ID: 1103556535

View in Genome Browser
Species Human (GRCh38)
Location 12:121770087-121770109
Sequence AGCCCGCTGGGTGTAGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103556530_1103556535 -7 Left 1103556530 12:121770071-121770093 CCAAAGGCCCTGGGTGAGCCCGC 0: 1
1: 0
2: 2
3: 20
4: 199
Right 1103556535 12:121770087-121770109 AGCCCGCTGGGTGTAGCTGTAGG 0: 1
1: 0
2: 1
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103556535 Original CRISPR AGCCCGCTGGGTGTAGCTGT AGG Intronic
900411378 1:2514237-2514259 AGCTCGCTGGGGGTGGGTGTGGG - Intronic
908070471 1:60454736-60454758 AGCCCTCTGGGTGGACATGTGGG - Intergenic
913593751 1:120353868-120353890 AGCAGGCAGGGTGTACCTGTTGG + Intergenic
914093503 1:144525118-144525140 AGCAGGCAGGGTGTACCTGTTGG - Intergenic
914305024 1:146408784-146408806 AGCAGGCAGGGTGTACCTGTTGG + Intergenic
914597033 1:149164038-149164060 AGCAGGCAGGGTGTACCTGTTGG - Intergenic
915206451 1:154273660-154273682 AGCCTGCAGGGAGTAGCTGGGGG + Intronic
917465000 1:175268273-175268295 AGCCAGCTGTGTGTAGGGGTGGG + Intergenic
918043814 1:180929060-180929082 AGCCCGCATGGTCTGGCTGTAGG - Intronic
920624409 1:207582615-207582637 AAACCTCTGGGTGTAGCTGAGGG + Intronic
1064244370 10:13657384-13657406 AGTCCGCGGGGTGTAGAAGTCGG + Exonic
1075788485 10:125066516-125066538 AGCCTGCTGGGGGTAGCTCACGG + Intronic
1076525915 10:131112349-131112371 AGCCCGCTGGGGGTAGGTTGGGG - Intronic
1077218629 11:1405509-1405531 AGCTCGCTGCCTGTAACTGTGGG - Intronic
1078007894 11:7546395-7546417 AGCAAGCTGGGTGGACCTGTGGG - Intronic
1080324768 11:31057888-31057910 AGCATGATGGGTGTTGCTGTAGG - Intronic
1085546295 11:77321255-77321277 AGCCTTATGGTTGTAGCTGTAGG + Intergenic
1086914297 11:92511039-92511061 AGCCTGCAGTGTGTACCTGTGGG + Intronic
1087582310 11:100073193-100073215 AATCAGCTGGGTGTGGCTGTGGG - Intronic
1088724274 11:112620583-112620605 ACCCCACTGGGTGCAGCTGCAGG + Intergenic
1089494726 11:118902358-118902380 AGCCCGCTGGGAGGGGCCGTGGG + Exonic
1091089231 11:132754087-132754109 AGCCAGCAGGGTGCAGCTGCAGG + Intronic
1091541101 12:1463352-1463374 AGCCAAATGGATGTAGCTGTTGG + Intronic
1091909481 12:4217350-4217372 AACCCACTTGGTGTAGCTCTTGG + Intergenic
1092260990 12:6953266-6953288 AGCCCCCTGAGTGTTGCGGTGGG - Intronic
1092974276 12:13729307-13729329 AAACAGCTGGGTGCAGCTGTGGG - Intronic
1100784670 12:98066276-98066298 AGCCCCAGGGGTGTAGCTGCTGG + Intergenic
1102517955 12:113462991-113463013 AGCCCGCGGGGTGGAGATGGGGG + Exonic
1103556535 12:121770087-121770109 AGCCCGCTGGGTGTAGCTGTAGG + Intronic
1109581027 13:64334431-64334453 AGCACACTGGGTCCAGCTGTAGG + Intergenic
1113149839 13:107251526-107251548 AGCCTGTGGGATGTAGCTGTAGG - Intronic
1118803144 14:69209507-69209529 ACCCTTCTGGGTGTGGCTGTAGG + Exonic
1125126365 15:36226914-36226936 AGCAACATGGGTGTAGCTGTAGG + Intergenic
1129414736 15:75368946-75368968 AGACCTCTGGCTCTAGCTGTCGG + Intergenic
1132868623 16:2105692-2105714 GGCCCGGTGGGTGTGGCTGCTGG + Intronic
1133344087 16:5058672-5058694 AGCCCCCTAGTTGTAGTTGTTGG + Intronic
1134522964 16:14926967-14926989 GGCCCGGTGGGTGTGGCTGCTGG - Intronic
1134549662 16:15133091-15133113 GGCCCGGTGGGTGTGGCTGCTGG + Intronic
1134718802 16:16369906-16369928 GGCCCGGTGGGTGTGGCTGCTGG - Intergenic
1134948970 16:18343027-18343049 GGCCCGGTGGGTGTGGCTGCTGG + Intergenic
1134955954 16:18382253-18382275 GGCCCGGTGGGTGTGGCTGCTGG + Intergenic
1135514636 16:23120566-23120588 AGGCCGCTGGATGTAGCTGTAGG - Intronic
1135949351 16:26898738-26898760 AGCCTGCTGGGTGATGGTGTTGG - Intergenic
1137282864 16:46992824-46992846 AGCTCGCTGGGTGCGGCTGCAGG - Intergenic
1139548349 16:67660222-67660244 CATCCGCTGGGTGTAGCCGTGGG - Exonic
1143901288 17:10176639-10176661 GGACAGCTGGGTGTAGCTGAGGG - Intronic
1144756204 17:17681913-17681935 CGCGCGCTGGGTGGAGATGTGGG + Intronic
1146837086 17:36119827-36119849 AGCAAGTTGGGTGTAGCTGAAGG - Intergenic
1148081510 17:44969606-44969628 AGCCGGCGGGGGGTAGCTCTCGG - Intergenic
1157287996 18:46390328-46390350 TGCCCGCTGGGTGTTGGTGCAGG + Intronic
1161583002 19:5090917-5090939 AGCCCGGTGGGGGCAGCTGGAGG + Intronic
1161684584 19:5696501-5696523 AGCCTGCTGGGCGTGGCTGTGGG + Intronic
1163491871 19:17621570-17621592 AGCCCTGTGGGTATTGCTGTGGG + Intronic
1167294606 19:48642348-48642370 AACCAGCTGGGTGTGGCGGTGGG + Intronic
1168150936 19:54448382-54448404 AGGGGGATGGGTGTAGCTGTTGG - Intergenic
1168249882 19:55135864-55135886 AGCCCTCTGGGGGGCGCTGTGGG - Intronic
925919544 2:8629474-8629496 AGCCTGCTGGGTGAGGCGGTGGG - Intergenic
929374442 2:41268579-41268601 AGCCAGCTTTGTGTTGCTGTTGG + Intergenic
934529720 2:95077266-95077288 AGCCCGCTGGGCAGAGCTGGGGG + Intergenic
935412417 2:102779852-102779874 AGCTAGCTGGGTGTGGCGGTGGG + Intronic
938943882 2:136193075-136193097 TGCCTTCTGGGTGTATCTGTGGG - Intergenic
1168845207 20:939887-939909 AGCACTCTGGGTGTTGCTGCTGG - Intergenic
1170678932 20:18507931-18507953 AGCCTGCTTGTTGCAGCTGTGGG + Exonic
950521786 3:13501794-13501816 AGCCAGCTGGGAGTTGCTGTAGG + Intronic
950850077 3:16053864-16053886 AGCCAGCTGGGAGTAGGTCTGGG + Intergenic
951484974 3:23201626-23201648 AGTCGGCTGTGTGTAGGTGTTGG + Intergenic
953031674 3:39183923-39183945 AGCTGGCTGGGAGTAGCTGCAGG + Exonic
954454966 3:50592809-50592831 AGGCTGCTGGCTGTGGCTGTGGG + Intergenic
955224437 3:57049454-57049476 AGCCTGCTGGGTTTATCTGTGGG + Intronic
969550779 4:7865734-7865756 TGCCAGCTGGGTGTAGCAGAGGG - Intronic
976449547 4:85172116-85172138 AGCTAGCTGGGTGTGGTTGTGGG + Intergenic
985654497 5:1122940-1122962 AGCCCTCTGGGAGGAGCTGGGGG + Intergenic
985835805 5:2271307-2271329 AGCCTGCTAGGTGCAGCTGCAGG + Intergenic
988509949 5:31856312-31856334 AGGCCCCTGGGTGCAGCTGCAGG + Intronic
993857208 5:93091059-93091081 AGGCCGCCGAGTGTAACTGTGGG + Intergenic
1001859603 5:175042245-175042267 AGCCTGCTGGGTGTATGTGCGGG - Intergenic
1002028702 5:176412988-176413010 AGGCAGCTGTGTGTAGATGTGGG - Intronic
1004196848 6:13512985-13513007 AGCACTCTGGGTGTAGCTAAAGG + Intergenic
1005987879 6:30885325-30885347 AGCTCGCTGGCTGTTGCTGAGGG + Intronic
1006151375 6:31991960-31991982 AGCCCTCTGGGTGGGGCTGGGGG + Intronic
1006157676 6:32024698-32024720 AGCCCTCTGGGTGGGGCTGGGGG + Intronic
1008118716 6:47585152-47585174 AACCAGCTGGGTGTAGCGGCGGG + Intronic
1014041834 6:116836502-116836524 AGCCGGGTGGATGTAGCTTTAGG + Intergenic
1019324610 7:432061-432083 AGGCCCCTGGGAGCAGCTGTGGG + Intergenic
1022902364 7:34823834-34823856 AGCCCTCTGGGGGTCACTGTGGG - Intronic
1024561465 7:50648659-50648681 AGCCCAGAGGGAGTAGCTGTAGG - Intronic
1025942294 7:66083181-66083203 TGCCCCCTGGGTGTCCCTGTAGG - Intronic
1026193586 7:68151912-68151934 AGCATCCTGGGTGTAGGTGTAGG - Intergenic
1027255737 7:76429670-76429692 AGCCCCTTGGGTGTGGCTGCAGG + Intronic
1029620116 7:101685015-101685037 AGCCCCCTGGGTGTAGGGGCAGG - Intergenic
1033633793 7:143189236-143189258 ACCCCGCTGGATGCTGCTGTGGG - Intergenic
1034015028 7:147573488-147573510 AGCTCACTTGGTGTAGCTCTAGG + Intronic
1034885370 7:154794581-154794603 AGCCCGCTGGGGGAGGCTGTCGG - Intronic
1035443445 7:158922840-158922862 ACCATGCTGGGTGTAGCTCTGGG + Intronic
1038411146 8:27360812-27360834 CGCCCTCTGGGTCTAGATGTGGG + Intronic
1038424358 8:27454752-27454774 AGCCCTCTGGTGGTAGCTGATGG - Intronic
1053023993 9:34715562-34715584 AGTCCTCTGGGTGAAGATGTTGG + Intergenic
1053121222 9:35548494-35548516 ATCCCTCTGGGTATGGCTGTTGG - Exonic
1057618957 9:96618891-96618913 AGCCCGCGGGGAGGAGCTGCAGG + Intronic
1060247791 9:121960813-121960835 AGCCTTCTGTGTCTAGCTGTGGG - Intronic
1060991515 9:127852365-127852387 AGCCAGCTGGGGGTAGGGGTCGG - Intronic
1061074009 9:128329792-128329814 AGCCTGCTGTGTGAAGCTGAAGG - Intronic
1061838185 9:133342752-133342774 GCCCCGCTGGGTGAAGCTGAGGG + Intronic
1062125281 9:134857136-134857158 ACCCCGCTGGATGTAACTATGGG + Intergenic
1186158596 X:6752083-6752105 AGTCCCCTGGGTGTAGCAGGTGG - Intergenic
1187285654 X:17900741-17900763 AGCCTGCTGAGTGTCTCTGTGGG + Intergenic
1192169129 X:68843538-68843560 GGCCCCCTGGGAGCAGCTGTGGG + Intergenic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic