ID: 1103555857

View in Genome Browser
Species Human (GRCh38)
Location 12:121766084-121766106
Sequence GAACCCTACGGGCCTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103555849_1103555857 14 Left 1103555849 12:121766047-121766069 CCTGGGGCCATCACGGCATTCTA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1103555857 12:121766084-121766106 GAACCCTACGGGCCTCCTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1103555850_1103555857 7 Left 1103555850 12:121766054-121766076 CCATCACGGCATTCTAGAGACGG 0: 1
1: 0
2: 0
3: 0
4: 43
Right 1103555857 12:121766084-121766106 GAACCCTACGGGCCTCCTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103555857 Original CRISPR GAACCCTACGGGCCTCCTGG GGG Intronic
901871651 1:12142127-12142149 GTACCTTACAGGCATCCTGGGGG - Intronic
904397441 1:30231278-30231300 TAACCCTTCGGCCCTCATGGAGG - Intergenic
907242127 1:53086621-53086643 GTGCCCTGCAGGCCTCCTGGAGG + Intergenic
916599219 1:166276084-166276106 GAACCCTGGGGTCCTCTTGGAGG + Intergenic
917458700 1:175208910-175208932 CAACCCTGTGGTCCTCCTGGAGG + Intergenic
924710396 1:246526462-246526484 GACCCCTACCTGCATCCTGGTGG - Intergenic
1067581673 10:47450389-47450411 GAACCCTCCTGGCTTCTTGGTGG - Intergenic
1069633359 10:69911034-69911056 GAGCCCCACTGGCCTCCAGGAGG - Intronic
1074400920 10:113140780-113140802 GCAGCCTGCGTGCCTCCTGGAGG + Intronic
1076124160 10:127961503-127961525 CCACCCCAGGGGCCTCCTGGGGG - Intronic
1076754551 10:132562428-132562450 GAACTCTACGCACCTCATGGGGG - Intronic
1077077538 11:708317-708339 GGACCCTAGGGGCTTCCCGGGGG - Intronic
1077111382 11:863673-863695 GAACCCTGGGTACCTCCTGGGGG + Intronic
1080649813 11:34213042-34213064 GAATCCTTTGGGCCTGCTGGGGG + Intronic
1084267965 11:68014641-68014663 GAACACCTCGGGCCTCCTGGAGG - Intronic
1091842446 12:3630733-3630755 GAGCCCTGCGGGCATCCTGGAGG - Intronic
1094877979 12:34672740-34672762 GAACCCTCCGAGCCTGGTGGGGG + Intergenic
1095944538 12:47746518-47746540 GAGGCCCACGGGGCTCCTGGTGG - Intronic
1103555857 12:121766084-121766106 GAACCCTACGGGCCTCCTGGGGG + Intronic
1116844552 14:49853123-49853145 GAGCCCTACGGCCCCCCTGTGGG - Exonic
1119521859 14:75292349-75292371 TATCCATACGGGCCTGCTGGGGG + Intergenic
1119532953 14:75375978-75376000 GAAACCTACAGGACTCCTAGAGG + Intergenic
1122985885 14:105211444-105211466 GGCCCCTTCTGGCCTCCTGGGGG + Intronic
1128789249 15:70420805-70420827 GACCCCTAATGGCATCCTGGAGG + Intergenic
1129324278 15:74791830-74791852 GGACACTAAGTGCCTCCTGGAGG - Intronic
1130077148 15:80698947-80698969 GCACCTTACAGTCCTCCTGGGGG - Intronic
1132543926 16:524471-524493 GACACGTTCGGGCCTCCTGGGGG - Intergenic
1134038434 16:11049763-11049785 GAACCCCTCAGGCCTGCTGGGGG - Intronic
1134081365 16:11327264-11327286 GAACGCTCCGGGCCTTCTGTGGG + Intronic
1136502204 16:30677547-30677569 CAACCCCTCTGGCCTCCTGGTGG + Intergenic
1148863981 17:50619098-50619120 AAACCCTAGGCTCCTCCTGGAGG + Intronic
1152091271 17:78249189-78249211 GAAGCCTGCAGGCCTGCTGGGGG + Intergenic
1152513209 17:80804254-80804276 GAACACCACGGCCCTCCTGCTGG - Intronic
1152714282 17:81891187-81891209 GCACCCTCCGGACCTCCGGGCGG + Intronic
1155057879 18:22200831-22200853 GAGCCCTCCCTGCCTCCTGGCGG - Exonic
1160010924 18:75106739-75106761 GAGCCCTGCGGGTCTCCTGTTGG + Intergenic
1160980223 19:1813205-1813227 GAACCCTGCGGGCTTCCTCTTGG - Intergenic
1160988441 19:1850935-1850957 GAACCCTATGGGCCTCAGGGAGG + Intergenic
1167512693 19:49904418-49904440 GGTCCCAACAGGCCTCCTGGGGG - Intronic
931992162 2:67801660-67801682 GAACTCTAAGGGGATCCTGGTGG - Intergenic
933750508 2:85599905-85599927 CAACGCTGCGGGCCTCTTGGTGG - Exonic
939109673 2:137992185-137992207 TAAGCCTACGGAACTCCTGGAGG + Intronic
947794086 2:232883499-232883521 GACCCCCACAGGCCTCCTCGGGG - Intronic
947910277 2:233796086-233796108 GACTCCTACAGGCCTCCTGCAGG - Intronic
948436101 2:237955719-237955741 GAACCCGGCGGGCCCCCTGAAGG - Intergenic
1175175508 20:57109389-57109411 GGACCCTCCAGGCCTTCTGGAGG - Intergenic
1179419286 21:41222814-41222836 GAGCCCTCGGGACCTCCTGGTGG + Intronic
1180175326 21:46084401-46084423 GAACCCTCCTGCCGTCCTGGGGG + Intergenic
1180968241 22:19801526-19801548 GAAGCCTCAGGGCCACCTGGCGG - Intronic
1182030183 22:27152929-27152951 TAACCCTAAGGGCCAGCTGGAGG + Intergenic
1183200104 22:36380120-36380142 GCAGCCTCCGGGCCTCCTGGGGG - Intronic
961769798 3:129240663-129240685 CAGCCCTCCGGTCCTCCTGGAGG + Intergenic
962236325 3:133710594-133710616 CAAAACTGCGGGCCTCCTGGGGG + Intergenic
963399133 3:144774910-144774932 GAAACCTACTGGTCTCTTGGGGG - Intergenic
966891164 3:184408679-184408701 GAGCCAGACAGGCCTCCTGGAGG + Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968548985 4:1212863-1212885 GAAGCCTGGGGCCCTCCTGGAGG + Intronic
968553158 4:1234380-1234402 GAACCGTCCTGGCATCCTGGAGG - Intronic
969076124 4:4579165-4579187 GACCCCTACAGGCACCCTGGTGG + Intergenic
977848216 4:101791093-101791115 GAACCCTCTGGGCTGCCTGGCGG - Intronic
986200305 5:5573213-5573235 GAACCCTACAGGCCCCCGCGGGG - Intergenic
1002904309 6:1436491-1436513 GCACCCTCCGGGCCCACTGGCGG - Intergenic
1006833158 6:36981188-36981210 GGACCCCCCGGGCCTCCTGCTGG + Intronic
1007662518 6:43495518-43495540 GAACACCATGGGCCCCCTGGTGG + Intronic
1007707731 6:43801296-43801318 GACCACTAGGGGCTTCCTGGAGG + Intergenic
1018698078 6:166406051-166406073 GGACGCCAAGGGCCTCCTGGGGG - Intergenic
1018937473 6:168283257-168283279 GAGCCCTCTGGGCCTCCTGTAGG + Intergenic
1019634790 7:2069788-2069810 GAACCCGAGAGGCCTCCTGTGGG + Intronic
1026857059 7:73762089-73762111 GCACCCCTGGGGCCTCCTGGGGG - Intergenic
1026889761 7:73975009-73975031 GGACCCCACAGGCCTGCTGGGGG - Intergenic
1032789469 7:135231930-135231952 GAACACTGGGGGCCTCCTGGTGG - Intergenic
1038312275 8:26453760-26453782 GGACCCCACGGCCCTCCTGCAGG - Intronic
1045198819 8:99957800-99957822 GAACCTGATGGGCCTCCTGTAGG - Intergenic
1049039754 8:140103482-140103504 GGACCCTACTGGCCTCCAGTGGG + Intronic
1049582980 8:143421128-143421150 GAGCCCGCCGGGCCTCCAGGAGG - Intronic
1053050815 9:34958936-34958958 GAACCCTACAGGGATCCCGGTGG - Intronic
1061734241 9:132641874-132641896 GAACACTAGGGGCCCCTTGGTGG - Intronic
1186672702 X:11783069-11783091 GCCCCCCAAGGGCCTCCTGGGGG - Intergenic
1186823328 X:13313487-13313509 GAACTTTACGGGACTCCTGCAGG - Intergenic
1186824961 X:13330014-13330036 GAACTTTACGGGACTCCTGCAGG - Intergenic
1190247806 X:48702116-48702138 TAACCCTGCTGGCCTGCTGGAGG + Intronic
1190323384 X:49191561-49191583 GATTCCTACGGGCCTCAGGGCGG - Exonic
1190529552 X:51361399-51361421 TAAGCCTACGGAACTCCTGGGGG + Intergenic
1192584039 X:72306373-72306395 GAACCCTCCGGCCCGCCTGGCGG + Intronic
1193270896 X:79529846-79529868 GAACCCCACCTGCCTCCTAGTGG - Intergenic
1197144142 X:123152726-123152748 GAACCCTTCTGCACTCCTGGTGG + Intergenic