ID: 1103552315

View in Genome Browser
Species Human (GRCh38)
Location 12:121746656-121746678
Sequence TAGAAAAATGAGAAGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1391
Summary {0: 1, 1: 1, 2: 5, 3: 175, 4: 1209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103552313_1103552315 -6 Left 1103552313 12:121746639-121746661 CCTGCTAGCTATTTCTTTAGAAA 0: 1
1: 0
2: 3
3: 23
4: 279
Right 1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG 0: 1
1: 1
2: 5
3: 175
4: 1209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103552315 Original CRISPR TAGAAAAATGAGAAGAAGGC CGG Intronic
900040175 1:454714-454736 TAGAAAAATGAGTTGAATGCTGG - Intergenic
900061604 1:689688-689710 TAGAAAAATGAGTTGAATGCTGG - Intergenic
901074617 1:6545750-6545772 TAAAGAAATGTGAAGCAGGCTGG + Intronic
901155121 1:7131246-7131268 TATAAAAATGAAAAGGCGGCCGG - Intronic
901396078 1:8982810-8982832 TAGAAATATGAGCATGAGGCTGG + Intergenic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902430707 1:16360964-16360986 TAAAAAAATAAAAATAAGGCCGG - Intronic
902642195 1:17774240-17774262 TAGCAAAATGAGGGAAAGGCAGG - Intronic
902688037 1:18091634-18091656 TTGAAAAATGGGAAGGAGGGGGG - Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903436947 1:23357120-23357142 TAGGAACAGGAGAAGCAGGCAGG + Intergenic
903505049 1:23827759-23827781 TAGCAAGATGAAAAGAAGGCTGG + Intronic
903605303 1:24571178-24571200 TAAAAAAGTAAAAAGAAGGCTGG + Intronic
903656631 1:24953068-24953090 TTGAAAAATGAAAAAAAGGCAGG + Intronic
903780535 1:25817509-25817531 TACAAAATTAAGAACAAGGCTGG - Exonic
904214602 1:28909497-28909519 TAAAAAAATAAAAATAAGGCTGG + Intronic
904514540 1:31044103-31044125 TACAAAAATAAAAAGAAGGCCGG + Intronic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904895815 1:33817279-33817301 GAAAAAAGAGAGAAGAAGGCAGG + Intronic
905400089 1:37695224-37695246 AAGAAAAATAAGCAGAGGGCAGG + Intronic
905506859 1:38486627-38486649 TAGAAAGAAGGGAAGAAGGCAGG + Intergenic
905570491 1:39000643-39000665 AAGAAAAAAGAAAAAAAGGCCGG - Intronic
905804189 1:40863963-40863985 TAAAAAAATAAGAAGAAAGAGGG - Intergenic
905806158 1:40879102-40879124 AAGAAAAAAGAAAAGAAGGAGGG + Intergenic
905908675 1:41638973-41638995 AAGAAAGTGGAGAAGAAGGCTGG + Intronic
906123151 1:43408569-43408591 TAAAAAAATAAAAAAAAGGCAGG - Intronic
906176283 1:43775986-43776008 AAGAAAAAGGAATAGAAGGCAGG - Intronic
906945752 1:50292890-50292912 TAGAAATATGAAAATAAGGCCGG + Intergenic
907065730 1:51480806-51480828 TATAAAAATGGGAATATGGCCGG - Intronic
907138399 1:52160708-52160730 TAGAAAAATGTCATCAAGGCCGG - Intronic
907483331 1:54759707-54759729 AACAAAAAAGAAAAGAAGGCTGG + Intronic
907513225 1:54977877-54977899 AAAAAAAAGAAGAAGAAGGCAGG + Intergenic
908177642 1:61571663-61571685 TAGAAAAATGAGGAGCACGCTGG - Intergenic
908368844 1:63458886-63458908 TAAAAAAATGAGAAAACTGCAGG - Intronic
909079377 1:71090480-71090502 TAGGAAAAAGAAAGGAAGGCAGG + Intergenic
909300800 1:74010875-74010897 TGAGAAAATGATAAGAAGGCAGG + Intergenic
909383564 1:75030191-75030213 TAAAAAAATAATAAAAAGGCTGG + Intergenic
909942831 1:81631195-81631217 AAGAAAAAAGAAAAGAAGGTCGG - Intronic
910260336 1:85288133-85288155 TTAAAAAATGAGAAGGTGGCTGG + Intergenic
910477886 1:87626368-87626390 TTAAAAAATGAGGAGAAGCCAGG + Intergenic
910843514 1:91584137-91584159 TAGAAAAATGAGAAAAATAAAGG + Intergenic
911005477 1:93217228-93217250 GATAAAAATGAGAAAACGGCCGG - Intronic
911112297 1:94202827-94202849 TAGAAAAATGAGAGCAAGGAAGG + Intronic
911422876 1:97666991-97667013 TAAAAAAATGAGTAGCAGGGCGG - Intronic
911769025 1:101715494-101715516 TGGAAAAAAGAGAAGAATTCTGG - Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912201986 1:107468799-107468821 ATGAAAAATGATAGGAAGGCCGG + Intronic
912214210 1:107589114-107589136 AAGAAAAATTAGAATAAGGATGG + Intronic
912260089 1:108102539-108102561 TCCAAAAATGAGATGAAAGCAGG + Intergenic
912327366 1:108780663-108780685 TAAAAAACTGTGATGAAGGCTGG - Intronic
912820671 1:112865267-112865289 TAAAAAAATAAAAAAAAGGCTGG - Intergenic
912882653 1:113432594-113432616 TAGGAAAATGACTTGAAGGCAGG - Intronic
913002144 1:114591424-114591446 TAGAAAAATGAGGAAAAGATAGG - Intronic
913059258 1:115189610-115189632 TAGAAATATGTGAGGCAGGCCGG + Intergenic
913377596 1:118170889-118170911 TAGAAAGAGCAGAAGCAGGCAGG + Intronic
913446174 1:118952976-118952998 TAGAAATAGGAAAAGATGGCTGG + Intronic
913599462 1:120409184-120409206 TTTAAAATTGAAAAGAAGGCTGG - Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
913955995 1:143293962-143293984 AAGACACATGAGAAGAGGGCAGG - Intergenic
913981439 1:143521478-143521500 AAGACACATGAGAAGAGGGCAGG + Intergenic
914075812 1:144348133-144348155 AAGACACATGAGAAGAGGGCAGG + Intergenic
914087920 1:144470431-144470453 TTTAAAATTGAAAAGAAGGCTGG + Intergenic
914103366 1:144618363-144618385 AAGACACATGAGAAGAGGGCAGG - Intergenic
914215971 1:145628752-145628774 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914310693 1:146463773-146463795 TTTAAAATTGAAAAGAAGGCTGG - Intergenic
914382937 1:147134976-147134998 TAGAAAAATGATATCAAGCCGGG - Intergenic
914468540 1:147951384-147951406 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914591412 1:149109372-149109394 TTTAAAATTGAAAAGAAGGCTGG + Intergenic
914810635 1:151025131-151025153 TGGAAAAATGAGAACAAGAAAGG - Intronic
915368287 1:155327581-155327603 TAGAAAAATGAAAAACAGCCTGG + Intronic
915696633 1:157749223-157749245 TAAAGTAATGAGAAAAAGGCAGG - Intronic
915768367 1:158390913-158390935 GAGAAAAATGTGAAGAGGGCTGG - Intergenic
916141862 1:161706609-161706631 TGGAAATATGAGTACAAGGCAGG - Intergenic
916643294 1:166755706-166755728 TAGAAAAATGCAAATCAGGCTGG + Intergenic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
916884615 1:169054899-169054921 AAGAAAAATGTGTAGAATGCAGG + Intergenic
916914931 1:169396255-169396277 TAGAAAAACAAAAAGGAGGCTGG + Intronic
917672381 1:177285322-177285344 TAAAAAATTGAGAAGTTGGCTGG + Intergenic
917849461 1:179048161-179048183 TGGAAAAAGAACAAGAAGGCAGG + Intronic
918034418 1:180853227-180853249 TTAAAAAATGAAAAGAAGCCAGG - Intronic
918216653 1:182397556-182397578 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
918673232 1:187247461-187247483 TTGAAAAAAAAGAAGAAAGCTGG + Intergenic
918866240 1:189904104-189904126 GAAAATAATGAGAACAAGGCCGG - Intergenic
919071568 1:192762409-192762431 TAGAAATTTGAAAAGAGGGCGGG - Intergenic
919523529 1:198619339-198619361 GAGAGAAATGTGAAGAAGGCTGG - Intergenic
919525903 1:198650164-198650186 TAGAAAGATAAGCAGAAGGCAGG + Intronic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
919635613 1:200000422-200000444 TAGAAAAATGGGCATAGGGCTGG - Intergenic
919816604 1:201444752-201444774 TGGAAAACTGTGAAGGAGGCTGG - Intergenic
919821158 1:201472794-201472816 AAGAAAGATGGGAATAAGGCGGG + Intergenic
920861480 1:209711408-209711430 TAGAAAAATGAGAACAACTGTGG - Intronic
920916596 1:210262581-210262603 TGGAAAAATGAGGAGAAGGAAGG - Intergenic
920968777 1:210724416-210724438 GAGAAAAATGAGCAGAGGCCTGG - Intronic
921173411 1:212569184-212569206 TAATAAAAAGAAAAGAAGGCAGG - Intronic
922084216 1:222330333-222330355 TAGTCAGATGAGAAGAAGGGCGG + Intergenic
922308249 1:224363338-224363360 TAGAAAATTCAAAAGAAGGCTGG - Intronic
922490818 1:226015022-226015044 TAGAAATATGAGATGCAGCCAGG - Intergenic
922498451 1:226079210-226079232 TAGAAATTAGAGAGGAAGGCCGG + Intergenic
922671894 1:227515677-227515699 TAAAAAAATCAGAAAAAGACGGG + Intergenic
922736045 1:227979271-227979293 TAAAAAAGAGAAAAGAAGGCTGG - Intergenic
922990060 1:229900036-229900058 CATAACAATGAGAAAAAGGCAGG + Intergenic
923185470 1:231568862-231568884 TACAAAAAAGAAAAGAAGGCTGG - Intronic
923432944 1:233941166-233941188 TACAAAAATGAGAGGAAGGCAGG - Intronic
923694430 1:236233313-236233335 AAAAAAAAAAAGAAGAAGGCTGG + Intronic
923859910 1:237883416-237883438 TAAAAAAATAAGACAAAGGCCGG + Intronic
924009098 1:239644647-239644669 GAGAGAGATGAGAAGAAAGCCGG + Intronic
924070350 1:240271637-240271659 TAGAAATTTGAGAAGAAAGTAGG + Intronic
924264360 1:242266818-242266840 TAGAAAAGAGAGAAGCTGGCCGG + Intronic
924342196 1:243048635-243048657 TAAAAAAGAGAAAAGAAGGCTGG + Intergenic
924763768 1:247012372-247012394 TAGAAAAATGCAAAGCAGCCAGG - Intergenic
924812301 1:247414063-247414085 AAGAAAATAGAGAAGAAGCCAGG - Intergenic
924818160 1:247460959-247460981 TAGAACATTGAGAAGGAGCCAGG + Intergenic
924856769 1:247881900-247881922 TAGAAAAATTAGTCTAAGGCCGG - Intergenic
924870472 1:248038350-248038372 TAGGAAAATGAGAAAAATGAGGG - Exonic
1062876904 10:949774-949796 TAGAAAAATCAGCAAAAGACAGG - Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062942804 10:1437621-1437643 AAGAAATATGGGAAGAAGGGAGG + Intronic
1063113919 10:3060008-3060030 AAGGAAAGTGAGAAGAAGGGAGG + Intergenic
1063391979 10:5655784-5655806 TTGAAAAAGAAGAGGAAGGCAGG + Intronic
1063542594 10:6949482-6949504 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1063654539 10:7974777-7974799 TTTAAAAGTGAGATGAAGGCCGG + Intronic
1064212217 10:13369645-13369667 TTGAAAAAGGAGTAGAAGGCCGG + Intergenic
1064402517 10:15033479-15033501 AAGAAAAAGGAGAAGAAAGAGGG + Intronic
1064743603 10:18457592-18457614 AAGAAAAATTAGGAGAGGGCCGG + Intronic
1064939408 10:20715865-20715887 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
1065163685 10:22951832-22951854 TAGAAAAAGAAGAACAAGGCTGG + Intronic
1065506636 10:26436265-26436287 TAGAAAGTTCAAAAGAAGGCAGG - Intergenic
1066131303 10:32396924-32396946 TACAAAAAGAAAAAGAAGGCTGG + Intergenic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1066720445 10:38331668-38331690 TAGAAAAAAGAGAAGCTGGCTGG - Intergenic
1066734285 10:38456908-38456930 TAAAAAAGAGAAAAGAAGGCTGG - Intergenic
1066756671 10:38718871-38718893 TACAAAATTGGGAGGAAGGCTGG - Intergenic
1066782144 10:38963069-38963091 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1066954973 10:42157561-42157583 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1067126077 10:43516669-43516691 CAGAAAAATGTGAAAAAGACTGG - Intergenic
1067411405 10:46068040-46068062 TAGAAAAAGGATATGAAGGAGGG + Intergenic
1067991793 10:51222180-51222202 TAGAAAAATATGAAACAGGCTGG - Intronic
1068521043 10:58077791-58077813 AAGAAAAAGAAGAAGAAGACAGG + Intergenic
1068677897 10:59786909-59786931 TAGAAAACTGAGGCTAAGGCAGG + Intergenic
1068978481 10:63036085-63036107 TATAAAAATAAAAAGAAGGCAGG + Intergenic
1069517425 10:69089597-69089619 TAGAAAGAAATGAAGAAGGCCGG + Intronic
1070089676 10:73271998-73272020 TAGAAACTTTAGAAGAAGCCAGG - Intronic
1070168598 10:73915816-73915838 TACAAAACTGAGAAGGAGGCTGG + Intronic
1070363819 10:75716698-75716720 GAGACACATGAGAAGGAGGCAGG - Intronic
1070584247 10:77749332-77749354 TAGAAAAATTGCAAGAAGGAAGG + Intergenic
1070831708 10:79421923-79421945 TAAAAAAATGTATAGAAGGCTGG - Intronic
1071040647 10:81305590-81305612 GAGATGAATCAGAAGAAGGCAGG + Intergenic
1071186229 10:83049193-83049215 GAGAAGAATGAGAAGAACACAGG - Intergenic
1071661506 10:87506763-87506785 GTGAAAAATTAGAAGTAGGCTGG + Intronic
1071870040 10:89783844-89783866 TAAAATAATGAAAATAAGGCAGG + Intergenic
1071989505 10:91087748-91087770 TGGAGAAATGAGAAGAACCCAGG - Intergenic
1072127833 10:92462898-92462920 TAGATAAATTATAAGTAGGCTGG + Intronic
1072212579 10:93260154-93260176 TAGAAAAGTGAGTTGAGGGCCGG + Intergenic
1072513692 10:96154450-96154472 GAAAAAAAAGAAAAGAAGGCAGG - Intronic
1072673627 10:97449824-97449846 TAGAAAAGAGAAAAAAAGGCCGG - Intronic
1072731250 10:97848806-97848828 TAAAAAAATAAAAATAAGGCCGG - Intergenic
1073163981 10:101427497-101427519 GAGAAGAAAGAGAAGAAGGAAGG - Intronic
1073359019 10:102882337-102882359 CAAAAAAATCAGAAGAAGCCAGG - Intronic
1074197912 10:111205612-111205634 TGGAAAAATCAGAAGAAGGAAGG - Intergenic
1074499197 10:114007445-114007467 TCTAAAAATGGAAAGAAGGCTGG - Intergenic
1075165620 10:120065584-120065606 TATAAAAATGAGATGATGGCTGG - Intergenic
1075338017 10:121622738-121622760 TAGAGAAAGGGGAAGAAGGAGGG - Intergenic
1075570129 10:123535704-123535726 TAGAAAAATGAGAAGCGGCTGGG + Intergenic
1075613547 10:123874157-123874179 TAGAAATGTGAGAAATAGGCTGG - Intronic
1076140599 10:128075864-128075886 TAGAAAAATCAGTGAAAGGCAGG - Intronic
1076277305 10:129212621-129212643 TAAAAAAATAAGAATATGGCTGG + Intergenic
1076613587 10:131742428-131742450 TAGAGACATGAGAAGCAGCCTGG - Intergenic
1076966396 11:90619-90641 TAGAAAAATGAGTTGAATGCTGG - Intergenic
1077007583 11:365623-365645 TAAAAAAATGAAAATAAGACCGG - Intergenic
1077613228 11:3658035-3658057 TAAAAAAATGACAATAAGGCCGG + Intronic
1077759443 11:5076281-5076303 GTGAGAAACGAGAAGAAGGCTGG + Intergenic
1077876400 11:6311883-6311905 TAAAAACATCAGAATAAGGCTGG + Intergenic
1078116033 11:8451906-8451928 TAAAAAAATGCAAAGAGGGCTGG + Intronic
1078130650 11:8611559-8611581 AATAAAAATAAGAAGCAGGCTGG + Intergenic
1078899915 11:15632266-15632288 TAGAAGAAAGAAAAGAAGACTGG - Intergenic
1079367685 11:19823502-19823524 TACAAAAATAAGAAATAGGCTGG - Intronic
1079455988 11:20636681-20636703 TGGCAAAATGACACGAAGGCAGG - Intronic
1079514219 11:21248046-21248068 TACAAAAAAGAGCAGGAGGCCGG + Intronic
1079563869 11:21856523-21856545 TAGAAAAATGGGCAAAAGACAGG - Intergenic
1079964384 11:26963153-26963175 GAGAAAAAAGAGAGGAAGGGAGG + Intergenic
1080011778 11:27467269-27467291 TATAAAAATCAAAATAAGGCGGG + Intronic
1080454825 11:32408550-32408572 AAGAAAAAAGAAAAGAAGGAAGG + Intronic
1081475330 11:43424470-43424492 TAGAAACATGAAAAGGTGGCTGG + Intronic
1081557047 11:44173861-44173883 TAGAAAGAAGAAAAAAAGGCCGG - Intronic
1082263239 11:50093861-50093883 TACAAAAAAGAAAAGGAGGCTGG + Intergenic
1082711694 11:56560723-56560745 TTGAAAATAGAGAAGAAGCCAGG - Intergenic
1082979912 11:59110554-59110576 TACAAAAATAATAAGAGGGCAGG + Intronic
1083100653 11:60302207-60302229 TAGAAAAATGATAAGAAATCAGG + Intronic
1083313634 11:61800354-61800376 TAGGAAAATTAGAAGCAAGCTGG - Exonic
1083372397 11:62192639-62192661 TTGAACAGGGAGAAGAAGGCAGG + Intronic
1084346295 11:68551781-68551803 TATAAAAATAAAAAGGAGGCCGG - Intronic
1084705162 11:70811856-70811878 CAGAAAAATGATAAGATGGATGG - Intronic
1084749083 11:71192155-71192177 TAAGAAGATGAGATGAAGGCCGG - Intronic
1084783639 11:71428944-71428966 TAGATAAGTGAGGAGGAGGCGGG - Intronic
1085193108 11:74646267-74646289 TATAAAAATGAAAATCAGGCCGG - Intronic
1085398621 11:76220846-76220868 TTTAAAAATGAGCAAAAGGCTGG + Intergenic
1085608324 11:77923017-77923039 TACAACTATGAGAAGAAAGCCGG + Intronic
1085927884 11:81043902-81043924 TATAAAAATTGGAATAAGGCTGG + Intergenic
1086312615 11:85551243-85551265 TAGAAATATGAGAAGCAGAATGG + Intronic
1086314175 11:85572667-85572689 AAGAAACATGAGATGAATGCAGG + Intronic
1086386677 11:86316212-86316234 GAGGAAAAAGAAAAGAAGGCCGG + Intronic
1086525817 11:87724660-87724682 TAGAAAAGTGAGTGGAAGGATGG + Intergenic
1086582019 11:88410295-88410317 TAGACAAATGAAGAGAAGCCAGG - Intergenic
1087157322 11:94918172-94918194 TAGAAAAAACAAAAGAAGCCGGG - Intergenic
1087161115 11:94949057-94949079 TAGAAAGGAGAGAAGAAGGAAGG + Intergenic
1087260639 11:96007405-96007427 TAGAAAATTCAGAATAAGGCAGG + Intronic
1087269672 11:96098637-96098659 TGGAAGAATGAGAACAAGGACGG - Intronic
1087278721 11:96186291-96186313 TATAAAAGTGGGATGAAGGCCGG + Intronic
1087292588 11:96336330-96336352 TAGAAAAATCAGAGGAAGAGAGG - Intronic
1087806822 11:102564401-102564423 TAGAAAACTGATAACAATGCAGG + Intergenic
1087818900 11:102689236-102689258 TAAAAAAATGAGGGGATGGCAGG + Intergenic
1088374925 11:109130433-109130455 TAGAAGAATTAGCAGAAGGCAGG + Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1089391484 11:118104885-118104907 TAGGAAAGAGAGAAGAAGGGAGG - Intronic
1089573491 11:119424874-119424896 TAGATGAATGGGAAGATGGCTGG - Intronic
1089637976 11:119828608-119828630 TGGAAAAAAGAAAAGAAGTCAGG + Intergenic
1089788845 11:120927910-120927932 TAAAAAAATATTAAGAAGGCAGG + Intronic
1089794640 11:120970419-120970441 TTGAAAAATGAAAGGAAAGCAGG - Intronic
1090272987 11:125400806-125400828 TAGGAAAATGAGATGAACACAGG - Intronic
1091530215 12:1347685-1347707 TACAAAAATGAACACAAGGCTGG + Intronic
1091662521 12:2395185-2395207 TAGAGAAAAGAAAAGAAGGCTGG - Intronic
1091725096 12:2840839-2840861 TAGAAAAAAGAGAAAAAAGCAGG + Intronic
1091964153 12:4723852-4723874 TAAAAAAATCAGAAGTCGGCCGG + Intronic
1092001466 12:5036034-5036056 AAGAAAAAAGAAAAGAAGGAGGG + Intergenic
1092118057 12:6023576-6023598 TAGACACATGGGAAGAAGGGAGG + Intronic
1092278236 12:7079040-7079062 TATTAAAATAAGAAGAGGGCTGG + Intergenic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092835302 12:12482278-12482300 TAATAAAAAAAGAAGAAGGCTGG + Intronic
1093059448 12:14588086-14588108 GAGAAAAATAAGAAGAAGAAGGG - Intergenic
1093316886 12:17663409-17663431 TGGAAAAATGAAAAGAATGCAGG + Intergenic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1094064108 12:26344913-26344935 TAGAAAAACCAGAAGAGGGTTGG - Intronic
1094242840 12:28248527-28248549 TAGAAAACTAGGAAGAAGGAAGG + Intronic
1094332484 12:29310111-29310133 TAGAAGAAAGAGTTGAAGGCAGG - Intronic
1094337789 12:29380599-29380621 TCGGAAAATGAGAAGGGGGCGGG - Intronic
1094616975 12:32044925-32044947 TTTAAAAATGAAGAGAAGGCTGG + Intergenic
1094629896 12:32163242-32163264 TAAATTAATGAAAAGAAGGCAGG - Intronic
1094655358 12:32414266-32414288 TAAAAAAAAAAGAAGTAGGCTGG - Intronic
1095177467 12:39109965-39109987 GAGAAAAATCAAAAGAAGGATGG - Intergenic
1095326779 12:40904311-40904333 AAGGAAAAAGAGAAGAGGGCTGG - Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095703367 12:45213783-45213805 CATAAAAATGAGAACAAGGCCGG + Intergenic
1095782056 12:46071406-46071428 TACAAAAATGGGAGGCAGGCTGG + Intergenic
1095828763 12:46560181-46560203 ATGAAAATGGAGAAGAAGGCAGG + Intergenic
1095851850 12:46818022-46818044 TACAAAAGTGAGAAGATGACAGG + Intronic
1095891782 12:47241648-47241670 TAGAAAAATTAAAACAAGCCGGG - Intergenic
1096077952 12:48816558-48816580 CAGAGATATGAGAAGAAGGAGGG + Intronic
1096141867 12:49249129-49249151 TAAGAAAATAAAAAGAAGGCCGG + Intronic
1096641093 12:52994997-52995019 TAAATGAATGAAAAGAAGGCTGG - Intergenic
1097003451 12:55897955-55897977 AAAAAAAAAAAGAAGAAGGCTGG + Intergenic
1097032495 12:56099778-56099800 TAGAAAAAGGAGGAGTTGGCTGG + Intronic
1097439076 12:59587417-59587439 TTGAAATATGAGAAGATGCCAGG + Intergenic
1097558255 12:61167157-61167179 TAGAAGACTCAGAAGAAGACAGG - Intergenic
1097986305 12:65786376-65786398 AAGAAAAATGAAAAGAAGGAAGG - Intergenic
1098349666 12:69545333-69545355 TTGAAAAAGAAGAAGAAAGCTGG + Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098650649 12:72962979-72963001 AAGAAAAAAGAAAAGAAGGGAGG + Intergenic
1099011382 12:77295326-77295348 TGGAGAAATCAGAAGTAGGCAGG + Intergenic
1099306203 12:80959269-80959291 TTTAAAAATGCGAAGGAGGCAGG - Intronic
1099469862 12:83034406-83034428 TAGGAAAATGGGAGGAAGGGAGG + Intronic
1099771657 12:87067026-87067048 TAGAAAGAGGAAAATAAGGCAGG - Intergenic
1099883728 12:88501168-88501190 TTGGAAAATGAAAAGAAGGAGGG - Intronic
1099965168 12:89438102-89438124 TAGAAAAGTGAGTAGAGGGAAGG - Intronic
1100207186 12:92363590-92363612 GAGAAGAATGAGGAGGAGGCAGG - Intergenic
1100282279 12:93129104-93129126 TTGAAAAATGTGAAGCAGGAAGG + Intergenic
1100313082 12:93415628-93415650 TAGAAAAATGAGAAAATAACTGG + Intronic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100587193 12:95991111-95991133 TAAATAAATAAGAAGAAGGAAGG + Intronic
1100755632 12:97748318-97748340 TAGAGAGATGAGGAGAAGCCAGG + Intergenic
1100879851 12:99004598-99004620 TGGAGAAATGAGAGGAAGGTGGG + Intronic
1100909907 12:99347271-99347293 AAAAAACTTGAGAAGAAGGCTGG + Intronic
1100922467 12:99503574-99503596 TAGTAACATAAGAAGAAAGCAGG - Intronic
1100949107 12:99825439-99825461 TTGAAAAACAAAAAGAAGGCTGG + Intronic
1101209649 12:102523289-102523311 TGGAAAAGTAAGGAGAAGGCAGG - Intergenic
1101233944 12:102769289-102769311 TTGAAGACTGAGTAGAAGGCAGG + Intergenic
1101362673 12:104042591-104042613 TAGAAAACTGATAGGAAGTCAGG + Intronic
1101369357 12:104111550-104111572 TAGAAAAATGGGCAAAAGACAGG - Intergenic
1101385476 12:104253506-104253528 TAGAGAATTTAGAAGAGGGCTGG + Intronic
1101562806 12:105875146-105875168 GAGATAAGTGAGAAGAAGGATGG + Intergenic
1101730624 12:107424310-107424332 TAGAGAAAGGAGAAAAAGGCAGG - Intronic
1101758208 12:107638185-107638207 TTAAAAAATGAGAAGAAGTGAGG + Intronic
1102126443 12:110485540-110485562 TACAAAATTAAGAAGAAAGCAGG + Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102484173 12:113244965-113244987 TAAGAAAATGAGAATGAGGCTGG + Intronic
1102655635 12:114480383-114480405 TAAAAAAATAATAATAAGGCGGG + Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1102781285 12:115567201-115567223 CAGAAATATGAGAAGAAAGATGG + Intergenic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103034692 12:117647054-117647076 GAGAAAAAAGAGAGGAAGACAGG + Intronic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1103572404 12:121853951-121853973 TAAAAAAAAAAGAAAAAGGCCGG + Intronic
1103616328 12:122155185-122155207 AAAAAAAAAGAGAAGAAGCCAGG - Intergenic
1103652326 12:122442536-122442558 TAAATAAATGAAAAGACGGCCGG - Intergenic
1103662613 12:122533396-122533418 TAAAAAGATAAGAAGGAGGCTGG + Intronic
1104122904 12:125816190-125816212 TAGACAAATCAGAAGGAGACTGG - Intergenic
1104426314 12:128681274-128681296 TATAAAAATGAAAAACAGGCCGG - Intronic
1105411363 13:20174294-20174316 TAGAAATATGAGAACAGGGGTGG + Intergenic
1105488228 13:20859170-20859192 TAAAAAACTGAAAAGGAGGCTGG + Intronic
1105840041 13:24246561-24246583 TAGAAAAATGTGACTCAGGCCGG + Intronic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106529949 13:30581395-30581417 TGCAAAAATGAGCAGCAGGCAGG - Intronic
1107138372 13:36970316-36970338 TAAAAAAAAGAGAAGAGGCCAGG + Intronic
1107553486 13:41497815-41497837 TGGAATAATGAGAATAAAGCTGG + Intergenic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1107702986 13:43067166-43067188 TAGAAAAATGAGAAATAAGAGGG + Intronic
1107850587 13:44568754-44568776 TACAAAAATGGGAAGAGGGTGGG + Intronic
1108346633 13:49552885-49552907 TAGAAAGACTAGAAGAAGGCTGG + Intronic
1108520515 13:51243321-51243343 TGAAAAAAAGAGATGAAGGCAGG + Intronic
1108558849 13:51623337-51623359 TGGAAAGATGAAAAGGAGGCTGG + Intronic
1108630874 13:52280861-52280883 TGGAAAGCTGATAAGAAGGCTGG - Intergenic
1108655814 13:52531679-52531701 TGGAAAGCTGATAAGAAGGCTGG + Intergenic
1108749446 13:53432577-53432599 TATAAAGATGAGAGGAAGGCTGG + Intergenic
1108834401 13:54523293-54523315 GAGAAAAGGGAGAGGAAGGCAGG - Intergenic
1109284333 13:60394359-60394381 TAGAAAAAAAAAAAGAAGGCTGG - Intergenic
1109582510 13:64361192-64361214 TAAAAAGAAGAGAAGAAGGATGG - Intergenic
1109713878 13:66195140-66195162 TTGAACAAAAAGAAGAAGGCTGG - Intergenic
1109749485 13:66671388-66671410 TGGAAAGATCAGAAGAAGACAGG + Intronic
1110041343 13:70763194-70763216 TAGAGAAGTAAGAAGTAGGCGGG + Intergenic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1110872674 13:80470577-80470599 TAGTAAAATGAAAGGAAGGATGG - Intergenic
1111025826 13:82521575-82521597 AAGAAAAATGAGCAGTAGACTGG - Intergenic
1111682357 13:91459213-91459235 TAAAAAAAAGAAAAGAAGGTTGG + Intronic
1111851108 13:93575630-93575652 TAAGACACTGAGAAGAAGGCAGG - Intronic
1112537435 13:100273917-100273939 AAGAAAAAAGGGAAGAAGGAAGG - Intronic
1112948485 13:104960612-104960634 ATGGAAAATGAAAAGAAGGCAGG - Intergenic
1112999115 13:105611584-105611606 CAGAAACATGACAAGAATGCAGG - Intergenic
1113112339 13:106837038-106837060 AAGAGGAATGAGAAGAAGGTTGG + Intergenic
1113359756 13:109619409-109619431 TAGAAGAAAGAGAAGAATGGTGG - Intergenic
1113398185 13:109968371-109968393 TGGAAAAGGGAGAAGAAGCCGGG + Intergenic
1113762075 13:112855472-112855494 TTTCAAAATGACAAGAAGGCTGG - Intronic
1113843420 13:113372701-113372723 TTTAAAAATAAAAAGAAGGCTGG - Intergenic
1114281317 14:21194837-21194859 GAGAAAGAAGAGAAGAAGGAAGG - Intergenic
1114473043 14:22976942-22976964 TAGAAAACTGTTAAGGAGGCAGG - Intronic
1114761782 14:25323959-25323981 TACAAAAAAGAGATGAAGGGTGG + Intergenic
1114820474 14:26012092-26012114 GAGAAAAATAAGAAGATGGATGG + Intergenic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115001959 14:28432929-28432951 TTGAAAAATAAGAATAAAGCTGG - Intergenic
1115157220 14:30355050-30355072 TAGAAAAATGAAAACAAGATTGG - Intergenic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115593605 14:34887709-34887731 GAGAAAAATGAAAAGAAGTTCGG - Intergenic
1115819085 14:37194667-37194689 TTGAAAAACGATAAAAAGGCTGG - Intergenic
1116070670 14:40040905-40040927 TAGAAGAAAGAAAAGAAGGGAGG - Intergenic
1116243873 14:42383016-42383038 GAGAGGAATGAGAAGCAGGCTGG - Intergenic
1116342922 14:43749568-43749590 GAGAAAAGTGGGAAGAAGGGAGG - Intergenic
1116375830 14:44199528-44199550 AAGAAAAAAGGGAAGAAGGGAGG + Intergenic
1116388102 14:44357638-44357660 GAAAAATAAGAGAAGAAGGCAGG + Intergenic
1116880324 14:50161012-50161034 TAAAAAAAAGAAAAAAAGGCTGG + Intronic
1116925333 14:50629007-50629029 TAGAATAATAAAAAGTAGGCTGG - Intronic
1117218127 14:53573328-53573350 ATGAAGAATGAGAAGAACGCTGG + Intergenic
1117236092 14:53777356-53777378 TTGAAAAAGGAGAATAAAGCGGG + Intergenic
1117330600 14:54708157-54708179 TAGAAGGGTGAGAAGAAGTCAGG + Intronic
1117592890 14:57293022-57293044 CAGATAACTGAGAAAAAGGCAGG - Exonic
1117809308 14:59529913-59529935 TAGATAAAAGAGAGGAAGACAGG - Intronic
1118136087 14:63029655-63029677 GAGAAAAATGAGAAGAAGAGAGG + Intronic
1118205599 14:63720324-63720346 GAGAAAAAGGAAAAGAAGGATGG + Intronic
1118583115 14:67324883-67324905 AAAAAAAATGAAAGGAAGGCTGG - Intronic
1119260679 14:73236518-73236540 TAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1119387788 14:74268658-74268680 AAGAAAGAAGAAAAGAAGGCAGG + Intergenic
1119527639 14:75334886-75334908 TAGAAAAATGAGCTGATGTCAGG + Intergenic
1119770238 14:77216090-77216112 TAGAAAAGAGAGAGGAAGGAAGG + Intronic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120510769 14:85411550-85411572 TAGAGAATTGAGAATTAGGCAGG + Intergenic
1120592740 14:86394986-86395008 AAGAAAAAAAAGAAAAAGGCTGG + Intergenic
1121046140 14:90789424-90789446 TTAAAAAAGGAAAAGAAGGCAGG + Intronic
1121069854 14:91008568-91008590 CAAAAAAATGAGAGGATGGCTGG + Intronic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121652597 14:95570409-95570431 TAGAAAAAAGAAATGAAGCCTGG - Intergenic
1121918327 14:97856528-97856550 TTGAAAAAGGAAATGAAGGCTGG + Intergenic
1121932418 14:97984676-97984698 TAGAGAAATGATAAGACTGCGGG - Intergenic
1122322255 14:100862120-100862142 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1122383306 14:101325935-101325957 TGGCAAAAGGTGAAGAAGGCTGG - Intergenic
1122621645 14:103061128-103061150 AAGAAAAAGAAAAAGAAGGCCGG + Intergenic
1202938502 14_KI270725v1_random:117487-117509 AAGACAAATGAGAAGAGCGCAGG - Intergenic
1123394696 15:19920404-19920426 AAGACAAATCAGAAGAGGGCAGG + Intergenic
1123440938 15:20290939-20290961 TATAAAATTGGGAGGAAGGCTGG - Intergenic
1123464049 15:20501075-20501097 TAGAAATATCAGTAGATGGCCGG - Intergenic
1123654016 15:22499346-22499368 TAGAAATATCAGTAGATGGCCGG + Intergenic
1124258043 15:28162030-28162052 ATAAAAAATTAGAAGAAGGCCGG + Intronic
1124307922 15:28594544-28594566 TAGAAATATCAGTAGATGGCCGG + Intergenic
1124334572 15:28847461-28847483 TAGAAAAGTAAAAAGTAGGCAGG + Intergenic
1124455994 15:29843483-29843505 TAGAAAAATCAAAGGTAGGCTGG - Intronic
1124573622 15:30888140-30888162 TAGAAAAATAATTTGAAGGCTGG + Intergenic
1124781702 15:32642255-32642277 TAGAAGAATGATTAGAAGGAGGG + Intronic
1124877126 15:33605444-33605466 TGGAGAAGTGGGAAGAAGGCTGG + Intronic
1125025694 15:35026969-35026991 TAAAAAAATAAAAAGTAGGCTGG + Intergenic
1125917679 15:43503749-43503771 AAGAAGAATCAGGAGAAGGCAGG - Intronic
1126034411 15:44533755-44533777 TCAAAAAAAAAGAAGAAGGCTGG - Intergenic
1126129946 15:45330982-45331004 TATAAAAATGAAATCAAGGCCGG + Intergenic
1126492016 15:49247447-49247469 GAGAAAAAAGAAAAGAAGGAAGG + Intronic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126676915 15:51167522-51167544 TAGAAAAATGCCAACTAGGCGGG - Intergenic
1127149770 15:56061243-56061265 TAAAAAAAGGAAAAGAAGGCTGG + Intergenic
1127260883 15:57325368-57325390 TAAAAAAATGAGTAAGAGGCAGG - Intergenic
1127628879 15:60806803-60806825 GACAAAAAGGAGAAAAAGGCAGG + Intronic
1127767625 15:62202876-62202898 TAGAAAAGTGAGATCAATGCTGG - Intergenic
1128296614 15:66526058-66526080 TAGAAAAATGTGAAGATGGTTGG - Intronic
1128661778 15:69506600-69506622 AAAAAAATAGAGAAGAAGGCTGG - Intergenic
1128976623 15:72158881-72158903 TTGAAAAATGGGCAAAAGGCTGG - Intergenic
1128990543 15:72256091-72256113 TATACAAATGAGAAGTAGGCTGG - Intronic
1129344989 15:74911735-74911757 GAGATAAATGAGAAGCAGGCAGG + Intergenic
1129571647 15:76692390-76692412 TAGAAAAATAACATGAAGGCTGG + Intronic
1129657765 15:77535969-77535991 TAGAAAAATGGGAACATGGCCGG - Intergenic
1129858915 15:78845085-78845107 AAGAAAAAAGAAAAGAAAGCTGG - Intronic
1130143795 15:81256207-81256229 TAGAAAAAGGGCAAAAAGGCTGG - Intronic
1130528667 15:84728628-84728650 TAGAAAAAGCAGAAGAGGGCCGG - Intergenic
1130574468 15:85079614-85079636 TAGAAAGAATAGAAGCAGGCTGG + Intronic
1130610674 15:85358106-85358128 GAGAAAAATCAAAAGAGGGCAGG + Intergenic
1131171604 15:90182980-90183002 TAGAAAAATGCGATATAGGCCGG + Intronic
1131910621 15:97196330-97196352 TATATGAATGAAAAGAAGGCAGG + Intergenic
1132441732 15:101872906-101872928 TAGAAAAATGAGTTGAATGCTGG + Intergenic
1133876671 16:9741151-9741173 TATCACTATGAGAAGAAGGCTGG + Intergenic
1134010480 16:10848518-10848540 TAGAAAAGAGAAAAGAAGCCTGG + Intergenic
1134398214 16:13884944-13884966 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
1134542533 16:15079104-15079126 TAGAAATATGAAGAGGAGGCCGG - Intronic
1134759900 16:16705086-16705108 TAGAAAAATGAAATGCAGGCTGG + Intergenic
1134986172 16:18654119-18654141 TAGAAAAATGAAATGCAGGCTGG - Intergenic
1135133813 16:19873166-19873188 TTGAAAAATAAGAGGAAGGCTGG + Intronic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135266924 16:21035028-21035050 CAGAAATAAGAGAGGAAGGCTGG + Intronic
1135360110 16:21805182-21805204 TAGAAATATGAAGAGGAGGCTGG - Intergenic
1135479391 16:22809734-22809756 CACAAAATTAAGAAGAAGGCTGG - Intergenic
1135846986 16:25927900-25927922 TAGAAACATGTGAAATAGGCTGG + Intronic
1135872842 16:26166926-26166948 TAGAAAAATGGGCAAAGGGCAGG - Intergenic
1135879109 16:26236226-26236248 TAAAAAAATGAAAATAATGCTGG + Intergenic
1135943118 16:26840154-26840176 TAGTAAAATAAAAAGGAGGCTGG + Intergenic
1136023063 16:27452225-27452247 TCGAAAAATGAATAGGAGGCTGG + Intergenic
1136055482 16:27685443-27685465 TAGAAAAATAAGATGAAACCAGG + Intronic
1136078411 16:27833435-27833457 TTGAAAAAGAAGAATAAGGCAGG - Intronic
1136262696 16:29091758-29091780 TAGAAATATGAAGAGGAGGCCGG + Intergenic
1136360339 16:29775358-29775380 AAGAAAAAAGAAAAAAAGGCCGG + Intergenic
1136427296 16:30177485-30177507 TAAAAAAATTAAAAGAGGGCTGG + Intergenic
1136697120 16:32092598-32092620 AAGACACATGAGAAGAGGGCAGG - Intergenic
1136700789 16:32138820-32138842 AAGACACATGAGAAGAGGGCAGG + Intergenic
1136725919 16:32357451-32357473 TACAAAATTGGGAGGAAGGCTGG + Intergenic
1136766868 16:32788639-32788661 AAGACACATGAGAAGAGGGCAGG - Intergenic
1136797619 16:33035889-33035911 AAGACACATGAGAAGAGGGCAGG - Intergenic
1136801227 16:33081739-33081761 AAGACACATGAGAAGAGGGCAGG + Intergenic
1136936684 16:34474214-34474236 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1136947988 16:34678867-34678889 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136955377 16:34778745-34778767 AAGGCAAATGAGAAGAGGGCAGG + Intergenic
1136959102 16:34825251-34825273 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136963135 16:34874356-34874378 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136967226 16:34928559-34928581 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1137085017 16:36109295-36109317 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1137087838 16:36150670-36150692 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1137092279 16:36208827-36208849 AAGACAAATGAGAAGAGAGCAGG + Intergenic
1137221551 16:46456776-46456798 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1137226407 16:46515610-46515632 TATAAAAAGCAGAACAAGGCTGG + Intergenic
1137257914 16:46792767-46792789 AAGAAAAAAAAGAAGACGGCCGG + Intergenic
1137392032 16:48089385-48089407 AAGAAAGATGATAAGAATGCAGG + Intronic
1137520131 16:49186306-49186328 TTGAAAAATAAGAACAAAGCTGG - Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137666536 16:50252923-50252945 TTGAAAAAAGAAAAGAAGTCTGG - Intronic
1138109009 16:54308371-54308393 AAGAAAAATAGAAAGAAGGCTGG + Intergenic
1138312246 16:56037131-56037153 TAGGGAAAAGAAAAGAAGGCAGG - Intergenic
1138485428 16:57339818-57339840 TCAAAAAAAGAGAAGAAGTCAGG + Intergenic
1138845749 16:60563815-60563837 TTGAAAAATAAGATGATGGCAGG + Intergenic
1138987491 16:62348419-62348441 TGGGAAAATGAGAAGAATGTGGG + Intergenic
1139061787 16:63262395-63262417 TATAAAAATCAGAATAAGGATGG - Intergenic
1139130258 16:64134331-64134353 TACAAATATTAGAAGAAGGGAGG + Intergenic
1139156460 16:64448803-64448825 TAGAAAAATAAGAGAAAGGAAGG + Intergenic
1139423995 16:66867681-66867703 TTGCAAAATGGGAATAAGGCCGG - Intronic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139808959 16:69596421-69596443 TTAAAAAAAGAAAAGAAGGCCGG + Intronic
1139918230 16:70441164-70441186 TATAAAAAAGAAAAGAAGGCTGG + Intergenic
1140826168 16:78708914-78708936 CAGAAAAATAAAAAGAAGGCAGG + Intronic
1140928491 16:79605649-79605671 GTGAAGAAAGAGAAGAAGGCTGG - Intergenic
1140953530 16:79841466-79841488 GAGAAAAATGGGAAAAAAGCAGG - Intergenic
1141087176 16:81104369-81104391 TAAAAAAAAAAAAAGAAGGCCGG + Intergenic
1141104320 16:81220756-81220778 AAGAAAAATGGGAGGAAGGTTGG + Intergenic
1141199123 16:81883597-81883619 GAGAAGACTGAGAAGATGGCAGG + Intronic
1141475878 16:84273032-84273054 GAGTAAAATGAGAAGATGGGTGG - Intergenic
1141544462 16:84755473-84755495 TAGAGAAGTGAGAAGCACGCAGG - Intronic
1141776471 16:86126428-86126450 TTAAAAAATGAGAAGTAGGCTGG + Intergenic
1141867037 16:86757475-86757497 AAGAAAAATGAGAACCAGGAAGG + Intergenic
1141884138 16:86880238-86880260 GAGGAAAAAGAGAAGAAGGGAGG + Intergenic
1203000512 16_KI270728v1_random:160304-160326 TACAAAATTGGGAGGAAGGCTGG - Intergenic
1203069263 16_KI270728v1_random:1050891-1050913 AAGACACATGAGAAGAGGGCAGG - Intergenic
1203132114 16_KI270728v1_random:1696708-1696730 TACAAAATTGGGAGGAAGGCTGG - Intergenic
1142959136 17:3541712-3541734 TTGAGCAATGAAAAGAAGGCTGG - Intronic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143440448 17:6968283-6968305 TAGAAAAATAAGAACAAAGTTGG + Intronic
1143488698 17:7270778-7270800 TCAAAAAATTGGAAGAAGGCCGG + Intergenic
1143698453 17:8638635-8638657 TAGAACAAAGAGAAGAAGCACGG + Intergenic
1143995238 17:11000978-11001000 CAGAAAACTATGAAGAAGGCAGG - Intergenic
1144400330 17:14891829-14891851 AATATAAATCAGAAGAAGGCTGG + Intergenic
1144431130 17:15192567-15192589 AAGAGAAATGAGAAGAAGGTGGG - Intergenic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1145324032 17:21783580-21783602 AAGACAAATGAGAAGGGGGCAGG - Intergenic
1145326580 17:21835215-21835237 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1145689559 17:26724381-26724403 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1145692642 17:26759240-26759262 CAGAAAAATGACATGAAGCCGGG + Intergenic
1145892508 17:28427033-28427055 AAAAAAAACAAGAAGAAGGCTGG + Intergenic
1146077289 17:29742929-29742951 TCAAAAAATCAAAAGAAGGCTGG - Intronic
1146299415 17:31676601-31676623 AAGAAAAATGGGAGGAAGGAGGG + Intergenic
1146330678 17:31924646-31924668 TACAAAAAATAAAAGAAGGCTGG - Intergenic
1146960513 17:36971920-36971942 TAGAAAACAAAGAAGAAAGCTGG - Intronic
1147306138 17:39565728-39565750 TAGAAATATGAGAGGGAAGCTGG - Intergenic
1147697938 17:42370558-42370580 CAAAGAAATGAGAAGATGGCTGG - Intronic
1148014262 17:44509993-44510015 AAAAAAAAAGAGAAGAAGGGAGG + Intergenic
1148058106 17:44814016-44814038 AAGTAGAATGAGTAGAAGGCAGG + Intronic
1148341956 17:46878548-46878570 GAGAAAAATGGGGAGAGGGCTGG + Intronic
1148498321 17:48068991-48069013 TACAAAAATGACAAGTTGGCCGG + Intergenic
1148499902 17:48082204-48082226 TAAAAAAATGATAAAGAGGCTGG + Intronic
1148593384 17:48833258-48833280 AAGAAAAGTAAGCAGAAGGCCGG + Intronic
1148593441 17:48833830-48833852 TAGAAAGAGCAGAAGTAGGCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149309487 17:55380133-55380155 AAGAAAAAGGAAAAGAAGGTAGG + Intergenic
1149347186 17:55750965-55750987 CAGGAAACTGAGGAGAAGGCGGG - Exonic
1149509371 17:57226125-57226147 AAAAAAAAAGAAAAGAAGGCTGG - Intergenic
1149710071 17:58733309-58733331 TATAAAAATGAGATAAAGCCGGG - Intronic
1150031742 17:61744565-61744587 TAGAAAAATTAAAAGAACGTTGG - Exonic
1150354118 17:64468786-64468808 TAAAAAAATGAAAAGATGGCCGG + Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150716578 17:67577294-67577316 AATAAAAATAAAAAGAAGGCCGG + Intronic
1151264734 17:72945946-72945968 TAGAAAAATCAGATAAAGTCTGG + Intronic
1152399421 17:80056463-80056485 TACAAAAATGAGAAATTGGCCGG + Intronic
1203182830 17_KI270729v1_random:80349-80371 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1203190770 17_KI270729v1_random:185806-185828 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1153079995 18:1211305-1211327 TGGAATAATGAGAAACAGGCTGG - Intergenic
1153284461 18:3445426-3445448 TTAAAAAATGAGAAGAAGGCCGG + Intronic
1153372974 18:4341201-4341223 AAGAAAAATGTGAAGAAGAGGGG + Intronic
1153875071 18:9362794-9362816 TAAAAAAATGAGAACTAGCCTGG - Intronic
1154072227 18:11163014-11163036 TTGAAGAATGAGAAGAAGACAGG - Intergenic
1154516438 18:15171967-15171989 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1155031907 18:21992021-21992043 TAAAAAAATGAGAAGAATCTGGG + Intergenic
1155124578 18:22859758-22859780 TACAAAAATGAGTAGCAGTCGGG + Intronic
1155348809 18:24885803-24885825 TAGAGTGATGAGATGAAGGCAGG + Intergenic
1155880367 18:31140503-31140525 AAGAAAAATGAGAAGAAAAATGG - Intronic
1156826937 18:41441861-41441883 AAGAAAGGTGAGAAGAAGGAAGG - Intergenic
1157049636 18:44147363-44147385 TTTAAAAATGAAAACAAGGCTGG + Intergenic
1157165822 18:45357586-45357608 TAAAGAAATAAGAAGAAGGAAGG + Intronic
1157355529 18:46930517-46930539 TAGAAAAAAGAAAAGCAGGCCGG + Intronic
1157365686 18:47062081-47062103 TATAAGAATTAGAAGTAGGCTGG + Intronic
1157672725 18:49543759-49543781 TTTAAAAATGAGGAGAAGGCCGG - Intergenic
1157849485 18:51034545-51034567 AAGAAAAAGGAAAAAAAGGCTGG - Intronic
1157868493 18:51207699-51207721 AAGAAAAATGAAAAAAAGGCTGG + Intronic
1157904452 18:51556763-51556785 TTTAAAAATCAGAAGACGGCCGG - Intergenic
1158240419 18:55371243-55371265 TAGAAACATGATCAGAGGGCAGG + Intronic
1158442214 18:57486412-57486434 TAGAAAAAAGGGAAGAACGAGGG - Exonic
1158466049 18:57690877-57690899 TATTAAAAAGAGAAAAAGGCCGG + Intronic
1158494656 18:57943480-57943502 AAGAAAAATGAGGAGAAGGAGGG - Intergenic
1158701887 18:59755552-59755574 AAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1158719464 18:59911218-59911240 TAGAAAAAAGAAAAAATGGCTGG + Intergenic
1158748361 18:60227730-60227752 TATCTAAATGAGAAGAACGCAGG + Intergenic
1158912102 18:62074803-62074825 GAGAACAATGAGAAAAAGGCTGG + Exonic
1159157790 18:64606771-64606793 GAGAAAAATGAGAAAATGGCTGG + Intergenic
1159237752 18:65698993-65699015 CACAAAAATGAGAACAAGACAGG - Intergenic
1159459003 18:68698718-68698740 TAAAAAACTAAGAAGAGGGCCGG + Intronic
1159517675 18:69478401-69478423 GAGAAAAAGGAGGAGAAGGAAGG - Intronic
1159529921 18:69642577-69642599 AATAAAAATGAAAAAAAGGCAGG - Intronic
1159998872 18:74996465-74996487 TAGAAAAAGGAAATGAAGTCAGG + Intronic
1160039252 18:75330969-75330991 TAGAAAGAGGAGAAGAAAGAAGG - Intergenic
1160293530 18:77617093-77617115 CTGAAAAGTGGGAAGAAGGCAGG - Intergenic
1160354091 18:78211927-78211949 TCGAAAAAGGAGAATAAGGTTGG - Intergenic
1160443204 18:78908255-78908277 TAGAAAAGTGTGAAGAATGAGGG + Intergenic
1160643199 19:160241-160263 TAGAAAAATGAGTTGAATGCTGG - Intergenic
1161147067 19:2685325-2685347 ATGAAAAATGAAGAGAAGGCTGG + Intronic
1161371926 19:3917287-3917309 TAAAAAAAAGAGAAGAGGCCGGG + Intronic
1161517376 19:4703954-4703976 TTGATGAAGGAGAAGAAGGCAGG + Exonic
1161658101 19:5528363-5528385 AAGAAAAATAAGAAGAAGAAAGG + Intergenic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1162059630 19:8086762-8086784 AATAAAAATGAAAATAAGGCTGG - Intronic
1162395308 19:10414931-10414953 TAAAGAAATGAGAACTAGGCTGG + Intronic
1162404364 19:10464699-10464721 AAGAAAAATGAAAACAAGGCCGG - Intronic
1162484334 19:10949758-10949780 AAAAAAAAAAAGAAGAAGGCCGG + Intergenic
1162485191 19:10956025-10956047 AAAAAAAAAAAGAAGAAGGCCGG + Intergenic
1162542693 19:11307414-11307436 TAAAAAAATAAAAATAAGGCCGG - Intronic
1162844998 19:13385522-13385544 TCTAAAAAAGAAAAGAAGGCCGG - Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163386661 19:17004200-17004222 TAGAAACTGGTGAAGAAGGCCGG - Intronic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164284819 19:23804589-23804611 TAGAAAAATGAGGCACAGGCCGG - Intronic
1164557094 19:29261743-29261765 GAGAAAAATAAGAAAAAGACTGG + Intergenic
1164775473 19:30850222-30850244 TATAAAAAGGAAAAGAAGGAGGG + Intergenic
1165294421 19:34915293-34915315 AAGAAAAAAGAAAAGAAGGAAGG + Intergenic
1165941820 19:39418280-39418302 AAGAAAAAAAAGGAGAAGGCTGG + Intronic
1166013965 19:39966127-39966149 TAGAAATTTGAAAAAAAGGCCGG - Intergenic
1166037014 19:40175906-40175928 TAGAAAAATAAAAAGCAGGCCGG - Intergenic
1166197137 19:41214480-41214502 AAGAAAAAGGAAAAGAAAGCAGG - Intergenic
1166542615 19:43615401-43615423 TAAAAAAATAAAAATAAGGCCGG + Intronic
1166617973 19:44268332-44268354 AAGAAAAATGAAAAGAAAACAGG - Intronic
1166806747 19:45492255-45492277 TAGACAGATGAGATGAAGGTTGG - Intronic
1167164350 19:47788298-47788320 TAAAAAAAAGAAAAGCAGGCCGG - Intergenic
1167212015 19:48139384-48139406 TAGAGAAGAGAGAAGAGGGCAGG - Intronic
1167553110 19:50174673-50174695 GAGAAAAATAACAAGAATGCAGG + Intergenic
1168046604 19:53798564-53798586 TAGGAAGATGAGAGGAAGGGAGG + Intronic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168083846 19:54030395-54030417 TATAAAAATTATGAGAAGGCCGG + Intergenic
1168185996 19:54699642-54699664 GACATAAATGAGAAGCAGGCAGG - Intronic
1168211091 19:54890722-54890744 TAAAAATATAAAAAGAAGGCTGG - Intergenic
1168220873 19:54959431-54959453 TAGAAAAAAAACAAGGAGGCCGG - Intronic
1168416671 19:56173649-56173671 TACAGAAATGAGAAGAAAGATGG + Intergenic
1202668998 1_KI270709v1_random:32245-32267 AAGACACATGAGAAGAGGGCAGG + Intergenic
925409672 2:3632774-3632796 TGGAAAAATGAGCAGAATCCCGG + Intronic
926306969 2:11644439-11644461 TAGAAATATGAGAAGAGGGGCGG + Intergenic
926347915 2:11966236-11966258 TAGTCAAATCAGATGAAGGCAGG - Intergenic
926596124 2:14791285-14791307 TAGAAAAAAGGCATGAAGGCCGG - Intergenic
926753942 2:16221222-16221244 AAGAAAAAAGAGCACAAGGCTGG + Intergenic
926812828 2:16771609-16771631 AAGATAAATGGGAAGAAGGAAGG + Intergenic
926825061 2:16898093-16898115 TAGAAAATGGGGAGGAAGGCTGG - Intergenic
926942426 2:18152446-18152468 TAGGAAAATTAAAAGAAGGAAGG - Intronic
927203610 2:20593315-20593337 AACATAAATGAGGAGAAGGCCGG - Intronic
927785855 2:25974362-25974384 TAGGAAAAAAAGAAAAAGGCCGG - Intronic
927821412 2:26268848-26268870 TAGAAAAAGCAGGGGAAGGCTGG + Intronic
928220358 2:29398190-29398212 GAGAGAAATGAGAAGATGGGAGG - Intronic
928477243 2:31641032-31641054 TGGAAAAATGAGTAGATGGGAGG - Intergenic
928660882 2:33500638-33500660 TAAAAAAATGAGAAGGAGGTGGG + Intronic
928704467 2:33933255-33933277 GAGAAAGAAGGGAAGAAGGCAGG - Intergenic
928753811 2:34500387-34500409 TGGAAAAATAAGAGGTAGGCTGG + Intergenic
928879123 2:36077261-36077283 AAGAAAAATCAGAGAAAGGCAGG + Intergenic
928925212 2:36571707-36571729 TAGATAAAGGGGAAAAAGGCTGG + Intronic
929113914 2:38428488-38428510 AAGAAAAAATAGAAGAAGGAGGG - Intergenic
929154970 2:38780966-38780988 AAAAAAAAAAAGAAGAAGGCAGG - Intronic
929590410 2:43142165-43142187 TAGAAAAGGGTGAAAAAGGCCGG + Intergenic
929717080 2:44323334-44323356 TAGAAGAATTAGAAGAATGGGGG - Exonic
930365518 2:50434376-50434398 TAGAAAAAGCAAAAGATGGCCGG - Intronic
930405844 2:50954628-50954650 AAGAAAGAAGAGAAGCAGGCAGG + Intronic
930445405 2:51464682-51464704 TTACAAAATGAGAAGAAAGCTGG + Intergenic
930479759 2:51932229-51932251 TAAAAAAAAGAAAAGAAGCCCGG - Intergenic
930761494 2:55043587-55043609 TAAAAAAATAAAAATAAGGCTGG + Intronic
930901417 2:56511552-56511574 TAGATACATGAAAAGAAGCCCGG - Intergenic
931644680 2:64411279-64411301 TTGAGAAAAGAGAAGAAGGCAGG - Intergenic
931764414 2:65442210-65442232 TAGAAAAAGGAATAGAAGGCCGG + Intergenic
931794765 2:65698782-65698804 AGGAAAAATGAGAAAAAGGAGGG - Intergenic
931833733 2:66077795-66077817 TAGTAGGATGACAAGAAGGCAGG + Intergenic
931891941 2:66682812-66682834 AAGGACAAAGAGAAGAAGGCAGG - Intergenic
932164555 2:69494263-69494285 AGGAAAGATGACAAGAAGGCAGG + Intronic
932473739 2:71985531-71985553 TAAATAACTCAGAAGAAGGCAGG - Intergenic
932600081 2:73117879-73117901 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
932753052 2:74384500-74384522 TAGAAAAATGAGAAGAGAGGAGG + Intronic
932800019 2:74733414-74733436 TAAAAAAATAAATAGAAGGCTGG + Intergenic
932815643 2:74859388-74859410 TAAAAAAATAAATAGAAGGCCGG + Intronic
932835428 2:75031364-75031386 TAAAGAAATAAGAAGAAGGGAGG + Intergenic
932857629 2:75253873-75253895 TAGAAAAGACAGAAGAAGGTTGG - Intergenic
932903018 2:75721843-75721865 AGGAAAAATGAAAAGAATGCAGG + Intergenic
932961634 2:76419233-76419255 AAGAAAAATGAGGAAAAGGAAGG - Intergenic
933128612 2:78643766-78643788 TAGAAAAATGAGGGAAAGCCAGG - Intergenic
933224102 2:79725678-79725700 AATAAAAATGTGAAGAAGGATGG - Intronic
934056942 2:88259015-88259037 AAGAAAAAAAAGAAGAAGACTGG + Intergenic
934142194 2:89057404-89057426 TACAAAAATGAGAAGATAGATGG + Intergenic
934227045 2:90143142-90143164 TACAAAAATGAGAAGATAGATGG - Intergenic
934252286 2:90367622-90367644 AAGACAAATGAGAAGAGGGCAGG - Intergenic
934257156 2:91435323-91435345 AAGACAAATGAGAAGAGGGCAGG + Intergenic
934319965 2:91963121-91963143 TACAAAATTGGGAGGAAGGCTGG - Intergenic
934484733 2:94695224-94695246 TAAGAAAATGAGAAGAAGCCGGG + Intergenic
934887624 2:98038816-98038838 TAGAAAAGAAAGAAGGAGGCCGG - Intergenic
935260243 2:101349184-101349206 TAGAAAAATGGGGAGAAAGCTGG - Exonic
935480566 2:103583008-103583030 AGGAAAACTGAGAAGAAGGGAGG - Intergenic
936376908 2:111948615-111948637 ATGAAAAATGAGAAAAAGGAAGG - Intronic
936720533 2:115247184-115247206 GAGAAAAATGAGGAGAAGCTGGG + Intronic
936772595 2:115932860-115932882 TAGAAATATGAGATACAGGCTGG + Intergenic
937197539 2:120172966-120172988 TAGAAAACTGAGAAGTACTCGGG + Intronic
937487085 2:122326458-122326480 ATGAAGGATGAGAAGAAGGCTGG - Intergenic
937621622 2:123994660-123994682 GAGAGAGATGAGAAGATGGCTGG - Intergenic
938195741 2:129326069-129326091 AAGAAAAAAGAAAAGAAGGAAGG + Intergenic
938385828 2:130866383-130866405 TGGAAAAAAAAGAAGAAGGTGGG + Intronic
938516759 2:132016961-132016983 AAGACAAATGAGAAGAGGGCAGG - Intergenic
938715032 2:134011393-134011415 TAGAAAGATAACCAGAAGGCAGG - Intergenic
939201474 2:139041351-139041373 TTTAAAAATTAGAATAAGGCTGG + Intergenic
939365724 2:141228198-141228220 TAGAAAAATTAAGAGAAGCCGGG - Intronic
939520197 2:143220505-143220527 TAGAAAATATAAAAGAAGGCTGG - Intronic
939534778 2:143414635-143414657 TAGAAATATGAAAAACAGGCAGG + Intronic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
939582992 2:143973492-143973514 TAGAAAAATGAGAAATTGGCCGG + Intronic
939603470 2:144222807-144222829 CAGAAAAAAGAAAAGAAAGCTGG + Intronic
939635093 2:144572196-144572218 GAGATAATTGAGTAGAAGGCTGG + Intergenic
939718695 2:145618991-145619013 TATTAAAATGTTAAGAAGGCAGG - Intergenic
939772630 2:146340979-146341001 AAGAAAACTAAGAAGTAGGCAGG - Intergenic
939990295 2:148872028-148872050 AAGAAAAAGGAGAACAGGGCCGG - Intergenic
940450558 2:153830638-153830660 TAGAAAAATGAGCAAAAGATTGG - Intergenic
940942195 2:159574687-159574709 TAAGAAAATGAAATGAAGGCTGG + Intronic
941161624 2:162042204-162042226 TAGACAAATGAGGATAATGCCGG + Intronic
941339345 2:164287108-164287130 TAGAAGAAAGGGAAGAAGGAAGG + Intergenic
941426825 2:165357269-165357291 GACAAAAATGACTAGAAGGCAGG - Intronic
941590353 2:167412427-167412449 TAGAGAAATGAGCAAAAGTCTGG + Intergenic
941652963 2:168113085-168113107 TAGACAATGGAGAAGAGGGCTGG - Intronic
941696155 2:168553104-168553126 GACAAAATTGGGAAGAAGGCAGG + Intronic
941852763 2:170200761-170200783 TAGAAAAAAGTGAGGAAGGCAGG + Intronic
942375274 2:175330255-175330277 GAGAAAGATGAGAGAAAGGCTGG + Intergenic
942428953 2:175889169-175889191 TAGAAGAAAAAGAACAAGGCAGG + Intergenic
942466309 2:176210480-176210502 TAAAAAAATCAGAATCAGGCCGG - Intergenic
942657680 2:178231118-178231140 TCCAAAAATGGGAAAAAGGCTGG + Intronic
943072962 2:183163902-183163924 TAGAAAGATGACATAAAGGCTGG + Intergenic
943234639 2:185301503-185301525 TAGAAAAATAAAAATAAGGATGG - Intergenic
943428398 2:187766025-187766047 TAGAAAAATGTAGACAAGGCTGG + Intergenic
943577137 2:189643075-189643097 TAGAAAAAAAAGGAGAAGGAGGG - Intergenic
943592816 2:189819878-189819900 TTGAAAAATGGAAAGAAAGCTGG - Intronic
943599487 2:189897910-189897932 TAGAAAAGTGAGAGTAGGGCTGG + Intronic
943698586 2:190964073-190964095 TAGAAAAATCACAAGAAATCTGG - Exonic
943721617 2:191208950-191208972 AAGAAAGGTGAGAAGAAGGAAGG + Intergenic
944023353 2:195133524-195133546 TAGAAAAATCAGAATAATGTTGG + Intergenic
944364277 2:198898264-198898286 AAGAAAAGAGAGAAGAAGGAAGG + Intergenic
944858786 2:203794278-203794300 TAGAAACATAAGCAGTAGGCCGG + Intergenic
945191747 2:207195735-207195757 TAGAAACATGTTTAGAAGGCTGG - Intergenic
945507021 2:210654132-210654154 GAAAAAAATGATGAGAAGGCAGG - Intronic
945619239 2:212112470-212112492 TAGAAAAATCAGTACAAGGAAGG - Intronic
945840713 2:214884563-214884585 TAGAAAAATAAGAAAAAGAAAGG - Intergenic
945929593 2:215841784-215841806 TAGAAAATTCAGGAGCAGGCCGG + Intergenic
946076651 2:217079211-217079233 TACAAAAAGGAGAAGAAGGAGGG + Intergenic
947374285 2:229480064-229480086 CAGAAAAAATAGAAGAATGCAGG + Intronic
947919182 2:233854581-233854603 TAGAAAACCGAGAGGAAGGCAGG - Intergenic
948331829 2:237174144-237174166 TTGAAAAAGCAGAAGAAAGCTGG - Intergenic
948683051 2:239649732-239649754 TAAAAAAATCAGGAGTAGGCTGG + Intergenic
949083179 2:242121504-242121526 TAAAAAAGAGAAAAGAAGGCTGG - Intergenic
1169144482 20:3243468-3243490 TAAAAAAATAAAAATAAGGCTGG - Intergenic
1169144993 20:3246603-3246625 AAGAAAAAAGAGAAAAAGACAGG - Intergenic
1169535414 20:6533723-6533745 TACAAAAAAAAGAAGCAGGCAGG - Intergenic
1169613595 20:7412506-7412528 TTAAAAAATGAGGAAAAGGCAGG - Intergenic
1169752115 20:9004988-9005010 TAGAAAAAAGGAATGAAGGCCGG - Intergenic
1169770836 20:9198363-9198385 TAGAAGAAAGAGAAGAAGGTAGG + Intronic
1170042703 20:12054705-12054727 TTGGAAAATGGGAAGAAAGCAGG + Intergenic
1170305748 20:14935946-14935968 TGGAAAAAAGAAAAGAAGGAAGG - Intronic
1170402326 20:16001367-16001389 AAGAAAAAAGAGAAAAAGGGAGG + Intronic
1171364501 20:24614592-24614614 TAGGAAAATCAAAAGAAGGAAGG + Intronic
1171950579 20:31417962-31417984 TCGAAAAAAGGGAAAAAGGCCGG + Intergenic
1172076335 20:32300708-32300730 TAGAAAAACTAGAAACAGGCTGG - Intronic
1172088481 20:32408712-32408734 TATGAAAATGCAAAGAAGGCTGG - Intronic
1172204540 20:33153661-33153683 TAGAAAAATGAAAAGATGAATGG + Intergenic
1172495789 20:35382804-35382826 TAAAAAAATGAAAATTAGGCCGG - Intronic
1173163916 20:40672617-40672639 AAGAAAAAGAAGAAGAAGGTGGG + Intergenic
1173804616 20:45916043-45916065 TAAGAAAATGAGAGCAAGGCTGG - Intergenic
1173967704 20:47125987-47126009 AAGAAAAGTGAGGCGAAGGCAGG + Intronic
1174463174 20:50697575-50697597 CAAAAAAATAAAAAGAAGGCCGG - Intergenic
1174807391 20:53616499-53616521 TATAAAAATGCAAAGATGGCCGG - Intergenic
1174945360 20:54979527-54979549 TAGAAAAAAGAACAGAAGCCTGG + Intergenic
1175087942 20:56476793-56476815 TAGAAAACAGAAAACAAGGCCGG - Intronic
1175166113 20:57045927-57045949 GAGATAGCTGAGAAGAAGGCTGG - Intergenic
1175343441 20:58250625-58250647 TTGGACAGTGAGAAGAAGGCAGG + Intergenic
1175367973 20:58468308-58468330 TACAAAAATGGGAAGTGGGCTGG + Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176279773 20:64294112-64294134 TAAAAAAGAGAAAAGAAGGCTGG - Intergenic
1176584812 21:8571649-8571671 AAGACAAATGAGAAGAGCGCAGG + Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1176892489 21:14334986-14335008 AAGAAAAGTGAGAAGAAAGGAGG - Intergenic
1176929386 21:14789884-14789906 AAGAAAAATTAGAAGAAGCAAGG - Intergenic
1176931700 21:14819907-14819929 TAGAAAAACAAGCAGCAGGCCGG - Intergenic
1177067850 21:16463334-16463356 TAGAGAGATGAGAAGAAGACAGG + Intergenic
1177483153 21:21720289-21720311 TCGAAAAAAGAGAGGAAGGAAGG - Intergenic
1177552039 21:22635597-22635619 TAGAAAGAAGAGAGGGAGGCCGG - Intergenic
1177612760 21:23474199-23474221 TTTAAAAATGAAAAGAAGACTGG - Intergenic
1177973020 21:27813778-27813800 AAGGAAAAAGAGAGGAAGGCTGG + Intergenic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1178591964 21:33918680-33918702 TAAAAAAAAAAAAAGAAGGCTGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178869904 21:36364753-36364775 TAAAAAAATGTGAAGCAGCCCGG + Intronic
1179266599 21:39809170-39809192 TATAAAAATAAGCAGCAGGCTGG - Intergenic
1179273920 21:39873621-39873643 TTGAAAAATGGGAAGAAGAATGG - Intronic
1179376867 21:40857465-40857487 TAGAACAAAAAGAAGAAGGAAGG - Intergenic
1179477243 21:41654965-41654987 TATAAAAATGAAATGTAGGCCGG + Intergenic
1179632256 21:42685762-42685784 AAGAAAAAAGAAAAAAAGGCCGG - Intronic
1179675992 21:42982431-42982453 AAGAAAAAGGAGCATAAGGCCGG + Intronic
1179794921 21:43776905-43776927 CAGAGGGATGAGAAGAAGGCAGG + Intergenic
1180023187 21:45142226-45142248 TTGAAAAACAAAAAGAAGGCAGG - Intronic
1180267623 22:10548551-10548573 AAGACAAATGAGAAGAGCGCAGG + Intergenic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1180308214 22:11147175-11147197 TACAAAATTGGGAGGAAGGCTGG - Intergenic
1180335693 22:11575002-11575024 TGCAAAAATGGGGAGAAGGCAGG + Intergenic
1180546690 22:16508988-16509010 TACAAAATTGGGAGGAAGGCTGG - Intergenic
1180569487 22:16701992-16702014 TAGACACATGGGAAGAAGGGAGG + Intergenic
1180978727 22:19868611-19868633 GACAAAAATGTGAAGAAGGGAGG + Intergenic
1181469662 22:23130157-23130179 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
1181755202 22:25019192-25019214 TAGAAATCTGACAGGAAGGCAGG + Intronic
1182212491 22:28688370-28688392 TATAAAATTGGGAGGAAGGCTGG + Intronic
1182352743 22:29707952-29707974 TCAAAAAAAGAAAAGAAGGCAGG + Intergenic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182565327 22:31194431-31194453 TATAAAAATGAGAAATTGGCCGG + Intronic
1182638229 22:31746207-31746229 TTGAAAAATAAGTACAAGGCTGG - Intronic
1182912504 22:33996860-33996882 AACAAAAATAAGAAGCAGGCTGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183389003 22:37533135-37533157 AAGAAAAAAGAAAAGAAGGCGGG + Intergenic
1183881480 22:40835068-40835090 CTGAAAAATTAGGAGAAGGCGGG - Intronic
1183942577 22:41304051-41304073 TCAAAAAATAAAAAGAAGGCTGG - Intronic
1184324439 22:43772341-43772363 AAAAGAAATGAAAAGAAGGCCGG + Intronic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184459972 22:44631720-44631742 TACAAAAATCAGAAGAGGTCAGG + Intergenic
1184819212 22:46896182-46896204 AAGAAAAATGGGCAAAAGGCAGG - Intronic
1185228424 22:49667030-49667052 TCCAAAAAAGAGAGGAAGGCAGG + Intergenic
1185264090 22:49889236-49889258 TAGAAAAATGGGCAGAGTGCCGG - Exonic
1203325638 22_KI270738v1_random:13100-13122 AAGACAAATGAGAAGAGGGCAGG - Intergenic
949538899 3:5017028-5017050 CAGAAAAATGAGAATAACACTGG - Intergenic
949708852 3:6850836-6850858 TATTAAAAAGATAAGAAGGCGGG - Intronic
949747616 3:7312905-7312927 AAAAAAAAGGAGGAGAAGGCAGG - Intronic
949937079 3:9124302-9124324 AACAAAATTCAGAAGAAGGCTGG + Intronic
949976518 3:9465990-9466012 TATGAAAATTAGAAGGAGGCCGG + Intronic
950035626 3:9883157-9883179 AAAAAAAAAAAGAAGAAGGCCGG - Intergenic
950082064 3:10229802-10229824 TAAAAAAATGAAAAAGAGGCCGG + Intronic
950176288 3:10877097-10877119 TATAAAAATGGGCAGAGGGCTGG - Intronic
950203063 3:11058183-11058205 TAGATGAATGATGAGAAGGCCGG + Intergenic
950331553 3:12159744-12159766 TAGAAAACAAAGAAGCAGGCTGG + Intronic
950502808 3:13375283-13375305 GAAAAAATTGAGAATAAGGCAGG - Intronic
950838424 3:15942879-15942901 TAGAAGAGAGAGAAGAAGGCAGG - Intergenic
951222728 3:20085805-20085827 TAGAAAAATTACATGTAGGCAGG - Intronic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
951682064 3:25305273-25305295 AAGGAAAAAGAGAAAAAGGCTGG + Intronic
952108434 3:30095208-30095230 TAGAAAAATGAGCAGGAGATAGG + Intergenic
952331236 3:32366207-32366229 TAGAGACGTGAGTAGAAGGCAGG - Intronic
952395248 3:32915334-32915356 AATAAAAATGAGAAAGAGGCCGG - Intergenic
952412102 3:33058609-33058631 TAGAAAAATGAAAAGAAAACAGG + Intronic
952634689 3:35513962-35513984 TAGAAAAATTACTAGAAGGAAGG - Intergenic
952749614 3:36814728-36814750 GAGAAAAAAGAGGGGAAGGCTGG - Intergenic
953321098 3:41972465-41972487 TAGAAAAATAACAACAAGGCTGG + Intergenic
953643647 3:44732741-44732763 TAGAAAAATGTGAAGAAAAAAGG + Intronic
953811277 3:46114916-46114938 TAGAAAAATCTGAACAAAGCAGG - Intergenic
954020189 3:47733457-47733479 TAAAAAAAGAACAAGAAGGCCGG + Intronic
954602128 3:51878098-51878120 TGGAAAAAGGAGAAGAAAGCAGG + Intergenic
954603691 3:51892526-51892548 TAGAAATATGGAAAGGAGGCCGG + Intergenic
954608034 3:51928948-51928970 TGGAAAAAGGAGAAGAAAGCAGG + Intergenic
954843196 3:53531146-53531168 TACAAAAATGAGGAGGAGGCTGG - Intronic
954980584 3:54741800-54741822 TAAAAAAATAGGAACAAGGCAGG - Intronic
955104497 3:55883976-55883998 TGGAGAAATTTGAAGAAGGCTGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
955972636 3:64450987-64451009 CAGAAAAATGATACAAAGGCTGG - Intergenic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956575482 3:70747887-70747909 TATAAAATTGAGAAGAGGGAAGG + Intergenic
956853836 3:73256691-73256713 TAGAAAAATGAGAATATTCCAGG - Intergenic
956989715 3:74749515-74749537 GAGAAAAATGATAAGAACGGAGG + Intergenic
957188442 3:76974296-76974318 AAGAAAAATAAGAAAAAGGGGGG - Intronic
957227372 3:77467361-77467383 GAGAAAAATGAGAAGCAGTAGGG + Intronic
957482367 3:80815124-80815146 TAGACAAATGAGAAGAACAAAGG + Intergenic
957758786 3:84527255-84527277 TTTAAAAATGAGAGGAAGGCAGG + Intergenic
957785176 3:84873511-84873533 TAGAAAAAGGAGTATTAGGCTGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958128290 3:89385743-89385765 TGGAAAACTCAGAAGAAGACAGG + Intronic
958137841 3:89519356-89519378 AAGAAAAAAGAAAAGAAGGGAGG - Intergenic
958425015 3:93969755-93969777 AAGAAAAAAGAGAGGAAGGAAGG - Intronic
958936640 3:100262426-100262448 TTTAAAACTGAAAAGAAGGCTGG + Intronic
958981312 3:100723561-100723583 TAGACAAATGCAAAGAAAGCTGG + Intronic
959018010 3:101158022-101158044 TTGAAAAATGACATGAAAGCTGG - Intergenic
959213499 3:103419282-103419304 GAGAACAATGTGAATAAGGCTGG + Intergenic
959270596 3:104204445-104204467 AAGAAAAATGAGTGGAAGACTGG + Intergenic
959676247 3:109039210-109039232 TAGAAATCAGAGAAGCAGGCGGG - Intronic
960275844 3:115728315-115728337 TAAATCAAGGAGAAGAAGGCAGG - Intergenic
961584622 3:127911738-127911760 GAAAAAAAAGAGAAGAAAGCTGG + Intergenic
961740842 3:129032350-129032372 TAGAAAACAGGGAAGAAGCCAGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
961917598 3:130393294-130393316 CAGAAAAGTGAGACGTAGGCAGG - Intronic
962127783 3:132640382-132640404 TATTAAAATGAAAAGTAGGCTGG - Intronic
962300879 3:134242003-134242025 TATAAGAATGAGAATGAGGCCGG + Intronic
962371424 3:134823860-134823882 CAGCAGAATGAGAAGAAAGCAGG + Intronic
962619621 3:137164584-137164606 GAGGAAAATGAAAGGAAGGCAGG + Intergenic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
962904165 3:139786979-139787001 TGGAACAATGAGAAAAAGACTGG - Intergenic
963250031 3:143094917-143094939 TAGATCAATAAGAAAAAGGCAGG - Intergenic
963441820 3:145349574-145349596 TAGAAAATTGAGAAGCAAGCAGG + Intergenic
963583725 3:147158492-147158514 TAGAAAGAAGGGAAGAAGGCAGG + Intergenic
963810532 3:149772315-149772337 TGAAAAAATGAGAAGGATGCCGG - Intronic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
963979946 3:151526300-151526322 AAGAAAAATGACAAGAAGAAAGG - Intergenic
964351932 3:155811713-155811735 TAAGAAAAGGAAAAGAAGGCCGG + Intergenic
964487282 3:157199011-157199033 TAGAAAGATTAGAAGACAGCTGG - Intergenic
964607818 3:158576631-158576653 TAGAAAGCTCAGAAGCAGGCTGG + Intronic
964692922 3:159473021-159473043 TAGAAAAATAAAAAGAATGCTGG + Intronic
964698198 3:159533821-159533843 TAGCTAAAAGAGAAGAAAGCAGG + Intronic
965087710 3:164120749-164120771 TGGAAAAAAGAGAAGAAATCAGG + Intergenic
965188545 3:165498999-165499021 AAGAAAAAAGAAAAGAAGGGAGG + Intergenic
965497068 3:169411987-169412009 TATAAAAATAAAAATAAGGCTGG + Intronic
965570671 3:170168824-170168846 TAGAGAAAAGAAAAGAATGCAGG + Intronic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
965611540 3:170549203-170549225 AAAAAAAAAAAGAAGAAGGCCGG - Intronic
966260221 3:177968527-177968549 AAGACTAATGAAAAGAAGGCTGG + Intergenic
966419577 3:179724159-179724181 TAAAAAAATAATAAGAAGGCCGG + Intronic
966428064 3:179802236-179802258 AAGAAAAAAGAAAAGCAGGCTGG + Intronic
966560859 3:181318811-181318833 TAAAAAATTGAGAGGAAGGAAGG - Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966869173 3:184278743-184278765 TAGAAGAATAAGAGGAAGGAAGG - Intronic
967172186 3:186830336-186830358 TAGACAAATGAAAATAAGGGTGG - Intergenic
967326743 3:188248285-188248307 TAGAAGCATAAAAAGAAGGCAGG - Intronic
967466803 3:189815933-189815955 TATAAAAATGAGAAGCAGAAAGG - Intronic
967575324 3:191083111-191083133 TAGAAAATAGAGAAATAGGCTGG + Intergenic
968210619 3:196845648-196845670 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
968560107 4:1275485-1275507 TTGAAAAAGAAGAATAAGGCTGG + Intergenic
968795416 4:2700499-2700521 AAGAAAAATAAGAAGAAGAAAGG + Exonic
971136615 4:23875638-23875660 GTGATAAAAGAGAAGAAGGCTGG - Intronic
971176189 4:24284730-24284752 TAGAAAAGAAAGAAGAAGCCCGG + Intergenic
971187194 4:24390661-24390683 TATAAAAATGAAAAGCAAGCAGG - Intergenic
971394164 4:26213418-26213440 TAGGAAAATGAGAAGGGGTCAGG + Intronic
971397463 4:26242054-26242076 TAAAGACATGAGAAAAAGGCTGG - Intronic
971400923 4:26274637-26274659 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
971697135 4:29920666-29920688 TAAAAATATGTGAATAAGGCTGG + Intergenic
971705533 4:30037844-30037866 TAGAAAGATGATAAACAGGCTGG + Intergenic
971790137 4:31159593-31159615 AAGAAAGAAGAGAAGAAGGCAGG + Intergenic
971973590 4:33653171-33653193 TAAAAATATGAGAAAAAGGGAGG + Intergenic
972059551 4:34852335-34852357 TAGAAAAAGAGGAAGACGGCCGG - Intergenic
972335283 4:38102458-38102480 TTGAGAAGTGAGAAGAAGGGAGG + Intronic
972378592 4:38497809-38497831 AAGAAAAATGGGGAGAAGGAAGG + Intergenic
972475315 4:39444436-39444458 GAGAAGAATGAGATGAAGGTGGG - Intronic
973053061 4:45618542-45618564 TAGAAAAATGAGAATAAAAAGGG + Intergenic
973269826 4:48251226-48251248 TTGAAGAATAGGAAGAAGGCTGG - Intronic
973615586 4:52674554-52674576 TAGAAAAATGAAGAGCAGCCGGG + Intergenic
973695477 4:53486379-53486401 TAGAAAAAAGAGAGGGATGCTGG - Intronic
974153861 4:58044908-58044930 TGGAAAGATGAGAAAAAGGGAGG - Intergenic
974189134 4:58481056-58481078 TAGCAAGATATGAAGAAGGCTGG - Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974258820 4:59498051-59498073 TAAAAATGTGAGAAGGAGGCCGG + Intergenic
974378013 4:61102630-61102652 TAGACAAATGTGAAGAAGTGGGG - Intergenic
974567854 4:63601642-63601664 TAGAAAAAAGAAAAATAGGCCGG + Intergenic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
974863894 4:67556573-67556595 TTGAAAAATGAAAAGAAGCAAGG - Intergenic
975302306 4:72804764-72804786 CTGAAAGATGAGAAGAAGTCAGG + Intergenic
975319125 4:72989976-72989998 TATAAAAATGCAAAGAAAGCAGG - Intergenic
975596810 4:76055068-76055090 TAGAAAAATGACAAGAGGCCAGG - Intronic
975647098 4:76555887-76555909 AAGAAAAAAGAAAAAAAGGCAGG - Intronic
976166255 4:82258079-82258101 TAGAAAAAGAAGAACAAAGCCGG - Intergenic
976268689 4:83208810-83208832 TATAAGAATAAGAAGAAGACTGG - Intergenic
976283604 4:83349278-83349300 GAGAAAAATGAGTAGGAGGATGG - Intergenic
976334059 4:83865235-83865257 CAGAAAACTTAAAAGAAGGCGGG - Intergenic
976463996 4:85347066-85347088 TAGAAAAATGCTAAAAAGGCCGG + Intergenic
976595231 4:86889605-86889627 TAGAAAACTGAAGAGTAGGCTGG + Intronic
977308022 4:95349786-95349808 GAGAAAAATGAGATAAAGGCAGG - Intronic
977388053 4:96370314-96370336 TAGAAAAAAAAGAAAAAGTCTGG - Intergenic
977532571 4:98217466-98217488 TAGAAAAAGTAAAACAAGGCTGG + Intergenic
977931675 4:102756743-102756765 TAGATAAGTAAGAAGAAGGTTGG - Intronic
978053393 4:104232476-104232498 TAGATAAATGAGAATAAATCAGG + Intergenic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978445051 4:108772449-108772471 AAGAAATATTAGCAGAAGGCTGG - Intergenic
978449073 4:108809748-108809770 AAGAAAAATGGGAAGAAGTAGGG + Intergenic
978515940 4:109568544-109568566 TTGAAAAAAGAGTAGAAGTCAGG - Intronic
978737290 4:112098510-112098532 TTAAAAGATAAGAAGAAGGCCGG + Intergenic
979128646 4:117010181-117010203 TAGGAAAAAGAAAGGAAGGCAGG - Intergenic
979260637 4:118639899-118639921 TAAAAAAGAGAAAAGAAGGCTGG - Intergenic
979366047 4:119824782-119824804 TATAAAAATGAAAAAAAGGCTGG - Intergenic
979368891 4:119859128-119859150 GAGAAAATTGATGAGAAGGCAGG - Intergenic
979424058 4:120543238-120543260 TAGAAATATGAGAAGTAGAATGG - Intergenic
979439112 4:120729997-120730019 TAGAAAAATCATAAGAAAACTGG - Intronic
979678813 4:123436855-123436877 TAGACAAAAGAGATGAAAGCAGG + Intergenic
979701958 4:123679178-123679200 TGGAAATTTCAGAAGAAGGCAGG - Intergenic
979906196 4:126296831-126296853 TACCAGAATGAGAAGTAGGCAGG + Intergenic
980125676 4:128771689-128771711 TAGAAATTGGAGTAGAAGGCCGG + Intergenic
980135962 4:128858761-128858783 TACAAAAATGAGAATTAGCCGGG - Intronic
980658738 4:135827580-135827602 TAGAAAATAGATAAGAAAGCAGG - Intergenic
981175740 4:141681240-141681262 TAGAAAAAAAAGAGGAAGGAAGG - Intronic
982058075 4:151573608-151573630 TAGATAGCTGAGAAGAAGCCAGG + Intronic
982236491 4:153255474-153255496 TAGCAGAATGAGAAGAAGAAAGG + Intronic
982404812 4:155007771-155007793 GGGAAAGATGAGAAGAAGGGAGG - Intergenic
982792131 4:159605374-159605396 TAAAAAAAAGAGAAGTAGGGTGG + Intergenic
982934274 4:161451421-161451443 AGGAAAAATGAGAGGAAGCCAGG + Intronic
982950871 4:161693932-161693954 TAAAAGAATTACAAGAAGGCTGG - Intronic
983165230 4:164468139-164468161 TTGAAAAAAGAGATGAAGGATGG + Intergenic
984314048 4:178103219-178103241 TCGAAAAATGAGTAGAAAGATGG - Intergenic
984542421 4:181056101-181056123 TATAAAAATGTGAAGTTGGCCGG - Intergenic
984685010 4:182657620-182657642 TAAATAAATAAAAAGAAGGCTGG - Intronic
984766857 4:183406476-183406498 TAAAAAAATAAAAAGGAGGCCGG + Intergenic
984833641 4:183999421-183999443 GAGAAAAATCAGCAGAAGCCAGG - Intronic
985085381 4:186307871-186307893 CATAGAAATGAGAGGAAGGCAGG + Intergenic
985260297 4:188108602-188108624 TAGAGAGATCAGAAGAAGGCAGG - Intronic
986216325 5:5722554-5722576 AAGAAAATTGAGGAAAAGGCGGG + Intergenic
986229014 5:5844373-5844395 TAGGAAAATAAGAAAATGGCCGG - Intergenic
986393426 5:7305472-7305494 TAGAAAAGTAAGAAGTAGGCAGG + Intergenic
986541663 5:8851021-8851043 AAGAAAAATAAGAAGCAGCCCGG - Intergenic
986914453 5:12600617-12600639 TAGAAAAATGAGAGCTAGGAGGG - Intergenic
986947780 5:13045884-13045906 TAGAATAATGAAAAGAAAGAAGG - Intergenic
987172935 5:15277509-15277531 TATAAGAATGAGCAGATGGCGGG + Intergenic
987183695 5:15392526-15392548 TAGAAAAAGGAGAAATCGGCCGG + Intergenic
987368114 5:17168209-17168231 CAGAGAGATGAGAAGCAGGCAGG + Intronic
987492171 5:18595030-18595052 TTGAAGACTGAGAAGAAGGCAGG - Intergenic
987498849 5:18680615-18680637 TAGAAAATTGAGAAGTGAGCCGG + Intergenic
988213325 5:28237823-28237845 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
988314767 5:29610462-29610484 TAGAAAAAGGAGTCAAAGGCCGG + Intergenic
988957680 5:36335221-36335243 TAAAAAACTAAGATGAAGGCTGG - Intergenic
988979974 5:36557688-36557710 AAGAAAAATGAAAACATGGCTGG - Intergenic
989437303 5:41429703-41429725 TAGAAATATGATAAGGAGGGAGG + Intronic
989539479 5:42601924-42601946 TAGAAACATGAAAAGAAAGAGGG + Intronic
989620870 5:43383111-43383133 TAGAAAAATGAAAATGAGCCAGG - Intronic
989753715 5:44925622-44925644 TAAGAAGATGAGAAGGAGGCCGG - Intergenic
990181890 5:53170260-53170282 AAGAAAAATGTGAAAAAGTCTGG + Intergenic
990352691 5:54934695-54934717 GGGAAGAATGAGAAGAAAGCAGG + Intergenic
990756015 5:59071321-59071343 TAGAAAAAAGAGAAAACTGCAGG - Intronic
990759496 5:59112740-59112762 TAGAAAGAAGAGAGGAAGGAAGG - Intronic
990842673 5:60101229-60101251 TAGAGAAATGAAATGAATGCAGG + Intronic
990908202 5:60825857-60825879 TACAAGAATGAGAGGAAGGGTGG + Intronic
991425770 5:66490080-66490102 TAGAAGAAGTAGAAGACGGCAGG - Intergenic
991608094 5:68423107-68423129 TAGAAATATGAGATGACAGCTGG + Intergenic
991610337 5:68443168-68443190 GAGAGAGATGAGAGGAAGGCAGG - Intergenic
991968203 5:72112445-72112467 GTGAAAAATGAGGAGAAGTCAGG - Intronic
992051623 5:72946493-72946515 TATAAAAATGTCAAGGAGGCCGG - Intergenic
992080436 5:73231016-73231038 TAGACAATTGAGAAGGGGGCTGG - Intergenic
992450372 5:76870823-76870845 TTAAAAAATGAGGAGGAGGCTGG + Intronic
992689032 5:79225493-79225515 GAGGAAAATGAGAAGGAAGCTGG - Intronic
992723622 5:79584536-79584558 TAAAAAAATTAGAAATAGGCTGG - Intergenic
992948319 5:81831727-81831749 TATAAAAAAGAAAACAAGGCAGG + Intergenic
992959407 5:81943590-81943612 TAGAATAAGGAGAAGAACGTTGG + Intergenic
993990004 5:94644644-94644666 CTGAAAGATGAGCAGAAGGCAGG - Intronic
994130839 5:96225893-96225915 AAGAAAAAGGAGAAGAAGAATGG - Intergenic
994216899 5:97147774-97147796 TATAAAAATGATAAGAAGGTAGG + Intronic
994483979 5:100372241-100372263 AAGAAAAATAAAAAGAAGGGAGG + Intergenic
994850105 5:105043934-105043956 TAGAAAAATAAGGCCAAGGCAGG - Intergenic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
995506741 5:112868694-112868716 AATAAAAATGTAAAGAAGGCCGG - Exonic
995603404 5:113823847-113823869 TAGAGAAAAGACTAGAAGGCTGG + Intergenic
995866744 5:116699809-116699831 CATAAAAATGAAAAGAAGCCAGG + Intergenic
995980243 5:118093160-118093182 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
996397386 5:123026896-123026918 TAGAAAACCCAGAAGTAGGCTGG + Intronic
996706616 5:126504655-126504677 AAGAAAAATGACATGAAAGCAGG + Intergenic
996798772 5:127379437-127379459 TAGAAGAATGAGAAGACATCAGG - Intronic
996944153 5:129046548-129046570 TAGAAAAAAAAGATGAAGGAAGG - Intergenic
997100586 5:130964547-130964569 CAGAAAAATGATGAGAAGACTGG - Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999035206 5:148341332-148341354 TTGAGAAATGAGAAGCAGCCAGG + Intergenic
999087635 5:148907051-148907073 TTGAAAGATGAAAAGAAGCCAGG + Intergenic
999169930 5:149584916-149584938 TAGAAACATATAAAGAAGGCCGG - Intronic
999274873 5:150323527-150323549 AAGAAGAATGAGCTGAAGGCAGG - Intronic
999524491 5:152389176-152389198 GAGAAGAATGAGAAGAGGGAGGG - Intergenic
999636600 5:153629397-153629419 GAAGAAAGTGAGAAGAAGGCAGG + Intronic
999715119 5:154354237-154354259 TAGAAAACAGAGACTAAGGCAGG + Intronic
999983131 5:156976896-156976918 TAGAAAATAGATATGAAGGCTGG - Intergenic
1000045611 5:157519579-157519601 TTAAAAAGTGAAAAGAAGGCTGG - Intronic
1000209815 5:159098684-159098706 AAGAAGAAAGAAAAGAAGGCAGG + Intronic
1000499283 5:162028734-162028756 AAGAAAAATGGGAGGAAGGGAGG + Intergenic
1000635672 5:163641227-163641249 TAGAAAATTTTAAAGAAGGCAGG + Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1000867229 5:166528712-166528734 AAGAAAAATGAGAAAAATGATGG + Intergenic
1000891943 5:166811214-166811236 TAGAAATATGTGATGACGGCCGG + Intergenic
1001096668 5:168780703-168780725 TAGAGAAATAAAAAGAAGGAAGG - Intronic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001338657 5:170823686-170823708 TAGAAAAATAACAAGATGCCGGG + Intergenic
1001839798 5:174865278-174865300 AAAAAAAATGACTAGAAGGCTGG - Intergenic
1002016285 5:176325757-176325779 TAAAGATAAGAGAAGAAGGCAGG - Intronic
1002062458 5:176633903-176633925 TAGAAAGATCAGTAGGAGGCTGG + Intronic
1002316626 5:178348286-178348308 CAAAATAATGAGAAGAAAGCAGG - Intronic
1002364497 5:178699570-178699592 TAGAAATATGAAAATAAGCCAGG - Intergenic
1002572822 5:180153571-180153593 TGGAGTAATGAGAAGAAGTCAGG - Intronic
1002733672 5:181364229-181364251 TAGAAAAATGAGTTGAATGCTGG + Intergenic
1002750869 6:109889-109911 TAGAAAAATGAGTTGAATGCTGG - Intergenic
1002753345 6:141137-141159 TAAAAAAGAGAAAAGAAGGCTGG + Intergenic
1002862142 6:1088793-1088815 CAGTAAAATGAGAACAAGTCAGG - Intergenic
1002961421 6:1918448-1918470 TTTAAAAATAAGAATAAGGCCGG + Intronic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003228560 6:4228731-4228753 TAGAAAAATGAGTAGAAGGCTGG + Intergenic
1003457076 6:6293024-6293046 CAGAAAGATGAGGAGAAGGATGG - Intronic
1003543607 6:7039764-7039786 TAAAAAAAAGAGAAGTCGGCTGG - Intergenic
1003844741 6:10161304-10161326 TAGATAAAGGTAAAGAAGGCAGG + Intronic
1004014143 6:11717020-11717042 TAGAAACATGGTCAGAAGGCTGG - Intronic
1004201296 6:13550340-13550362 AACAAAAAAGATAAGAAGGCTGG - Intergenic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004528386 6:16430292-16430314 AACAACAATGAAAAGAAGGCAGG + Intronic
1004575921 6:16894740-16894762 TAGAAAAAGAAAAGGAAGGCCGG + Intergenic
1004973217 6:20935369-20935391 AACAAAAATGAGAAGAATGAGGG - Intronic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1005824896 6:29626924-29626946 TAGAAGGATGAGAAGGAGTCAGG + Intronic
1005884544 6:30086621-30086643 GAGAAAACTGAGAAGATGGGGGG - Intergenic
1006081402 6:31569494-31569516 TAAAAGAATGAGAAGAAGGTTGG + Intergenic
1006544472 6:34768453-34768475 TAGAAAGATAAGAATTAGGCTGG + Intronic
1006546010 6:34782045-34782067 TAGAAAAATGAAGTGCAGGCTGG - Intergenic
1006751316 6:36379579-36379601 AAGAAGAAAAAGAAGAAGGCCGG + Intronic
1007134499 6:39508015-39508037 AAGAAAAAAGAGAAGAGGGAGGG - Intronic
1007161383 6:39793944-39793966 TAGAAAAATGAGAAAATGAAGGG + Intronic
1007732615 6:43957272-43957294 AAAAAAAATAAGAAAAAGGCAGG + Intergenic
1007837956 6:44690597-44690619 TAGAAAACTGATCTGAAGGCTGG + Intergenic
1008419974 6:51287125-51287147 AAGAAAAAAGAGAGGAAGGAAGG + Intergenic
1008877800 6:56348517-56348539 TGGTAAAATGAGAATAAGGAGGG + Intronic
1009950233 6:70386927-70386949 TGGCAATATGTGAAGAAGGCAGG + Intergenic
1010003207 6:70969012-70969034 TGGGAATATGAAAAGAAGGCAGG - Intergenic
1010045024 6:71431783-71431805 AAGAAAAAAGAGAGGAAGGGAGG - Intergenic
1010217552 6:73418129-73418151 TTAAAAAATGAGAACAATGCTGG + Intronic
1010290013 6:74124604-74124626 AAGAAGAAAGAGAAAAAGGCAGG - Intergenic
1010322162 6:74524556-74524578 GAGAGAACTGAGGAGAAGGCAGG + Intergenic
1010578279 6:77561523-77561545 GAGAAAAATGTGGAGAAGGAAGG - Intergenic
1010617186 6:78028378-78028400 TAGAGAAATGTGGAGAAGGATGG - Intergenic
1010799927 6:80163198-80163220 TATAAAAGAGAGAAGAAGCCAGG - Intronic
1010964935 6:82193976-82193998 TAGAAAAGTCAAATGAAGGCTGG - Intronic
1011203796 6:84869178-84869200 GTGACAAAGGAGAAGAAGGCAGG - Intergenic
1011963394 6:93120718-93120740 TAGAAATATGGAAAGAAGGAGGG - Intergenic
1012235224 6:96806239-96806261 TAGAAAATTTAAAAGATGGCAGG - Intronic
1012250408 6:96974015-96974037 AAAAAAAAAGAGAAGAAGTCAGG - Intronic
1012266801 6:97154896-97154918 TGGAAAAAGAAGAAGAAAGCTGG - Intronic
1012360607 6:98373937-98373959 AAGAAACATGAGAACAAGCCTGG + Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012798309 6:103792011-103792033 TGGAAAAATGAGATGAAGAAAGG - Intergenic
1013120225 6:107134440-107134462 TAGAAAAAAGTGAACCAGGCTGG + Intergenic
1013147871 6:107412534-107412556 TAGAAAAATGGGCAAAGGGCTGG - Intronic
1013238603 6:108222051-108222073 AACAAAAATGTAAAGAAGGCCGG - Intronic
1013248663 6:108312931-108312953 TAAGAACATGAGAGGAAGGCTGG - Intronic
1013314024 6:108924219-108924241 TTGAAAAATGAGCAGGAGGCCGG + Intronic
1013350764 6:109303681-109303703 TTCAAAAATGAAGAGAAGGCTGG - Intergenic
1013534321 6:111049900-111049922 TAAAAAAATGATATGGAGGCCGG + Intergenic
1013841343 6:114398125-114398147 TGGAAGAATGAAAAGAAGGAAGG - Intergenic
1013855141 6:114563409-114563431 TAGAAAAAGGAAAAGAAGATTGG - Intergenic
1014006917 6:116429650-116429672 TAGAAATATGAGGAGTTGGCCGG + Intronic
1014030558 6:116697418-116697440 TAGAAAAATGAAAAGGAAGAAGG + Intronic
1014562608 6:122909363-122909385 AAAAAAAAAAAGAAGAAGGCAGG - Intergenic
1014727720 6:124992566-124992588 TAGAATAGTGAGAAGAGGGGAGG + Intronic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1015027898 6:128559013-128559035 AACAAGAATGAGCAGAAGGCTGG - Intergenic
1015550018 6:134402538-134402560 TAGAAGAAAGAGAAAAAGACAGG - Intergenic
1015741149 6:136455182-136455204 TAGAAATATGAGTAGTAGACAGG + Intronic
1016079020 6:139833287-139833309 TATAAAAATGAGATGAAACCTGG + Intergenic
1016472286 6:144387433-144387455 TATTAAAATGGGAAGAAGGCCGG - Intronic
1016785439 6:148006119-148006141 TAGAAAGAAGGAAAGAAGGCCGG + Intergenic
1016851431 6:148623247-148623269 TAGATAAATGACAACCAGGCAGG - Intergenic
1016883348 6:148933516-148933538 TTGAATAATGAGAAGCACGCAGG + Intronic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017255478 6:152328706-152328728 TTCAAAAATAAGAAGAGGGCTGG - Intronic
1017381928 6:153841386-153841408 TAGAAGAAACAGAAGACGGCCGG + Intergenic
1017385729 6:153880633-153880655 TAGAAAAATCAGGAAAAGGAAGG + Intergenic
1017726480 6:157279598-157279620 GAGAAAAAAGAAAAGAAGGAGGG + Intergenic
1017786074 6:157758241-157758263 AAGAAAAAAGAGAGGAAGGAAGG + Intronic
1017978270 6:159376331-159376353 TAGAAAGATGAAGAGGAGGCAGG + Intergenic
1018574644 6:165246855-165246877 TAAAAAAATAAAAAGAAAGCTGG - Intergenic
1018693562 6:166370555-166370577 AAGAAAACTAAAAAGAAGGCCGG + Intronic
1019237922 6:170636551-170636573 TAGAAAAATGAGTTGAATGCTGG + Intergenic
1019494974 7:1333475-1333497 TAAAAAAAGGAGAAGAAGGAGGG - Intergenic
1019827524 7:3296851-3296873 TAGAAAAATGAGCAGAGGCTGGG - Intergenic
1020364290 7:7363940-7363962 TATAAAAATGTGGAGGAGGCTGG - Intronic
1020700470 7:11475654-11475676 TAGAAAAATTTGAAGAATGCAGG - Intronic
1020728202 7:11843736-11843758 TAGAAAAGAGAGAAGGGGGCAGG - Intergenic
1020960037 7:14790746-14790768 TAGAAAAATAAGAATAAAGTGGG - Intronic
1021352055 7:19605880-19605902 GAGAAAAATGAAAAGAAGGAGGG - Intergenic
1021441262 7:20679619-20679641 TAGAAAAATGAGAAAAAATGTGG + Intronic
1021562184 7:21979465-21979487 TAGAAAAATGAGAAAAATTTAGG + Intergenic
1021724395 7:23535202-23535224 TAGAAAAATGGAAAATAGGCCGG - Intergenic
1021781625 7:24112742-24112764 TGGAAAAATGAGTAAAAGGCAGG - Intergenic
1021853297 7:24829575-24829597 TAGAGAACTGAGGAGAAGGGGGG - Intronic
1021896878 7:25244866-25244888 AAGAAAAATGGGAAGATGCCAGG - Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022143223 7:27511722-27511744 TATAAAATGGAGAAGCAGGCTGG - Intergenic
1022731282 7:33028703-33028725 TAGAAAAATCAGAAAAAGGATGG + Intronic
1022845619 7:34206892-34206914 GAGAAAAAAGAGAAAATGGCAGG + Intergenic
1023229197 7:38007623-38007645 TAGAAAAAAGATATGAATGCAGG - Intronic
1023375170 7:39548717-39548739 TAGAAAAATGGGAAAAAGAGTGG - Intergenic
1023425230 7:40029128-40029150 TAAAAAATTAAGAAAAAGGCTGG + Intronic
1023541633 7:41272405-41272427 TATAAAAAGGAGTAGAAGCCAGG - Intergenic
1023556624 7:41430118-41430140 GAGAAACAGGAGAGGAAGGCTGG - Intergenic
1023685745 7:42733299-42733321 GAGAAAAGTGTGAAGATGGCTGG + Intergenic
1023739244 7:43263700-43263722 TAGGAAACAGAGAAGAAGGGAGG + Intronic
1024076778 7:45825033-45825055 TAGAAAAATCTGATTAAGGCTGG - Intergenic
1024375719 7:48636125-48636147 TACAATAATGAGAAGAAAGCAGG - Intronic
1024409466 7:49023495-49023517 GAGAAAAATGAGAAGCAAGAAGG - Intergenic
1024731129 7:52254978-52255000 AAGAAAAAGGAGAAGAAAGAGGG + Intergenic
1024807171 7:53156397-53156419 AAGACAAATGAGAAGAGGGCGGG - Intergenic
1025059875 7:55796826-55796848 TAAAAAAGAGAAAAGAAGGCTGG + Intronic
1025127636 7:56356387-56356409 TAGAAAAATCTGATTAAGGCTGG + Intergenic
1025128077 7:56361301-56361323 TAAAAAAGAGAAAAGAAGGCTGG + Intergenic
1025319516 7:58079792-58079814 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1025477929 7:60950263-60950285 AAGACAAATGAGAAGAGTGCAGG + Intergenic
1025489153 7:61090255-61090277 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1025554199 7:62283679-62283701 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1025560582 7:62369595-62369617 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1025562304 7:62382692-62382714 AAGAAAAATGGGAAGCAGGTAGG - Intergenic
1025602866 7:63015967-63015989 TAGAAAAATGTGATTAAGGCCGG + Intergenic
1025840692 7:65143108-65143130 AAGAAAAATGGCAAGCAGGCAGG - Intergenic
1025844577 7:65184822-65184844 TACAACCATGAGAAGAAAGCCGG - Intergenic
1025878019 7:65507055-65507077 AAGAAAAATGGCAAGCAGGCAGG + Intergenic
1025882356 7:65552849-65552871 AAGAAAAATGGCAAGCAGGCAGG + Intergenic
1025891086 7:65649753-65649775 AAGAAAAATGGCAAGCAGGCAGG - Intergenic
1025894905 7:65691160-65691182 TACAACCATGAGAAGAAAGCCGG - Intergenic
1025988890 7:66479749-66479771 AATAAGAATGAGCAGAAGGCTGG - Intergenic
1026162519 7:67882031-67882053 TTGAAAAATGACTAGAGGGCTGG + Intergenic
1027143038 7:75673317-75673339 TTGAAAAAGAAGAACAAGGCCGG - Intronic
1027251871 7:76403957-76403979 TCCAAACATAAGAAGAAGGCCGG - Intronic
1027264824 7:76488597-76488619 TAAAAAAAAGAAAAGAGGGCTGG + Intronic
1027316197 7:76986700-76986722 TAAAAAAAAGAAAAGAGGGCTGG + Intergenic
1027713799 7:81643416-81643438 TAGTAAAATATGAAGCAGGCTGG + Intergenic
1027823065 7:83073134-83073156 TGGAAATATTACAAGAAGGCAGG + Intronic
1027900598 7:84109328-84109350 TATAAAAAAGAGAAGAAGGAAGG + Intronic
1028098599 7:86793098-86793120 TGTAAACATAAGAAGAAGGCTGG - Intronic
1028152247 7:87387653-87387675 AAGAAAAATCATAAGGAGGCTGG + Intronic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028408408 7:90501194-90501216 TAGAAAAAGGAGATACAGGCAGG + Intronic
1028509052 7:91601830-91601852 TAGAAAAAGACAAAGAAGGCTGG - Intergenic
1028613213 7:92735217-92735239 TACAAAAATGATAAGAAGGAAGG - Intronic
1028639344 7:93025939-93025961 GAAAAAAAGGAGAAGAAGGGTGG + Intergenic
1029212139 7:98917823-98917845 TTGAAATATGTAAAGAAGGCCGG + Intronic
1029354142 7:100038697-100038719 TAGAAAATTGAGGATAAGGCTGG + Exonic
1029539752 7:101175629-101175651 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
1029992468 7:104974751-104974773 TAGAAAAATCAAATGTAGGCCGG + Intergenic
1030183950 7:106740998-106741020 TAGAAAGATGAACAAAAGGCTGG + Intergenic
1030275283 7:107714306-107714328 TAGAAAAAGGCAGAGAAGGCAGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030540240 7:110821614-110821636 TAGAAAAAGGAAAGGTAGGCTGG + Intronic
1030605118 7:111632529-111632551 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
1031190964 7:118550343-118550365 TACAAAAATGAGATGAAGGAAGG + Intergenic
1031240075 7:119226853-119226875 TAGAAAACTGAGAATCAGACAGG + Intergenic
1031245694 7:119308576-119308598 TAGAAATAAAAGAAGAAGGCCGG + Intergenic
1031592171 7:123606642-123606664 TAGAAAAAAGAGTAGAATGTTGG - Intronic
1031730345 7:125292626-125292648 TAGAAAAAGGAAAAAAGGGCTGG - Intergenic
1031913390 7:127540627-127540649 TCTAAAAATGTGAAGTAGGCCGG - Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032826231 7:135571218-135571240 TTGAACAATGAGATGAAGTCAGG - Exonic
1032934438 7:136712663-136712685 TAGAAAAATGACAAAAACTCAGG - Intergenic
1033461991 7:141555099-141555121 TAGAAAAACCAGAGGAAGCCTGG + Intronic
1033732041 7:144189519-144189541 TTGAAAGATGAGAAGAATGTGGG - Intronic
1033742890 7:144288102-144288124 TTGAAAGATGAGAAGAATGTGGG - Intergenic
1033751012 7:144361512-144361534 TTGAAAGATGAGAAGAATGTGGG + Intronic
1034118376 7:148604735-148604757 TAAAATAAACAGAAGAAGGCAGG + Intronic
1034525123 7:151654567-151654589 GAGAAAAATGACAAAAAGGAAGG - Intronic
1034647663 7:152662867-152662889 TAAAAAAATGCAAATAAGGCCGG - Intronic
1034847804 7:154463501-154463523 TAAGAAAAGGAGAAGTAGGCTGG - Intronic
1035087156 7:156270489-156270511 TATATAGATGAGAAGAAGGTTGG + Intergenic
1035509848 8:170059-170081 TAGAAAAATGAGTTGAATGCTGG - Intergenic
1036408534 8:8477494-8477516 TCTAAAAAGGAGAAGAAGGCAGG + Intergenic
1036552889 8:9830726-9830748 AAGAAAGATGGGAAGAAGGGAGG - Intergenic
1036826710 8:11982447-11982469 TACAAGAGTGAGAAAAAGGCAGG + Intronic
1037349453 8:17935065-17935087 TAGCAAGATGATAAGAAGGTAGG - Intronic
1037473279 8:19231832-19231854 AAGAAATATAAGAAGAAGGCAGG - Intergenic
1037473327 8:19232190-19232212 AAGAAATATAAGGAGAAGGCTGG - Intergenic
1037483142 8:19323675-19323697 TAAAAAAATCAAAAGGAGGCCGG - Intronic
1037512777 8:19600374-19600396 TACAAAATAGAGAAGTAGGCTGG - Intronic
1037548163 8:19943891-19943913 TATAAAAATAAAAAGTAGGCTGG + Intronic
1037660673 8:20923971-20923993 TGGAAAAATGAGAATAAGGGAGG + Intergenic
1037999752 8:23381636-23381658 TAGAAAAAGGGGTATAAGGCAGG - Intronic
1038735706 8:30167138-30167160 AAGAAAAATTAGCAGAAGGAAGG + Intronic
1038779742 8:30559751-30559773 AAGAAAAATGAGAAGAGGGAGGG + Intronic
1038792273 8:30678686-30678708 AAGAAAAAAGAAAATAAGGCAGG + Exonic
1038838728 8:31159001-31159023 TATAAAAATGAGAACAGGCCGGG + Intronic
1039838141 8:41273913-41273935 TAAAGCAAGGAGAAGAAGGCAGG + Intronic
1039954522 8:42196845-42196867 AAGGCAAATGAGAAGAAGGAAGG + Intronic
1039977590 8:42380515-42380537 AAGAAAAAAGAGAGGAAGGAAGG + Intergenic
1040385020 8:46909289-46909311 TAGAACACTGTGAAGAAAGCAGG + Intergenic
1040564431 8:48553170-48553192 TGGAGAAAGGAGAAGAAGCCCGG + Intergenic
1040807173 8:51407873-51407895 TAGAAAAAGGAGCAGAAAGGGGG + Intronic
1040837134 8:51744369-51744391 GAGAAAAAAGAAAGGAAGGCTGG + Intronic
1040851009 8:51899824-51899846 TAGAAAGTCGAGAAGAGGGCCGG + Intergenic
1041237420 8:55818440-55818462 TAGAAAACTGGGAATCAGGCTGG - Intronic
1041260615 8:56018123-56018145 TAGAAAAATAAAAATAAGGCCGG - Intergenic
1041767704 8:61436632-61436654 CAGAAATATGAGAAGAATCCAGG - Intronic
1041902634 8:62998568-62998590 TAGAAAAATGAAAAGCAGCCAGG - Intronic
1041945426 8:63435354-63435376 TAGCAAAATGAAAAAAAAGCTGG + Intergenic
1042190757 8:66184572-66184594 ATGAAAAATGAGAATCAGGCTGG - Intergenic
1042230903 8:66553384-66553406 AACAAAAATGAGTAAAAGGCTGG - Intergenic
1042305406 8:67325884-67325906 ATGAAATATGAGAAAAAGGCTGG + Intronic
1042978036 8:74492683-74492705 CAGAAATAAGAGAAGCAGGCAGG - Intergenic
1045182867 8:99804835-99804857 TAGAAAAATTTGAAAAAGCCAGG + Intronic
1045662252 8:104450094-104450116 TAGGAAAATGAAGAGAAGGAAGG + Intronic
1045755701 8:105538713-105538735 TAAAACAATGAGATGGAGGCTGG + Intronic
1045855146 8:106756446-106756468 TAGAAAAAAGAGAATTCGGCCGG - Intergenic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1045930837 8:107624611-107624633 TAGAAAAATGATAACGGGGCTGG - Intergenic
1046160127 8:110351563-110351585 AAAAAAAAAAAGAAGAAGGCAGG - Intergenic
1046495330 8:115006441-115006463 TTAAAAAGTGAGAAAAAGGCTGG - Intergenic
1046522695 8:115345816-115345838 TTTAAAAATGAGAAGTAGGTGGG + Intergenic
1046740005 8:117817827-117817849 TAGCAAATGGAGAAAAAGGCCGG + Intronic
1046966566 8:120173749-120173771 TATAAATATTAGAAGAAGGAGGG - Intronic
1047351159 8:124075879-124075901 CAGAAAAATGAGAAAAATGCCGG - Intronic
1047518696 8:125577831-125577853 TAGAAAAAGGAAGAGAAGTCTGG - Intergenic
1047734174 8:127751338-127751360 TAGCAAAAAGTGGAGAAGGCTGG - Intergenic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048087595 8:131200968-131200990 TGGAAAGATGAGAAGAAGACAGG + Intergenic
1048250942 8:132866457-132866479 TAGAAGAAAGAAAAGAAGGAAGG + Intergenic
1048320987 8:133400042-133400064 CAGAAACATGGGGAGAAGGCAGG - Intergenic
1048366366 8:133742334-133742356 TAGAAGAATGGAAAGAAGGAAGG + Intergenic
1048522163 8:135166447-135166469 GAGAAAAATGAAAGGAAGGAAGG - Intergenic
1048621218 8:136134749-136134771 TTGGAAAAAGAGCAGAAGGCAGG - Intergenic
1048912592 8:139150351-139150373 AAGAAAAATGGGAAGGAGACTGG - Intergenic
1049811727 8:144578076-144578098 TTGAAAAATTAGAATAAAGCTGG + Intronic
1050050025 9:1589675-1589697 TAGAAAAATGAGCAAAAGACAGG - Intergenic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050247431 9:3705331-3705353 TTGAAACATCAAAAGAAGGCAGG + Intergenic
1050288390 9:4128356-4128378 TATAAAAGTGAGAAGATGGCAGG - Intronic
1050364528 9:4862037-4862059 AAGAAAAATGGGAAGAAAACAGG - Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050688299 9:8197060-8197082 TAGAAAGATAAGCAGAAGGCAGG + Intergenic
1050694050 9:8259777-8259799 TAGAAAAATGGGAAAGATGCTGG - Intergenic
1050713726 9:8495883-8495905 AAGAAAAATGAGTTAAAGGCTGG - Intronic
1051051460 9:12937354-12937376 TTGAGAAATGAAAAGAAGACAGG + Intergenic
1051189909 9:14500391-14500413 TAAAACAATTAGAAGATGGCTGG + Intergenic
1051474493 9:17490093-17490115 TAGAAATAGGAAAAGTAGGCTGG + Intronic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051835282 9:21330501-21330523 TAAAAAAATGAGAGGCAGGGTGG + Exonic
1051989305 9:23131950-23131972 TAGAAAAAGGAATAGATGGCAGG - Intergenic
1052064286 9:23997624-23997646 TTGAACAATGAGAACAAGGCAGG + Intergenic
1053148220 9:35726392-35726414 GGCAAAAATGAAAAGAAGGCAGG - Intronic
1053148775 9:35729962-35729984 TAGAAAAAGGATGAGAAGACAGG + Intronic
1053673062 9:40389148-40389170 TAAGAAAATGAGAATAAGCCGGG - Intergenic
1054384168 9:64529214-64529236 TAAGAAAATGAGAATAAGCCGGG - Intergenic
1054442719 9:65282109-65282131 AAGACAAATGAGAAGAGGGGAGG - Exonic
1054487559 9:65739392-65739414 AAGACAAATGAGAAGAGGGGGGG + Intergenic
1054511563 9:65987135-65987157 TAAGAAAATGAGAATAAGCCGGG + Intergenic
1054739228 9:68787927-68787949 TAGAAAGATTAGAAAGAGGCTGG - Intronic
1055016571 9:71624958-71624980 TTCAAAAATGAGCAGTAGGCTGG + Intergenic
1055034921 9:71808377-71808399 AAGAGAATTGAGAAGAAGACTGG - Intronic
1055165544 9:73187090-73187112 TACACAAATGAGAAGAAGAAAGG + Intergenic
1055212762 9:73817170-73817192 AGGAAAAAGGAGAAAAAGGCGGG + Intergenic
1055584398 9:77742961-77742983 TAGAAAGATCAGCAGGAGGCTGG + Intronic
1055810610 9:80143678-80143700 TAGAAAAAAGAGAAGTTGGTCGG + Intergenic
1055946496 9:81695801-81695823 TAAAAAAATAAAAAGAAGGCCGG - Intergenic
1055959366 9:81805620-81805642 TAGAAGAATGGGGAAAAGGCTGG + Intergenic
1056149230 9:83767657-83767679 TAGAAAAGAGAGAATATGGCTGG - Intronic
1056181725 9:84090222-84090244 GAGAGAGATGAGAAGATGGCTGG + Intergenic
1056196515 9:84234189-84234211 TTGAAAAATGAAAATTAGGCCGG - Intergenic
1056233122 9:84567021-84567043 TATAAAAATGGGCAGCAGGCTGG - Intergenic
1056320481 9:85430420-85430442 AAAAGAAATGAGAAGAAGGGAGG + Intergenic
1056425466 9:86471240-86471262 TCTAAAAATGGGAAGGAGGCTGG - Intergenic
1056577176 9:87864529-87864551 TAGAGAAACAAGGAGAAGGCAGG + Intergenic
1056645642 9:88409289-88409311 AAGAAAAAAGAAAAGCAGGCCGG - Intronic
1056983741 9:91341820-91341842 TAGAAAAATGTGATGGAGGCTGG + Intronic
1057000271 9:91502793-91502815 AAGAAGTATGAGAAGAACGCAGG - Intergenic
1057043122 9:91862025-91862047 TATAAGAAGAAGAAGAAGGCCGG + Intronic
1057107319 9:92431866-92431888 TAGAAAAATGAGTAAAGGCCAGG - Intronic
1057419748 9:94901642-94901664 TAGAAAAGTGCTGAGAAGGCTGG + Intronic
1057972051 9:99567830-99567852 TTTAAAAAGGGGAAGAAGGCTGG + Intergenic
1058076091 9:100652999-100653021 TAAAAATATGTGAACAAGGCTGG + Intergenic
1058296441 9:103314006-103314028 AATAGAAATGTGAAGAAGGCAGG + Intergenic
1058411221 9:104734274-104734296 TATAAAAATAAAAAGGAGGCTGG - Intergenic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1059155060 9:111982296-111982318 TATAAAGATGAAATGAAGGCAGG - Intergenic
1059535610 9:115077484-115077506 TAGAAATATGATGAGGAGGCCGG - Intronic
1059686597 9:116643474-116643496 TATAAAAATAGGAAGCAGGCTGG + Intronic
1059926988 9:119219483-119219505 AAGATAAATGGGAAGAAGGAAGG - Intronic
1060189507 9:121583089-121583111 TAGAAAACGGAGAAGCTGGCCGG + Intronic
1060240297 9:121897414-121897436 GAGAAAAATGAGCCGAAGCCAGG - Intronic
1060649220 9:125310832-125310854 AAAAAAAAAAAGAAGAAGGCTGG - Intronic
1060722498 9:125988463-125988485 TAAAGAAATGAGAAGCAGGGAGG - Intergenic
1060909980 9:127341818-127341840 TAGAAACAGCAGAAGAATGCAGG + Intronic
1060963476 9:127698388-127698410 TAGAAAAACGAAAAACAGGCCGG + Intronic
1061025235 9:128044158-128044180 TAGAAAAATGGAAAGGTGGCTGG + Intergenic
1061269528 9:129530124-129530146 TAGAAAACTAAGAAGTCGGCCGG + Intergenic
1061332064 9:129901108-129901130 AATAAAAATGACGAGAAGGCCGG + Intronic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061495971 9:130974358-130974380 TAGAAAAATGAGCACCAGGCTGG + Intergenic
1061542261 9:131283652-131283674 TAAAAAAAAAAAAAGAAGGCTGG + Intergenic
1061735559 9:132654647-132654669 TAGAAAAATGAATAAAGGGCCGG + Intronic
1061764394 9:132872358-132872380 TAAAAAAAAGAGAAGAACACAGG + Intronic
1061977451 9:134076936-134076958 TTGAAAGACAAGAAGAAGGCTGG + Intergenic
1062605564 9:137347102-137347124 TAGAAAAATGACATGGAGGCTGG - Intronic
1062758128 9:138316847-138316869 TAGAAAAATGAGTTGAATGCTGG + Intergenic
1203614718 Un_KI270749v1:49168-49190 AAGACAAATGAGAAGAGCGCAGG + Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1186420276 X:9420118-9420140 TAAATAAATAAGAAGAAGACTGG + Intergenic
1186560739 X:10610012-10610034 TAGAAAAACAAAAAGAAGGCCGG - Intronic
1186671580 X:11772271-11772293 ATGAAAAATGGAAAGAAGGCAGG - Intronic
1186988422 X:15041081-15041103 GAGAAAAAAGAGAAAAAGGATGG - Intergenic
1187037621 X:15558496-15558518 TACAAAAATAAGAAGAAGAAAGG - Intergenic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187495539 X:19792602-19792624 TAGAGAAAGGGGAAGAAGACAGG + Intronic
1187560008 X:20393400-20393422 TAGAAAAATGCAAATCAGGCTGG - Intergenic
1187942629 X:24396814-24396836 TACAAAAATGAAAAGAAGACTGG - Intergenic
1188576645 X:31659342-31659364 TAAAAAAATGAGAAACAGGCCGG + Intronic
1188596088 X:31901924-31901946 TAAAAAAATGATAAGAATGTGGG - Intronic
1188636443 X:32437465-32437487 GAGAAAAAAGAGAATAAGGGGGG - Intronic
1188728164 X:33610479-33610501 TGGCAAAGTGAGGAGAAGGCTGG - Intergenic
1189128384 X:38472584-38472606 TGGAAGAAAGAGAAGAAGGAAGG - Intronic
1189215615 X:39320583-39320605 TAGAGAAATTAGAAGCACGCAGG - Intergenic
1189222460 X:39384046-39384068 TAGATAAATGACAGGGAGGCAGG - Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1189984098 X:46538593-46538615 AAAAAAAATGAAAAGAAGACTGG + Intronic
1189993045 X:46612629-46612651 TAGAAAACTGAGATGCAGGCCGG + Intronic
1190059131 X:47199633-47199655 GAGAAAACTGGGCAGAAGGCTGG - Intronic
1190582152 X:51899740-51899762 TAGAAAAATTAGAAAAATTCTGG - Intronic
1190748418 X:53340713-53340735 CACAAAAATGAGAAAAAGGCTGG + Intergenic
1190834975 X:54092245-54092267 GAAAAAAATGAAAAGAAGGCTGG + Intronic
1190961744 X:55256839-55256861 TTTAAAAATGAGAAAAATGCAGG - Intronic
1191857166 X:65636438-65636460 TAGAGAAATGAAAAGCAGGCTGG + Intronic
1192257311 X:69472846-69472868 TAAATAAATGAGATGATGGCTGG - Intergenic
1192833826 X:74778428-74778450 AAGAAAAAAGAAAAGAAGGAAGG - Intronic
1193071616 X:77312124-77312146 TAGAAAAATAAGAGGGAGGCTGG + Intergenic
1193214394 X:78845650-78845672 TAGCAAAAAGAGAACAAAGCTGG + Intergenic
1193536056 X:82716675-82716697 TATAAAAATGGGAACTAGGCTGG - Intergenic
1193927763 X:87509875-87509897 TTGAAAAATGAGAATACGGTTGG - Intergenic
1194543520 X:95204436-95204458 AAGAATAATGAAAAGAAAGCAGG - Intergenic
1194661721 X:96635147-96635169 GTTAAAAATGAGAAGCAGGCAGG - Intergenic
1195007347 X:100699069-100699091 TAGAAAAATGAAAACAGGCCAGG + Intronic
1195660540 X:107373682-107373704 TAGAAATATAGAAAGAAGGCTGG + Intergenic
1195751007 X:108161984-108162006 TAGGAGGATGAGAAGAAGGGAGG - Intronic
1197140251 X:123109992-123110014 TGGAAAAATCAAAAGAAGGAAGG - Intergenic
1197202514 X:123760354-123760376 TAAAAAAATGTGATGCAGGCTGG + Intergenic
1197670292 X:129269370-129269392 TTGAAAACCTAGAAGAAGGCCGG - Intergenic
1197741331 X:129896623-129896645 AAAAAAAATAAGAAGAGGGCTGG - Intergenic
1197816262 X:130501747-130501769 TAGAGAAATGGAAAGAAGGAAGG - Intergenic
1198021613 X:132664303-132664325 TAGAAAAATAAAGTGAAGGCTGG - Intronic
1198131802 X:133703411-133703433 CTGAAACATAAGAAGAAGGCAGG + Intronic
1198250030 X:134870755-134870777 TGGAAAGAGGAGAGGAAGGCAGG + Intergenic
1198452964 X:136786028-136786050 TAGAAAAATGGGCAGTAGGAAGG - Intergenic
1198467963 X:136920599-136920621 TAGAAAAATAAGCAGAAGGTCGG - Intergenic
1198604918 X:138326442-138326464 TAGAAAAGAGAGAAAAATGCTGG - Intergenic
1198892806 X:141418110-141418132 TAGAAATTTGTGAAGAAGACAGG + Intergenic
1199674477 X:150175049-150175071 TAGAAAAGAAAGAAAAAGGCCGG - Intergenic
1200256900 X:154587333-154587355 TAGAAAAATCATTAAAAGGCCGG + Intergenic
1200260869 X:154617070-154617092 TAGAAAAATCATTAAAAGGCCGG - Intergenic
1200832386 Y:7699760-7699782 TGGAAAACAGAGAAGAAGCCGGG + Intergenic
1201187493 Y:11418225-11418247 TACAAAATTGGGAGGAAGGCTGG - Intergenic
1201316903 Y:12656295-12656317 CAAAAACATGAAAAGAAGGCAGG - Intergenic
1201348419 Y:13010830-13010852 TCAAAAAGTGAGATGAAGGCAGG - Intergenic
1201698875 Y:16858136-16858158 TACAAAAATCACAAGCAGGCCGG + Intergenic
1202382108 Y:24282283-24282305 TAAAAAAGAGAAAAGAAGGCTGG - Intergenic
1202488676 Y:25387842-25387864 TAAAAAAGAGAAAAGAAGGCTGG + Intergenic