213 22:30673337-30673359 AGTTAGACAAATCCTGAGGAAGG + Intergenic
1185396250 22:50591455-50591477 AACAACACCAATACAGAGGATGG - Intronic
949176049 3:1063583-1063605 AGTGAGACCAATGCAGAAGGTGG - Intergenic
950657017 3:14442850-14442872 AATCACAGCAAGCCAGAGGATGG + Intronic
951989192 3:28656865-28656887 AGTGACACAAATCAAGAGAATGG - Intergenic
952732782 3:36656776-36656798 ATTGACACCATTCCACAGGATGG + Intergenic
953073967 3:39550953-39550975 AGTGAGACCAATGCAGAAGGTGG + Intergenic
953494776 3:43376645-43376667 GGTGACACCAATTCTGAGAAAGG + Intronic
954628766 3:52037070-52037092 ACTGACACCTATACAGAGGGAGG + Intergenic
956005718 3:64776536-64776558 AGTGAGACCAATGCAGAAGACGG + Intergenic
956025357 3:64977386-64977408 AATGAAACCAATGCAGAGGAAGG + Intergenic
956888933 3:73590437-73590459 AGAGAGACCTAACCAGAGGAAGG - Intronic
957992674 3:87647605-87647627 ATTGACACTACTTCAGAGGATGG + Intergenic
962247458 3:133808004-133808026 AGGTACAACAATGCAGAGGAGGG - Intronic
966693444 3:182764240-182764262 AGTAAAACCAATTCAGAGAAGGG + Intergenic
968575900 4:1366008-1366030 TGTGACGCCATTCCACAGGAGGG + Intronic
969262203 4:6041119-6041141 AGTGAGACCAATCGGGAGGTGGG - Intronic
969327399 4:6451932-6451954 AGTGACACCACCCCAGAGCCAGG + Intronic
971205291 4:24561761-24561783 AGGAACAACAAACCAGAGGATGG + Intronic
971268674 4:25117084-25117106 AGTGACACCAATCGTCAGTAAGG - Intergenic
971749103 4:30623776-30623798 AGTGAGACCAAGGCAGAAGAAGG + Intergenic
972821644 4:42708511-42708533 ACTGATACCTATGCAGAGGATGG - Intergenic
975149522 4:71005357-71005379 AGTGAGACCAATGCAGAAGACGG - Intronic
978401536 4:108335950-108335972 ATGGACACCAATCATGAGGAGGG + Intergenic
978906729 4:114013563-114013585 AGTGAGACCAATGCAGAAGGTGG - Intergenic
980073566 4:128268819-128268841 AATGACACAAAACCAGATGAAGG + Intergenic
980223399 4:129948380-129948402 AGTGAGACCAATGCAGAAGGTGG - Intergenic
980769238 4:137350625-137350647 AGTGAGACCAATGCAGAAGGTGG + Intergenic
981078896 4:140618636-140618658 GATGACACCAGTGCAGAGGAAGG - Intergenic
981491349 4:145343605-145343627 AGTCTAACCAATCTAGAGGAAGG + Intergenic
982101688 4:151974704-151974726 AGGGGCACCAATCAACAGGATGG + Intergenic
983699666 4:170576818-170576840 AGTGACAGGATTCCAAAGGAGGG - Intergenic
985317310 4:188672244-188672266 AGTGAGACCAATGCAGAAGGTGG + Intergenic
985675783 5:1230623-1230645 GGTGACACAAACCCAGAGCAAGG + Intronic
986110246 5:4709381-4709403 AGTGAGACCAATGCAGAAGGTGG + Intergenic
986265207 5:6184712-6184734 ATTGCAGCCAATCCAGAGGATGG + Intergenic
987612680 5:20227227-20227249 AATCACACAAATTCAGAGGAGGG + Intronic
988400940 5:30759534-30759556 AATGACACCAGTCCAGAAAAGGG - Intergenic
989140036 5:38192840-38192862 AGGGACACCACTCAAGAGGAAGG - Intergenic
990098762 5:52156389-52156411 AGTGAGACCAATGCAGAAGGTGG + Intergenic
993757729 5:91751594-91751616 AGTGAGACCAATGCAGAAGACGG - Intergenic
994014944 5:94955012-94955034 AGTGAGACCAATGCAGAAGGCGG + Intronic
994438168 5:99764164-99764186 AGTGAGACCAGTGCAGAGGGTGG - Intergenic
994850913 5:105053779-105053801 AGTGAGACCAACAGAGAGGAGGG - Intergenic
996146533 5:119983714-119983736 AGAAACACAAATCCAAAGGAAGG - Intergenic
996461447 5:123748452-123748474 GGTGACACCAATAGACAGGAAGG - Intergenic
997808912 5:136947505-136947527 AGTGTCAGCAATGCAGAAGACGG - Intergenic
999030175 5:148281677-148281699 AGTGAGACCAATGCAGAAGGTGG - Intronic
1000820289 5:165974048-165974070 AGTGAGACCAATGCAGAAGGCGG - Intergenic
1001347846 5:170922888-170922910 AGTGAGATCAATGCAGAAGATGG - Intronic
1004400598 6:15284957-15284979 AGTGACTGCAATCCAGGTGAGGG - Intronic
1005485378 6:26294424-26294446 TGGGACACCATTCCAGAGCAAGG - Intergenic
1005750842 6:28881051-28881073 AGGGAAAACAATCAAGAGGAGGG - Intergenic
1006199858 6:32278959-32278981 AGTGAGACCAATGCAGAAGGCGG + Intergenic
1006699386 6:35959512-35959534 AGTGACACCAATCTACAAGGAGG - Exonic
1008606239 6:53142396-53142418 AGAGCCACCAATGCACAGGATGG + Intronic
1009594059 6:65711615-65711637 AGTGATTTCAATCAAGAGGAAGG - Intergenic
1011471273 6:87710211-87710233 AGTGACACCAATTCTGAGTCAGG - Intergenic
1012247059 6:96937801-96937823 AGTGACAACAGTCCCTAGGAAGG - Intronic
1012387258 6:98696623-98696645 CCTGACACCTTTCCAGAGGATGG + Intergenic
1014413511 6:121154383-121154405 AGTGAGACCAATGCAGAAGGCGG - Intronic
1014573835 6:123045450-123045472 AGTGACACCGAGAAAGAGGAAGG + Intronic
1018338619 6:162824367-162824389 AGAGGCACCAATCCAAAGGTAGG - Intronic
1018360627 6:163063720-163063742 AGTGAAACCAAACCAAAGGACGG + Intronic
1018639712 6:165895325-165895347 AGAGACACAGATGCAGAGGACGG + Intronic
1018913511 6:168118180-168118202 AGGGACACCAACCCAAAGAAAGG - Intergenic
1020312197 7:6876565-6876587 AGTGACACCATCCTAGAAGATGG - Intergenic
1021424685 7:20486654-20486676 AGTGACATTATTCCAGAGAAGGG + Intergenic
1022423754 7:30248015-30248037 TGTGACACCATTTCAGAGAAAGG + Intergenic
1023715868 7:43043380-43043402 AGTGACCCCAAGTGAGAGGAAGG + Intergenic
1023999100 7:45179238-45179260 AGTGAGACCAGCCAAGAGGAAGG + Intronic
1024802948 7:53101975-53101997 AGTAAAACTAATCCAAAGGAAGG + Intergenic
1025840211 7:65139953-65139975 GGAGACACCAACACAGAGGATGG + Intergenic
1025882851 7:65556012-65556034 GGAGACACCAACACAGAGGATGG - Intergenic
1025890593 7:65646592-65646614 GGAGACACCAACACAGAGGATGG + Intergenic
1027632015 7:80618676-80618698 ACAGAGCCCAATCCAGAGGAAGG + Intronic
1028451620 7:90991447-90991469 AGTGACACAAATCAAGGGAAGGG + Intronic
1031851896 7:126875426-126875448 GGAGACACCAATGCGGAGGATGG - Intronic
1035306395 7:157935800-157935822 AGTGACACAGATGCTGAGGATGG - Intronic
1040817704 8:51526576-51526598 AGTGACAGAAATACAGAGGCAGG - Intronic
1041121412 8:54590253-54590275 AGTGATACAATGCCAGAGGAGGG - Intergenic
1041419179 8:57647375-57647397 AGTGAGACCAATGCAGAAGGTGG - Intergenic
1041666221 8:60447813-60447835 AGTGAGACCAATGCAGAAGGTGG + Intergenic
1044312472 8:90709432-90709454 AGTGAGACCAATGCAGAAGGTGG - Intronic
1044940363 8:97335531-97335553 AGCGAGACCAATGCAGAGGGTGG - Intergenic
1045694871 8:104797605-104797627 TGTGAGACAAATCCATAGGATGG + Intronic
1046695130 8:117331435-117331457 AGGGACACCAATCTAGATGCTGG + Intergenic
1046930424 8:119836447-119836469 AGGGAGACCAATTCAGAGGCAGG + Intronic
1046972649 8:120238999-120239021 AGTGAGACCAATGCAGAAGGCGG - Intronic
1048052370 8:130830064-130830086 AGGGTTACCAATCCAGAGGGAGG + Intronic
1048875084 8:138830707-138830729 AGTTACACAAATCTAGTGGAAGG - Intronic
1050158509 9:2693258-2693280 AGTGCCACCAACTCAGTGGAGGG - Intergenic
1050974004 9:11912820-11912842 AATGAGACCAATGCAGAGGCGGG - Intergenic
1051611744 9:18968139-18968161 AGTGAGACCAATGCAGAAGGTGG - Intronic
1053362899 9:37502207-37502229 TGTGACAGCAATTCAGAGAATGG - Intronic
1054986081 9:71262905-71262927 AGTGAGACCAATGCAGAAGGCGG - Intronic
1056123633 9:83513711-83513733 AGTGAGACCAACACAGAGGGTGG + Intronic
1056339996 9:85619281-85619303 AGTTACACCATTCCAGAAGAGGG - Exonic
1056656755 9:88515905-88515927 AGGGAAACCATACCAGAGGAGGG + Intergenic
1185841038 X:3391443-3391465 AGTGACATCAAACCAAAGGAGGG - Intergenic
1186810244 X:13181381-13181403 AGTGAGACCAATGCAGAAGGTGG + Intergenic
1187368243 X:18682305-18682327 AGCGACTTCAATCCAGAAGAGGG - Intronic
1187556159 X:20353932-20353954 AATGAAACCAATACCGAGGAAGG + Intergenic
1188231695 X:27671634-27671656 AATGATGTCAATCCAGAGGAAGG + Intronic
1189222441 X:39383936-39383958 AGTGACACACAGCCAGAAGAGGG + Intergenic
1189392348 X:40586779-40586801 AGGGACTCCTATACAGAGGAAGG - Intronic
1191909044 X:66127608-66127630 AGTGAGACCAATGCAGAAGGTGG - Intergenic
1192224381 X:69218202-69218224 AGAGACATCAAACCAGAGGCAGG + Intergenic
1193352127 X:80475538-80475560 AGTGAGATCAATGCAGAAGATGG - Intergenic
1193520524 X:82523942-82523964 AGTGACAGCACTGCACAGGAGGG + Intergenic
1193585738 X:83318995-83319017 AGTCACACTGATGCAGAGGATGG - Intergenic
1194242469 X:91469531-91469553 AGTGAGACCAACACAGAAGATGG + Intergenic
1194545109 X:95225044-95225066 AGCGAGACCAATGCAGAAGATGG + Intergenic
1195826132 X:109003416-109003438 AGTGAGACCAATGCAGAAGGTGG + Intergenic
1195896567 X:109751239-109751261 AGGAACAGCAATTCAGAGGAAGG - Intergenic
1196367908 X:114943562-114943584 AGTGACATCAACGCAGAGGGTGG - Intergenic
1196412573 X:115435406-115435428 AGTGACTCCATTACAGAGTAGGG - Intergenic
1196578519 X:117351105-117351127 AGTGACAGCTCTCCAGGGGAGGG - Intergenic
1196946693 X:120833452-120833474 AGTGACAGCAACACAGAAGATGG - Intergenic
1197126679 X:122955092-122955114 AGTGACAGCAGGACAGAGGATGG - Intergenic
1197312978 X:124929065-124929087 ATTGAGAACAATTCAGAGGAAGG - Intronic
1197319015 X:125005631-125005653 AGTGAGACCAATGCAGAGGCGGG + Intergenic
1197337200 X:125222401-125222423 AGTGATATCATTCAAGAGGAGGG + Intergenic
1198058218 X:133016562-133016584 AGTGATAAAATTCCAGAGGAAGG - Intergenic
1198114699 X:133533903-133533925 AGTAACACCAACCCAGAAGAAGG - Intergenic
1198645596 X:138802485-138802507 AGTGAGACCAATGCAGAAGATGG - Intronic
1198784576 X:140273276-140273298 AGAGACACCAATGCAGAAGGTGG - Intergenic
1200360105 X:155596251-155596273 AATGGCACCAATCCAGAAAAAGG - Intronic