ID: 1103560085

View in Genome Browser
Species Human (GRCh38)
Location 12:121789036-121789058
Sequence GCCCATCTGCAGAGGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103560085_1103560090 8 Left 1103560085 12:121789036-121789058 CCATCCAGCCTCTGCAGATGGGC 0: 1
1: 0
2: 1
3: 33
4: 324
Right 1103560090 12:121789067-121789089 TAAAACAGCCCAGGTAGACCAGG 0: 1
1: 0
2: 1
3: 10
4: 147
1103560085_1103560089 -1 Left 1103560085 12:121789036-121789058 CCATCCAGCCTCTGCAGATGGGC 0: 1
1: 0
2: 1
3: 33
4: 324
Right 1103560089 12:121789058-121789080 CTTAGAGGTTAAAACAGCCCAGG 0: 1
1: 0
2: 1
3: 10
4: 133
1103560085_1103560091 13 Left 1103560085 12:121789036-121789058 CCATCCAGCCTCTGCAGATGGGC 0: 1
1: 0
2: 1
3: 33
4: 324
Right 1103560091 12:121789072-121789094 CAGCCCAGGTAGACCAGGCGTGG 0: 1
1: 0
2: 1
3: 20
4: 194
1103560085_1103560093 16 Left 1103560085 12:121789036-121789058 CCATCCAGCCTCTGCAGATGGGC 0: 1
1: 0
2: 1
3: 33
4: 324
Right 1103560093 12:121789075-121789097 CCCAGGTAGACCAGGCGTGGTGG 0: 1
1: 0
2: 7
3: 79
4: 691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103560085 Original CRISPR GCCCATCTGCAGAGGCTGGA TGG (reversed) Intronic
900130366 1:1084781-1084803 TCCCCTCTGCTGAGGCGGGAAGG - Intronic
900157514 1:1209142-1209164 AACCAGCTGCAGAGGCAGGAGGG + Intergenic
900731295 1:4262555-4262577 GTATATATGCAGAGGCTGGAGGG + Intergenic
900733712 1:4281093-4281115 GCCCATTGGCATAGGCTGGGTGG + Intergenic
901060494 1:6469671-6469693 ATCCATCTGCAGTGGCAGGAGGG + Exonic
901344318 1:8525753-8525775 GCCTACCTGCAGGGGCTGAATGG + Intronic
901399748 1:9007580-9007602 GCTCATCAGGTGAGGCTGGAGGG - Intronic
901473088 1:9471145-9471167 GCTCAGCTGCCCAGGCTGGAGGG - Intergenic
901637516 1:10677183-10677205 GCCGCTCTGCTCAGGCTGGAAGG + Intronic
902187120 1:14733853-14733875 TCCCATCTGGAGAGGCTGATCGG - Intronic
902242930 1:15100787-15100809 TCCCATCTGCAGAGCGAGGACGG + Intronic
902264798 1:15255647-15255669 GAGGATCTGCAGAGCCTGGATGG + Intronic
902921080 1:19666226-19666248 GCCCAGCAGCAGGGGCAGGAAGG - Exonic
902926310 1:19698101-19698123 GCACATCAGCATTGGCTGGAGGG - Intronic
902926522 1:19699552-19699574 GCACATCAGCATTGGCTGGAGGG - Intronic
905309028 1:37036879-37036901 TCCCAGCTGCAGAGGCTGTGGGG + Intergenic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
905878467 1:41448417-41448439 GGCCATCAGCACAGGCTGTATGG + Intergenic
906305859 1:44718702-44718724 GCCCAGCAGCAGTGGCTGGTTGG + Intronic
908323967 1:63005452-63005474 GCCCACCTGCAGATGCTTGGAGG - Intergenic
910011716 1:82471871-82471893 TCCCCTCCGCAGAGGTTGGAAGG + Intergenic
913116035 1:115697855-115697877 GACCATGAGCAGAGGCTGGTTGG - Exonic
913347785 1:117825537-117825559 GACCATCTGGGGAGACTGGATGG - Intergenic
914753779 1:150552036-150552058 GTCCATCTGTAGAGGCTACATGG - Intronic
915038974 1:152951881-152951903 GCCCATGTCCTGAGGCTGGTGGG - Intergenic
915107331 1:153542617-153542639 GGTCAGGTGCAGAGGCTGGAGGG - Intergenic
915127754 1:153678127-153678149 GCTAATCTGCACAGTCTGGAAGG + Intergenic
915705804 1:157842378-157842400 GCCCATCTTTGGAAGCTGGATGG + Intronic
915733098 1:158067853-158067875 GGCCAGCTGCAGCGGCTGGCTGG - Intronic
916602340 1:166305341-166305363 ACCTTTCAGCAGAGGCTGGAAGG + Intergenic
918126308 1:181587195-181587217 GGTCATCAGCAGAGGGTGGAAGG + Intronic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
919582301 1:199391795-199391817 CCCCATCAGCAAAGGCTAGACGG + Intergenic
920398221 1:205661488-205661510 TCCCGTCTGCTGAGGCTGAATGG + Intronic
920444540 1:206005922-206005944 TCCCATGTGCAAAGGCTGTAAGG - Intergenic
921933016 1:220770710-220770732 GACCAACAGCAGAGGCTGGGAGG - Intronic
922977514 1:229797922-229797944 GCCCATCCACAGAGGCTCCATGG - Intergenic
923163345 1:231337132-231337154 GCCCAACTGCAGCGGGTGCACGG - Exonic
1063115401 10:3068467-3068489 TCCCGTCTGCGGAGGCTGGCGGG - Intronic
1063265850 10:4449882-4449904 TTCCATTTTCAGAGGCTGGATGG + Intergenic
1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG + Exonic
1067069848 10:43123654-43123676 GACCATCTGCAGAGAGTGAAAGG - Exonic
1067945785 10:50687163-50687185 GCCCAGCAGCAGAGGCTGGTGGG + Intergenic
1068425577 10:56859334-56859356 GCTGATGGGCAGAGGCTGGAAGG - Intergenic
1070306213 10:75240665-75240687 CCTCATCTGGAGAGGCTGAATGG + Intergenic
1070664712 10:78334852-78334874 GCCTATCTGCAGAGCCTTGATGG + Intergenic
1070674560 10:78403542-78403564 GGCCATCTGCAGTGTCTGTAAGG - Intergenic
1070674973 10:78406199-78406221 GCCTCTCTGCAGAGCCTAGATGG - Intergenic
1070867301 10:79714036-79714058 GCCCAGCAGCAGAGGCTGGTGGG + Intronic
1070881093 10:79852160-79852182 GCCCAGCAGCAGAGGCTGGTGGG + Intergenic
1071634216 10:87236259-87236281 GCCCAGCAGCAGAGGCTGGTGGG + Intronic
1071647666 10:87368476-87368498 GCCCAGCAGCAGAGGCTGGTGGG + Intronic
1072213504 10:93268555-93268577 GCCCATCAAGAGAGGCTGCATGG + Intergenic
1075529353 10:123214878-123214900 GCCCCTGTCCAGAGGCTGGTGGG + Intergenic
1075732090 10:124642482-124642504 TCCCATCTGCAGAAGCTGCCCGG + Intronic
1076030380 10:127152717-127152739 GGCCATTTGCAAAGTCTGGAAGG - Intronic
1076767110 10:132642192-132642214 GCCCATCTGCAGAGGAGGCCTGG + Intronic
1077914546 11:6602793-6602815 TCACATCTGCAGAGGCTCAAAGG + Intronic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081253166 11:40860505-40860527 GCACATCAGCAGAGACTAGAAGG - Intronic
1081575652 11:44317203-44317225 ACCGATCTGCAAAGGGTGGACGG - Intergenic
1081711291 11:45217678-45217700 GCTCATCTGGAGAGCCTGGGAGG - Intronic
1081910386 11:46696392-46696414 CCCCAGCTGCAGGGCCTGGAGGG - Intronic
1083201383 11:61123062-61123084 TCCCACGTGCAGAGACTGGAGGG + Intronic
1083273615 11:61584869-61584891 CCCCTTCTGTAGGGGCTGGAAGG - Intergenic
1083750332 11:64757570-64757592 GCCTAAGTGCAGAGTCTGGAAGG - Intronic
1084246144 11:67858565-67858587 GCCCTTTTGCCCAGGCTGGAGGG + Intergenic
1084392150 11:68884460-68884482 GCAAATCTTCAGAGGGTGGAAGG - Intergenic
1084445267 11:69200105-69200127 GGCAATCTGGAGAGGCAGGAAGG + Intergenic
1084673782 11:70622618-70622640 GGCCACGTGCAGAGGCTGGCAGG - Intronic
1085637548 11:78170151-78170173 GCCCTTCTTAAGAGGGTGGAGGG + Intergenic
1086324314 11:85682745-85682767 TCCCATGGGCAGAGGCCGGACGG - Intronic
1088596009 11:111440768-111440790 GCCATTCTGCAAGGGCTGGATGG - Intronic
1088624930 11:111723200-111723222 TCCCTTCTGGAGAGGCTAGAAGG - Intronic
1089336268 11:117725921-117725943 GCCCAGCTGGAGAGGCTGCAGGG - Intronic
1089708452 11:120298078-120298100 GCCCAGCTGCCCTGGCTGGAAGG + Intronic
1091846922 12:3663614-3663636 GCCCATCTGAAGAAGCATGAAGG - Intronic
1091873164 12:3912034-3912056 CCCCATGTGCAGAAGCTTGAGGG + Intergenic
1092083088 12:5734456-5734478 GCCCCTGTGCAGGGTCTGGAAGG - Intronic
1092145313 12:6210585-6210607 GCCCATCTGCACCGGAAGGAAGG - Intronic
1092163306 12:6327885-6327907 GCCCAGCTGCAGAGGATGCGGGG + Exonic
1092979755 12:13782880-13782902 CCCCATCTGCATAGGCTAGTGGG - Intronic
1095322401 12:40845646-40845668 TCTCATCTCCAGAGGCTGGCGGG - Intronic
1095584486 12:43835758-43835780 GCCGCTCTGCAGAGGCGGGCCGG + Intergenic
1096060381 12:48693468-48693490 GACCCTCTGAAGAGACTGGAGGG - Exonic
1099431500 12:82591573-82591595 GCTCAGTTGCACAGGCTGGAGGG - Intergenic
1100478916 12:94959405-94959427 CCCCACCTGGGGAGGCTGGAGGG - Intronic
1100713656 12:97283588-97283610 GCCCATCAGCAGTGGCATGAGGG + Intergenic
1103192426 12:119013038-119013060 GCATATCTGGAGATGCTGGAGGG - Intronic
1103197317 12:119056018-119056040 GCAAATCTGGAGAGACTGGAGGG - Intronic
1103560085 12:121789036-121789058 GCCCATCTGCAGAGGCTGGATGG - Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104668507 12:130664900-130664922 GCCCATTCACAGAGGCCGGAGGG + Intronic
1104934027 12:132355082-132355104 GCCCACCTGCATGGGGTGGAAGG + Intergenic
1106080410 13:26495951-26495973 TCCCACCTGCAGATGCTGGCAGG + Intergenic
1106143767 13:27034142-27034164 CCCCATCAGCAGGGGCTGAATGG + Intergenic
1106457227 13:29937992-29938014 GCCCAGATGCAGAGGCAGGTGGG + Intergenic
1106462224 13:29981169-29981191 CTGCAGCTGCAGAGGCTGGATGG - Intergenic
1108258975 13:48638132-48638154 GCCCTTCTGAAGGGGCTTGAGGG + Intergenic
1113113397 13:106848645-106848667 GCCTTTCTGCAGAGGGTGGGGGG - Intergenic
1113347949 13:109499066-109499088 GCCCTCCTGCACAGGATGGATGG - Intergenic
1113481543 13:110625513-110625535 GCCCAGCTCCAGAGGCAGGGAGG + Intronic
1114459043 14:22875338-22875360 GCCAATCTGCAGAGGCACCATGG - Exonic
1115103055 14:29726312-29726334 GTCCATCTGCACAGCATGGAGGG + Intronic
1116739669 14:48738446-48738468 GCCTGACTACAGAGGCTGGATGG - Intergenic
1116835982 14:49769115-49769137 GGCCATTTGCACAGGCGGGAAGG - Intronic
1119065124 14:71517985-71518007 GGCGAGCTGCAGTGGCTGGACGG + Intronic
1119636243 14:76275753-76275775 GCCCTTCCTCAGTGGCTGGAAGG + Intergenic
1120439242 14:84514304-84514326 GAACTTCTGCAGAGGCTGGGAGG - Intergenic
1120487470 14:85131740-85131762 GCCCATCTGGAGATTCTGTATGG - Intergenic
1120818834 14:88893029-88893051 TCCCATCAGCTGTGGCTGGAGGG - Intergenic
1121466753 14:94120626-94120648 GACCATCTTAAGAGACTGGAAGG - Intergenic
1121526361 14:94621981-94622003 GGCCAGCTGCAGTGGCTGCATGG - Intronic
1121828993 14:97033679-97033701 GCCAAATTCCAGAGGCTGGAAGG + Intergenic
1122774688 14:104111950-104111972 GCCTTTCTACAGAGCCTGGAGGG + Exonic
1125425029 15:39540008-39540030 GCCTGGCTACAGAGGCTGGAAGG + Intergenic
1125434198 15:39627980-39628002 GACAGTCTGCAGAGGCTGGTTGG - Intronic
1125670132 15:41465605-41465627 GCTCTTCTGCCCAGGCTGGAGGG - Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128501653 15:68230947-68230969 TCCCTTCTGCAGCGGCTTGAGGG - Intronic
1129461113 15:75700482-75700504 GCCCTTCTGCAGGGGCTGGCGGG + Intronic
1129873736 15:78958597-78958619 GCCTCCCTGCTGAGGCTGGAAGG + Intergenic
1130922064 15:88355856-88355878 GACCATCTGCAGAGGGTTTAGGG + Intergenic
1131440374 15:92455061-92455083 GCCCTGCTGCAGAGACTTGAGGG + Intronic
1131524178 15:93139555-93139577 GCACATTTGCAGAGGATGGCGGG + Intergenic
1132543992 16:524738-524760 GCCCTTCAGCAGAGGCAGGATGG - Intergenic
1132544021 16:524833-524855 GCCCTTCAGCAGAGGCAGGCTGG - Intergenic
1133222539 16:4324974-4324996 GCCCAGCAGCAGGGGCTGGCGGG - Intronic
1133398134 16:5464684-5464706 GCCCAGCTGTGGAGGGTGGATGG + Intergenic
1134909279 16:18009464-18009486 GCCCATGGACAGAGGCTAGAAGG - Intergenic
1137440769 16:48497103-48497125 GCCCAGCTCCAGCGACTGGAAGG + Intergenic
1137594291 16:49713607-49713629 GCCCATTTGCAGAAGCGGGCAGG - Intronic
1137597595 16:49735160-49735182 GCCCATCTCCACAGCCTTGAAGG + Intronic
1139374712 16:66489734-66489756 GCACAGAGGCAGAGGCTGGAGGG + Intronic
1139505702 16:67397122-67397144 GTCCATCTGCAGTGACTTGAGGG - Intronic
1140406199 16:74713343-74713365 CCTCATCTGCGGAGGCTGGGAGG + Exonic
1141160663 16:81627505-81627527 GACCACCTGTGGAGGCTGGAAGG - Intronic
1141702076 16:85647137-85647159 GCCCATCTGCAGGTGCGGCAGGG - Intronic
1142509343 17:384787-384809 GCCAGGCTGCAGAGGATGGAGGG + Intronic
1142933477 17:3308322-3308344 TCCCCTCTGCAGAGGCTGCTGGG + Intergenic
1144787247 17:17838713-17838735 GTCCCTCTGCAGAGGCAGGGAGG + Intergenic
1144848713 17:18233374-18233396 CCCCATCTGCAGAAGCTGGGAGG - Intronic
1145062203 17:19740290-19740312 GCCCACCTGCCCAGGCTGCAGGG - Intronic
1145811998 17:27769844-27769866 GCCCCTCTGCCAGGGCTGGATGG - Intronic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1146675859 17:34773431-34773453 GCCCAACTGCAGCAGCAGGAGGG + Intergenic
1148227326 17:45908059-45908081 ACCCATTCACAGAGGCTGGAGGG - Intronic
1148582119 17:48751477-48751499 GCCCATCTGTTCAGGGTGGAGGG - Intergenic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1150993937 17:70294317-70294339 GCCTGTCTGGAGAGGATGGAGGG + Intergenic
1152445901 17:80343333-80343355 GGCCATCGGCTGACGCTGGAGGG - Intronic
1153070892 18:1103089-1103111 TTCCAGCTGCAGAGGCTGGAGGG + Intergenic
1153611742 18:6892816-6892838 GCTCATCTGCAAAGACTGGGAGG - Intronic
1153895047 18:9551313-9551335 GCCCCTCAGCAGAGCCCGGATGG + Intronic
1155152928 18:23136336-23136358 GCCCAACTGCAGCTGCTCGACGG + Exonic
1155190010 18:23421498-23421520 GCAGATCTGCTGGGGCTGGATGG - Intronic
1155545670 18:26912052-26912074 GACCATCTGCAGTGGCTGTCAGG + Exonic
1156553887 18:38046037-38046059 GTCCATGTGCATAGGCTAGAAGG + Intergenic
1160688209 19:447257-447279 GCCGATCCACAGAGGCAGGAAGG + Intronic
1160730064 19:637832-637854 GCCCATCCACAGAGGCAGGAAGG + Intergenic
1160794227 19:936929-936951 GCCAATCCACAGAGGCAGGAGGG - Intronic
1160816324 19:1037608-1037630 GCCCACCTGGAGAGGAAGGAGGG - Exonic
1160961471 19:1723581-1723603 GCCCATCCACAGAGACAGGAGGG + Intergenic
1161143430 19:2662797-2662819 TCCCCTCCCCAGAGGCTGGAGGG + Intronic
1161160477 19:2758931-2758953 GCCCATCCACAGAGACAGGAAGG + Intronic
1161167001 19:2793353-2793375 GCCCATCCACAGAGACAGGAGGG - Intronic
1161306334 19:3570934-3570956 GCCCATCCACAGAGACAGGAGGG - Intronic
1161361700 19:3853627-3853649 GCCAATCCACAGAGGCAGGAAGG + Intronic
1161476693 19:4489941-4489963 GCCCCTCCACAGAGGCAGGAAGG - Intronic
1161509833 19:4664125-4664147 GCCCATCCACAGAGACAGGAGGG + Intronic
1161580419 19:5077740-5077762 GCCCCTCCGCAGGGGCTGCAGGG + Intronic
1161730158 19:5955026-5955048 GCCCAACTCCCAAGGCTGGAGGG + Intronic
1161736799 19:5996501-5996523 GCCGATCCACAGAGGCAGGAGGG + Intronic
1162360516 19:10217294-10217316 CCCCATCTGTAGGGGCTGGGAGG + Intronic
1165112473 19:33510415-33510437 GTATATATGCAGAGGCTGGAAGG + Intronic
1166314267 19:41980028-41980050 GCCCCTCTGCACTGGCTGGCTGG + Intronic
1167118007 19:47499294-47499316 CCCCATCTGGAGTGACTGGAAGG - Intronic
1167219251 19:48186844-48186866 GCCCATCTGAAGATGAGGGAGGG - Intronic
1167577771 19:50325944-50325966 GCGCAGCTGCAGAGGCTGGACGG + Intronic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG + Intergenic
928108940 2:28490869-28490891 TCCCATCTGGAGAGGCTGCCAGG + Intronic
928121633 2:28587941-28587963 GCCTGTCTGCAGAGGCTGGGAGG - Intronic
928404280 2:31002728-31002750 TCCCACCTGCAGAGAATGGATGG + Intronic
928408235 2:31031828-31031850 GCCCCTCTGTGGAGGGTGGAGGG - Intronic
929023352 2:37575803-37575825 GCCCAGGTGCTGTGGCTGGAGGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930221035 2:48747121-48747143 GCTCTGTTGCAGAGGCTGGAGGG + Intronic
930786366 2:55274888-55274910 GCCCTACTGCCCAGGCTGGAGGG - Intergenic
932717113 2:74109147-74109169 ATCCATCTGCAGAGCCTGAAGGG + Intergenic
933781994 2:85809061-85809083 GGCTATCTCCAGTGGCTGGAGGG - Intergenic
933846980 2:86334721-86334743 GCCCATCTGCTCAGGCTGGGTGG + Intronic
935347314 2:102120759-102120781 ACCCACCTGCAGAGCGTGGAGGG - Intronic
935658416 2:105444322-105444344 GCCTGTCTGCAGAATCTGGAAGG + Intergenic
938244941 2:129769093-129769115 GCTCACCTGCAGAGGCTGACGGG - Intergenic
938418921 2:131127880-131127902 GGGCCTCAGCAGAGGCTGGACGG + Intronic
939415848 2:141895853-141895875 GCCCAAATGAAGAGGTTGGAGGG - Intronic
943564067 2:189496769-189496791 GCCCCTCTCCAGAAGGTGGAAGG - Intergenic
943807617 2:192141681-192141703 CCCCATCTTTAGAGGCAGGAAGG + Intronic
946033726 2:216725277-216725299 TCCAACCTGCAGAGGGTGGAGGG + Intergenic
946310449 2:218880182-218880204 ACACACCTGCAGGGGCTGGAGGG - Intergenic
947466104 2:230347839-230347861 GCCCAACTGCAGAGGCAAGCTGG - Intronic
948179665 2:235969808-235969830 ACCCTTCTGCGGAGGCTGGCGGG - Intronic
948426023 2:237886980-237887002 TCCCGTCTGCACAGCCTGGATGG - Intronic
948602764 2:239116686-239116708 GCTCTTCAGCAGAGGCAGGATGG - Intronic
949049985 2:241892442-241892464 GCCCAGCTCCCAAGGCTGGAAGG - Intergenic
1168789952 20:569220-569242 GCCCATCTGCATGGGCTCAAGGG - Intergenic
1171079004 20:22158629-22158651 GACCATGTCCAGAGGCTGGCAGG + Intergenic
1171399025 20:24859681-24859703 GGGCATCTGCAGAGGCTCCAAGG + Intergenic
1171991629 20:31700971-31700993 GCCCAGCTGATGAGGCAGGAAGG + Intronic
1172181721 20:33007837-33007859 ACCCTTCTGCAGAGGGTGGCTGG - Intronic
1172406023 20:34689897-34689919 CCCCTTCTGCAGAATCTGGATGG - Intergenic
1172626555 20:36350768-36350790 TCCCTTTTGCAGATGCTGGAGGG + Intronic
1172878658 20:38182470-38182492 CCTCAACTGCAGGGGCTGGAAGG + Intergenic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1175261417 20:57676629-57676651 GTCCAGCTGCAGAGGCTCAAGGG + Intronic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1175801637 20:61804405-61804427 GGCCAGATGCAGAGGCTGGACGG - Intronic
1176411188 21:6450407-6450429 GCCCAGCTGCAGGGTCTGCATGG + Intergenic
1176431564 21:6579335-6579357 GTCCATCTGCTGAGTGTGGAAGG - Intergenic
1177264397 21:18764710-18764732 GTCCATGGGCACAGGCTGGAGGG - Intergenic
1178187514 21:30240747-30240769 GCTCATTTGCTCAGGCTGGAGGG + Intergenic
1178503583 21:33145428-33145450 CCCCATCTGGAAGGGCTGGAGGG + Intergenic
1178672753 21:34606275-34606297 GCCAAGCGGCAGAGGCTGGAAGG - Intronic
1178800617 21:35791771-35791793 GCCCACCTGCAGGTGCTGGGAGG + Intronic
1179686681 21:43058729-43058751 GCCCAGCTGCAGGGTCTGCATGG + Intronic
1179706958 21:43186797-43186819 GTCCATCTGCTGAGTGTGGAAGG - Intergenic
1179725799 21:43340643-43340665 GCCCCTCTCCCCAGGCTGGAGGG - Intergenic
1179994823 21:44969158-44969180 GCCCAGCTGCCCAGGCTCGAGGG + Intronic
1181036155 22:20170648-20170670 GCTTCTCTGCTGAGGCTGGATGG - Intergenic
1181084267 22:20432073-20432095 GCGCAACTGCAGAGGCAGGGAGG - Intronic
1181570626 22:23766237-23766259 CCCCATCTGCAGGGGCTGGGGGG + Exonic
1182624860 22:31638303-31638325 TCCCTTCTGGAGAGTCTGGACGG + Intronic
1183536611 22:38405286-38405308 GGCCATTTGCAGAGGCAGGCTGG - Intergenic
1184286299 22:43473631-43473653 GCCCAGCAGCTGAGGCTGGTGGG + Intronic
1184652860 22:45927073-45927095 GTCCATCTGCAGAGGCCTGGGGG - Intronic
1185231343 22:49685959-49685981 GGCCACCTGCAGAGCCTGGGAGG - Intergenic
949977568 3:9475060-9475082 CTCCATCTGCAGGGTCTGGAAGG - Exonic
950361449 3:12452346-12452368 GCCCATATTCAGACCCTGGAAGG + Intergenic
953099418 3:39810077-39810099 GCCCCTCCGCAGAGGCTGACTGG - Intronic
953886747 3:46718271-46718293 GCCCCACTGGAGGGGCTGGAGGG - Exonic
955751275 3:62187250-62187272 GCCCCTCTGCACAGGCTGACAGG - Intronic
956081688 3:65564056-65564078 GCATATCTCCAGAGGCTGAAAGG + Intronic
958153680 3:89725436-89725458 CCCCATCAGCAGAGGCTGAGTGG + Intergenic
960157793 3:114315218-114315240 GCCCACCTGCAAAGATTGGAGGG + Intergenic
960926637 3:122801005-122801027 GCCCAGCAGAACAGGCTGGAGGG - Intronic
961038972 3:123663689-123663711 GGCCATCCCCAGAGCCTGGAGGG + Intronic
961450976 3:127002173-127002195 GCCCAGCTGCACTGGCTGCAGGG - Intronic
962985244 3:140530614-140530636 CCACATCTGCTGAAGCTGGATGG - Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968130413 3:196189816-196189838 GACCTGCTGCCGAGGCTGGACGG + Intergenic
968292659 3:197550690-197550712 GCCGATCTGCAGGGGGTGGGGGG + Intronic
968615560 4:1576018-1576040 GCCCAGCTGCAGATGCTGCTGGG - Intergenic
969122249 4:4919197-4919219 GGGCATATGCAGAGGCTGGTGGG - Intergenic
972771644 4:42202964-42202986 GGAAATCTGCAGAGGATGGATGG + Intergenic
974596135 4:64016302-64016324 TCACATCTGCAGGGGCTTGAGGG + Intergenic
976239228 4:82935809-82935831 GCCCTGCTACAGAGGCTCGAAGG + Intronic
981069913 4:140524096-140524118 GCCAATCGGAAGAGGCCGGAGGG + Intergenic
981159109 4:141475901-141475923 GCCCACCTGCAGGGGCAGAAGGG - Intergenic
982031423 4:151304917-151304939 GCCCATCTGCATAAGCTGGGAGG + Intronic
983417956 4:167482272-167482294 GCCCAACTTCAGGGGCTTGAGGG + Intergenic
985427312 4:189843497-189843519 GCCCAGCCGCAGCTGCTGGAAGG + Intergenic
985528571 5:420633-420655 CCCCATGTGGAGAGGATGGAAGG + Intronic
985823597 5:2177557-2177579 GCCCATCTGCAGTTCCTGAAGGG + Intergenic
985964469 5:3329531-3329553 GCCACTCTGCAGAGGCTGGCAGG + Intergenic
985999610 5:3620227-3620249 GCGGATCACCAGAGGCTGGAGGG - Intergenic
986009405 5:3698656-3698678 GCTCAGCTGGAGAGGCTGGCTGG - Intergenic
986404219 5:7409221-7409243 GCCTATCTGAGGAGGGTGGAGGG + Intronic
986772839 5:10989158-10989180 GCCCCTCTGCACTGGCAGGAAGG - Intronic
987379989 5:17275819-17275841 GCTCTTCTGCAGAGGCTGCGGGG - Exonic
988491964 5:31712525-31712547 GACCACCTGGAGAGACTGGATGG - Intronic
990811619 5:59731376-59731398 GCCCATATGCTGAGGATGGCTGG + Intronic
991621457 5:68549704-68549726 CCCCCACAGCAGAGGCTGGATGG + Intergenic
995261798 5:110112927-110112949 GTCCATCTTAACAGGCTGGAGGG - Intergenic
997360547 5:133292043-133292065 GCCCATCTCCATGGGCTGGGTGG - Intronic
997885634 5:137627581-137627603 GCCCAACTTCCCAGGCTGGAAGG - Intronic
1000269420 5:159669402-159669424 GCCCACCTTCAAATGCTGGAAGG + Intergenic
1001086272 5:168701995-168702017 GCCCATCTTCAGCAGCTGGAAGG + Intronic
1001897961 5:175397504-175397526 GCCCATGTGCTGAGGATGGTCGG - Intergenic
1002181704 5:177434143-177434165 GCCCAGCTGCAGTCGCTGGCAGG - Intronic
1002199628 5:177520443-177520465 GTCCATCAGCAGGGGCTGGGAGG + Intronic
1002376585 5:178793432-178793454 GCCCACCTGCAAAGACAGGAGGG + Intergenic
1003924507 6:10864275-10864297 GCCCAGCTGCAGAGGCAGAGGGG - Intronic
1005942444 6:30570978-30571000 GCCCATCAGGTGAGGCTGGTAGG - Intergenic
1005942548 6:30571552-30571574 GCCCATCAGGTGAGGCTGGTAGG + Exonic
1007179232 6:39916211-39916233 GCCCAGCTCCAGCGGCTGGAAGG - Exonic
1010190520 6:73191162-73191184 GCCCGTCTTCACAGGTTGGATGG - Intronic
1011140942 6:84155754-84155776 TCCCATGTGCATAGACTGGAAGG + Intronic
1012386529 6:98689568-98689590 GCCCATATCCAGATGCTGCATGG + Intergenic
1012794958 6:103748403-103748425 GTCCACCAGCACAGGCTGGAGGG - Intergenic
1017962332 6:159233212-159233234 GCCCATCTCCCGGGGCTGGGAGG + Exonic
1018683199 6:166281859-166281881 CCCCAGGTGCAGAGGCAGGAGGG - Intergenic
1019521816 7:1464122-1464144 GCCCCCCTGCAGAGCGTGGAAGG + Intergenic
1020042182 7:5012602-5012624 TCCCACCTGCAGTGGCTGGGTGG + Intronic
1020836348 7:13156721-13156743 ACCCAACTGGAGAGACTGGAGGG - Intergenic
1023255889 7:38311663-38311685 CCCCATCTGCAGGGGCTGGGGGG - Intergenic
1024850780 7:53714235-53714257 GCCCATATGCAAGGACTGGAAGG - Intergenic
1024986997 7:55202714-55202736 CCCCCTCTGGAGATGCTGGAGGG - Intronic
1029151870 7:98485933-98485955 GCCCTTCTGCAGAGCCTGTGTGG + Intergenic
1029218483 7:98969643-98969665 GCCCAACTGCAGAGGCAGGCAGG + Intronic
1029235422 7:99112306-99112328 GCCCATCTGCAAAGACTGGGGGG + Intronic
1029359179 7:100075819-100075841 GGCCATCTGCTCAGGCAGGATGG - Intronic
1029627893 7:101731776-101731798 GCCCCTGTGAAGAGGCTGAAGGG - Intergenic
1033975427 7:147094716-147094738 GGCCATGGGCAGAGGCTGGAAGG - Intronic
1034196228 7:149250312-149250334 GCCCGGCTACAGAGCCTGGAGGG + Exonic
1036286548 8:7448333-7448355 TCCCATCTGCAGGCGCCGGAAGG + Intronic
1036334929 8:7863191-7863213 TCCCATCTGCAGGCGCCGGAAGG - Intronic
1036719128 8:11156408-11156430 GCCCAGCTGAAGAGGCAGGCAGG - Intronic
1036780430 8:11643047-11643069 GCCCATGAGCACAGGCTCGAGGG - Intergenic
1037358959 8:18053445-18053467 GCCCTGCTGCAGAGGTGGGAGGG - Intergenic
1037971884 8:23177812-23177834 GCCCATGGGCAGGGGCTGCAGGG - Intergenic
1038400032 8:27277655-27277677 GGCCATCTGCAGTACCTGGAAGG - Intergenic
1039472232 8:37820730-37820752 GCCCATTTGCAAAGGCTCAAGGG - Intronic
1040504477 8:48034934-48034956 GGCCACCTGGAGAGGCTGCAGGG - Intronic
1040537332 8:48321902-48321924 GCCCAGTTGTCGAGGCTGGAGGG + Intergenic
1041430446 8:57776037-57776059 GCCCATGGGCAGGAGCTGGAAGG - Intergenic
1042190879 8:66185983-66186005 GTCCATCTGCAGAGCCTAGGAGG - Intergenic
1043517088 8:81004904-81004926 GCCCATCCTCAGAGGCCGGCTGG - Intronic
1046870986 8:119205792-119205814 TCCCATAAGCACAGGCTGGAAGG + Intronic
1046880466 8:119301071-119301093 GCCTGTCTGCAGAGGTTGGCCGG - Intergenic
1049164841 8:141119311-141119333 GCCCATGTGCGGGGGCTGGGCGG + Intronic
1049260269 8:141635298-141635320 GCCCATCTGCTGGTGCTGGCAGG + Intergenic
1049783718 8:144440578-144440600 TCCCAGCTGCCGAGGGTGGATGG + Intronic
1051659775 9:19415086-19415108 GCCCATCTACCAAGGCTGGCTGG - Intronic
1053044648 9:34905220-34905242 GACCAGCTGCAGAGGCAGGGAGG + Intergenic
1054160706 9:61670557-61670579 CCACATCTGGAGAGGCTGGCAGG + Intergenic
1056941870 9:90962826-90962848 GCCCAGCTGCTGATGCTGGAAGG + Intergenic
1057520203 9:95753910-95753932 GCCCATCTGCAAAGGCCAGAAGG + Intergenic
1059419883 9:114184242-114184264 ACCCAGCTGCAGAGGTTGAATGG + Intronic
1060794637 9:126505394-126505416 GCCCTCCTGCAGTTGCTGGATGG + Exonic
1061324481 9:129855095-129855117 GCCCTGCTACAGAGACTGGAGGG + Intronic
1061559771 9:131394599-131394621 GCCGGGCTGCAGAGGCCGGAGGG + Intronic
1061869551 9:133513454-133513476 GCCCGTGAGCAGAGGCTGCAGGG - Intergenic
1062192031 9:135253076-135253098 GCACAAAGGCAGAGGCTGGAGGG + Intergenic
1062383389 9:136298440-136298462 GCCCGGCTCCAGAGGCTGGCTGG + Intronic
1062391761 9:136336698-136336720 GCCAATCCGCAGAGGAGGGAGGG + Intronic
1062500925 9:136851652-136851674 GCCCGTCTGGAGAGGCTGGCCGG - Intronic
1062598015 9:137307772-137307794 GCCCGTCTGCGAAGGCTGGGGGG - Intronic
1186353184 X:8761009-8761031 GCCAATCTGAAAAGGCTGCATGG - Intergenic
1187449574 X:19384707-19384729 TCCCATCTGCCCAGGCTGGAGGG - Intronic
1189051221 X:37647625-37647647 GCCCATCTGCATAGAATGCAGGG - Intronic
1189073520 X:37890027-37890049 GCCCTTATACAAAGGCTGGAAGG + Intronic
1189085429 X:38018144-38018166 GCCCTTATACAAAGGCTGGAAGG - Intronic
1189491001 X:41471788-41471810 GCCCTTATACAAAGGCTGGAAGG - Intronic
1189614771 X:42771658-42771680 GCCCTTATTCAAAGGCTGGAAGG - Intergenic
1189616143 X:42786349-42786371 GCCCTTATACAAAGGCTGGAAGG - Intergenic
1189987697 X:46568882-46568904 GCCCTTATACAAAGGCTGGAAGG - Intergenic
1193975090 X:88108582-88108604 CCCCATCTGCAGAGTCTAAATGG - Intergenic
1196698489 X:118640181-118640203 GCCCAACTGCGGAAGCTAGAGGG + Intronic
1196761444 X:119204209-119204231 CCCCAGCTGCTGAGGCTGGGAGG + Intergenic
1197560511 X:128014873-128014895 GCCCCTATGCAGAGGCTCCACGG - Intergenic
1200952342 Y:8911038-8911060 GCCCTACTGCCCAGGCTGGAGGG - Intergenic
1202174264 Y:22083379-22083401 GACCAACTGCACAGTCTGGAAGG + Intronic
1202217096 Y:22503003-22503025 GACCAACTGCACAGTCTGGAAGG - Intronic
1202326089 Y:23693067-23693089 GACCAACTGCACAGTCTGGAAGG + Intergenic
1202342604 Y:23885866-23885888 GACCAACTGCCGAGCCTGGAAGG + Intergenic
1202528165 Y:25784219-25784241 GACCAACTGCCGAGCCTGGAAGG - Intergenic
1202544682 Y:25976987-25977009 GACCAACTGCACAGTCTGGAAGG - Intergenic