ID: 1103563336

View in Genome Browser
Species Human (GRCh38)
Location 12:121803848-121803870
Sequence AGTGAGGGGTGGGGGGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 718
Summary {0: 1, 1: 1, 2: 4, 3: 84, 4: 628}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103563323_1103563336 11 Left 1103563323 12:121803814-121803836 CCCCGGGGAGGGGGAGGCAGTGT 0: 1
1: 0
2: 2
3: 41
4: 408
Right 1103563336 12:121803848-121803870 AGTGAGGGGTGGGGGGCCGCTGG 0: 1
1: 1
2: 4
3: 84
4: 628
1103563322_1103563336 12 Left 1103563322 12:121803813-121803835 CCCCCGGGGAGGGGGAGGCAGTG 0: 1
1: 0
2: 6
3: 64
4: 458
Right 1103563336 12:121803848-121803870 AGTGAGGGGTGGGGGGCCGCTGG 0: 1
1: 1
2: 4
3: 84
4: 628
1103563321_1103563336 16 Left 1103563321 12:121803809-121803831 CCTTCCCCCGGGGAGGGGGAGGC 0: 1
1: 0
2: 2
3: 49
4: 444
Right 1103563336 12:121803848-121803870 AGTGAGGGGTGGGGGGCCGCTGG 0: 1
1: 1
2: 4
3: 84
4: 628
1103563325_1103563336 9 Left 1103563325 12:121803816-121803838 CCGGGGAGGGGGAGGCAGTGTGG 0: 1
1: 0
2: 7
3: 110
4: 1019
Right 1103563336 12:121803848-121803870 AGTGAGGGGTGGGGGGCCGCTGG 0: 1
1: 1
2: 4
3: 84
4: 628
1103563324_1103563336 10 Left 1103563324 12:121803815-121803837 CCCGGGGAGGGGGAGGCAGTGTG 0: 1
1: 1
2: 5
3: 77
4: 788
Right 1103563336 12:121803848-121803870 AGTGAGGGGTGGGGGGCCGCTGG 0: 1
1: 1
2: 4
3: 84
4: 628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103563336 Original CRISPR AGTGAGGGGTGGGGGGCCGC TGG Intergenic
900118740 1:1039789-1039811 AGAGTGAGGTGGGGGGCCGGGGG + Intronic
900160373 1:1220427-1220449 AGGGAGGGGTGGGAGGTCGCAGG + Intronic
900308185 1:2021072-2021094 AGCCAGGAGTGGGGGGCCTCTGG + Intronic
900365368 1:2309855-2309877 AGGGAGGGGTGGGGGGGCCGGGG - Exonic
900427664 1:2587819-2587841 AGCGTGGGGTGGGGGGCCCAGGG + Intronic
900489286 1:2938824-2938846 TGTGTGGGGTGGGGGGCTGCTGG + Intergenic
900497094 1:2980698-2980720 AGGGAGGGAAGGGGGGCAGCTGG + Intergenic
901386181 1:8910780-8910802 GGAGGGGGGTGGGGTGCCGCGGG + Intergenic
901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG + Intronic
901866808 1:12111809-12111831 GGTGAGGGATGGGGGGCTTCAGG + Intronic
902350348 1:15848911-15848933 ATTCAGGGGTGGGGGGCACCAGG - Intronic
902676020 1:18009142-18009164 AGTGTGGGGTGGGGATCCTCAGG - Intergenic
902679613 1:18033752-18033774 AGTGAGGGGTGTGGGGTCAGGGG + Intergenic
902728510 1:18352951-18352973 GGCGAGGGGTGGGGGGCCCGGGG - Intronic
902776177 1:18676398-18676420 AGGGTGGGGAGGGGGGCAGCGGG + Intronic
903038308 1:20509123-20509145 ATTGCGGGGTGGGAGGCTGCAGG - Intergenic
903517941 1:23925024-23925046 AGTAAGGGGAGGGGGGCTTCTGG - Intergenic
903594761 1:24485626-24485648 TGTCAGGGGTGGGGGGCTGGGGG - Intergenic
903663795 1:24994874-24994896 GGTCAGGGGTGGGGGGCGGAGGG - Intergenic
903811573 1:26037682-26037704 GGAGAGGGGTGGGGGGTTGCTGG - Intronic
904030784 1:27532298-27532320 AGTGAAGGGTTGTGGGCCCCAGG - Intergenic
904266258 1:29319987-29320009 AGTGAAGGGTCTGGGGCCCCAGG - Intronic
904438139 1:30512632-30512654 AGTGAGGGGCAGGGCCCCGCAGG - Intergenic
905495011 1:38378070-38378092 AGAAAGGGGTGAGGGGCCACTGG - Intergenic
906083121 1:43107481-43107503 GGTGAGGGGCGGGGGGCAGGGGG + Intergenic
907185161 1:52603347-52603369 AGAAGGGGGTGGGGGGGCGCGGG + Intronic
907192833 1:52663115-52663137 AGGGAGGGGTGTGGAACCGCAGG - Intronic
907280173 1:53342142-53342164 GGTGAGGGGTGGGGAGAGGCTGG - Intergenic
907460229 1:54601440-54601462 AGGGAGGGGAGGGGAGCTGCTGG - Intronic
907460722 1:54603974-54603996 AGGGAAGGGTGGGGGCCCGGTGG - Intronic
907858051 1:58323086-58323108 ATTGTGGGGTGGGGGGCAGGGGG + Intronic
910194254 1:84624187-84624209 GGTGGGGGGTGGGGGGGCGGTGG + Intergenic
910788107 1:91022077-91022099 GGGGAGCGGAGGGGGGCCGCTGG - Exonic
911217424 1:95210831-95210853 TGTCAGGGGTGGGGGGCTGGGGG - Intronic
911725546 1:101237997-101238019 GGGGTGGGGTGGGGGGGCGCGGG + Intronic
911729802 1:101281238-101281260 ACTGAGGGATGGGGGACCCCTGG + Intergenic
912203088 1:107480571-107480593 AGGTAGGGGTGGGTGGGCGCGGG - Intronic
912330734 1:108818032-108818054 AGTGAGGGGTGCAGGGCCACTGG + Intronic
912411528 1:109483790-109483812 GGTGGGGGGGGGGGGGGCGCGGG + Intronic
912420580 1:109539849-109539871 AGTGAGCGGTGAGAGGCAGCCGG - Intergenic
912429501 1:109621427-109621449 GGTGAGGGGTGGTGGGGGGCGGG + Intronic
913477585 1:119253117-119253139 GGTGGGGGGTGGGGGGCGGGGGG + Intergenic
913632665 1:120724464-120724486 TGTGAGGGGTCCCGGGCCGCGGG - Intergenic
914286056 1:146228453-146228475 TGTGAGGGGTCCCGGGCCGCGGG + Intronic
914330969 1:146670782-146670804 TGTGAGGGGTGGAGTGCAGCAGG - Intergenic
914431824 1:147625576-147625598 AGCGAGGGGTGGGGGGAGGGGGG + Exonic
914547087 1:148679206-148679228 TGTGAGGGGTCCCGGGCCGCGGG + Intronic
914619420 1:149391156-149391178 TGTGAGGGGTCCCGGGCCGCGGG - Intergenic
914847095 1:151289302-151289324 AGGGAGGGCTGGTGGGGCGCAGG + Intronic
914881282 1:151548849-151548871 AGTGAGAGCTGGGGGAACGCAGG + Intronic
915508005 1:156369440-156369462 AGTGCGGGGTGAGGGCGCGCGGG + Intronic
915521633 1:156448625-156448647 AGTGAGGGCTGGGATCCCGCAGG - Intergenic
915616847 1:157045820-157045842 AGGGAGGGAAGGGGGGCGGCCGG - Intergenic
915916473 1:159943740-159943762 AGTGAGGGGTAGGGGGAAGGGGG + Intronic
916611889 1:166399428-166399450 AGTGCGGGGTTGGGGGCAGGGGG - Intergenic
916963319 1:169910684-169910706 TGAGAGGGGTTGGGGGGCGCAGG - Intergenic
916966195 1:169945137-169945159 AGTGGGGGGCGGGGGGGGGCTGG + Intronic
916992210 1:170256187-170256209 AGTGGTGGGTGGGGGGCAGTGGG + Intergenic
917838726 1:178960731-178960753 AGGGAGGGGTGGGTGGCAGGGGG - Intergenic
919195937 1:194286415-194286437 AGTGTGGGGTGGGGTGGGGCGGG - Intergenic
919947305 1:202328859-202328881 AGAGGGGGGTTGGGGGCAGCAGG + Intergenic
920045001 1:203127442-203127464 CGTGAGGGGTGAGGGGTCGCTGG + Exonic
920079352 1:203361018-203361040 AGTGAGGAGTGGGAGGGAGCGGG + Intergenic
920135986 1:203769769-203769791 GGTGCGGGGGGGGGGGCGGCGGG + Intronic
920367917 1:205457565-205457587 AGTGGGGGGGGGGGGGCAGCAGG + Intergenic
920394001 1:205631126-205631148 AAAGAGGGGCGGGGGGCCGCTGG + Intronic
920438956 1:205965796-205965818 TGTGAGGGGTGGAGGGCTGTTGG + Intergenic
920535374 1:206733585-206733607 AGTGGGGGGAGGGGGGCCCTGGG - Exonic
920551537 1:206865740-206865762 GGTGAGGGGTGGGGGGTCAGGGG - Intronic
921172042 1:212558801-212558823 CCCGAGGGGTGGGGGCCCGCGGG - Intergenic
921947151 1:220894109-220894131 AGGCAGCGGTGGGGAGCCGCAGG + Intergenic
921957255 1:220997764-220997786 GGTGGGGGGTGGGGGGCGGGGGG - Intergenic
922775602 1:228213054-228213076 TGTGAGAGGGGCGGGGCCGCAGG + Intronic
922811251 1:228416693-228416715 AGCGGGGGCTGGGGGGCGGCGGG + Intronic
923400913 1:233614652-233614674 AGTGAGGGGAGGCGGGCTGGAGG - Intronic
923438934 1:233996910-233996932 AGTAAGGGGTGGGGGGTCACAGG - Intronic
924436643 1:244048809-244048831 AGGGAGGGGCGGGGGGGAGCGGG + Intergenic
1063664304 10:8052191-8052213 AGAGAGGGGTGGGGGGCCTGGGG - Intergenic
1064458249 10:15508544-15508566 AGTGTGGGGTGAGAGGCCACTGG + Intergenic
1064778902 10:18810899-18810921 GGTGGGGGGTGGGGGGCTGGGGG + Intergenic
1065404773 10:25351422-25351444 AGTTGGGGGTGGGGGGGTGCTGG + Intronic
1067069074 10:43119450-43119472 AGCCAGGGGTGGGAGGCCGCAGG - Intronic
1067102418 10:43342878-43342900 GGTGGAGGGTGGGGGGCCGGAGG - Intergenic
1067416386 10:46106334-46106356 AGGGAGGGCTGGGAGGCCACGGG + Intergenic
1068218273 10:54010779-54010801 AGTGAGAGGTGGGGGCTCACGGG - Intronic
1069717278 10:70529361-70529383 AGATAGGGGTGGGAGGCAGCAGG - Intronic
1069751041 10:70745147-70745169 AGTGAGGGAGTGGGGGACGCTGG + Intronic
1069985059 10:72277319-72277341 TGTGAGGGGTGGGTGGCGGCAGG + Intergenic
1070302119 10:75211050-75211072 AGAGAGGGGCGAGGGGCCGCGGG - Intronic
1070962629 10:80509707-80509729 CGTGGGGGGTGGGTGGCCTCGGG - Intronic
1071001311 10:80833433-80833455 GTTGAGGGGTGGGGGGCAGGGGG + Intergenic
1071320608 10:84452824-84452846 GGTGGGGGGAGGGGGGCGGCGGG - Intronic
1071605120 10:86980541-86980563 AGTGTGGATTGGGGGGCCACTGG - Intronic
1072191051 10:93076297-93076319 AGTGTGGGGTGGGGGGGCGTGGG + Intronic
1073249840 10:102114665-102114687 CCTGGGGGGCGGGGGGCCGCGGG + Intronic
1073451154 10:103610148-103610170 AGTGAGGGGTGGGAGGAAGCTGG + Intronic
1073457604 10:103647049-103647071 AGTCAGGGGTGGGGGGATGGAGG + Intronic
1074893617 10:117755949-117755971 AGTGAGGGGGTGGGGGCTGGAGG - Intergenic
1075006261 10:118832286-118832308 AGGGCGGGGTGGGGGGTGGCAGG + Intergenic
1075162892 10:120040287-120040309 GGGGAGGGGAGGGGGGCTGCAGG + Intergenic
1075301097 10:121324869-121324891 ACTCAGGGGTGGGGGACCCCTGG + Intergenic
1075715392 10:124552364-124552386 AGAGAGGGGTGGGTGGTGGCAGG - Intronic
1076392126 10:130110870-130110892 AGGGAGGGGCGGGACGCCGCGGG + Intergenic
1076491511 10:130864852-130864874 ACAGAGGGTTGGGGGGCCTCGGG - Intergenic
1076625850 10:131821571-131821593 CCTGAGGGGTGTGGGGCTGCTGG - Intergenic
1076708908 10:132320395-132320417 AGTGAGGGGTGGGGGTCCGCTGG + Intronic
1076724828 10:132408458-132408480 AGTGAGGTGTGGGGCGCTGCTGG + Intronic
1076824817 10:132961602-132961624 GGTGAGGGGTGGGGAGCCCCCGG - Intergenic
1076824840 10:132961684-132961706 GGTGAGGGGTGGGGGGTCAGGGG - Intergenic
1076824870 10:132961764-132961786 GGTGAGGGGTGGGGGATCGCCGG - Intergenic
1077010153 11:376052-376074 CCTGGGGGGTGGGGGGGCGCAGG - Exonic
1077138814 11:1014506-1014528 GGGGCGGGGTGGGGGCCCGCGGG + Intronic
1077217418 11:1400763-1400785 TGTCCGGGGTGGGTGGCCGCAGG - Intronic
1077348231 11:2074491-2074513 AGGGCTGGGTGGGGGGACGCGGG - Intergenic
1077426596 11:2482642-2482664 AGTGTGGGGTGGGGGTTGGCGGG - Intronic
1077882363 11:6361341-6361363 AGTGAGGGGTGGGAAGCAACTGG - Intergenic
1079126105 11:17719636-17719658 AGGGAGGGGTGGGGGACAGTGGG + Exonic
1079135870 11:17775751-17775773 AGTGAGCAGTGGGTGGCCGGTGG + Intronic
1081063730 11:38512879-38512901 TGGGAGGGGTAGGGGGCCGGGGG - Intergenic
1081131997 11:39392069-39392091 ATTGTGGGGTGGGGGGACGGGGG - Intergenic
1081290140 11:41314644-41314666 TGTCAGGGGTGCGGGGCCGTGGG + Intronic
1081512019 11:43784453-43784475 AGGTGGGGGTGGGGGGCAGCAGG + Intronic
1081669534 11:44935287-44935309 AGTGGGTGTGGGGGGGCCGCAGG + Intronic
1081781889 11:45718855-45718877 AGTGAGGAGTGGGGAGCAGGAGG - Intergenic
1082029445 11:47594075-47594097 AGCGAGGGCTGGGGAGGCGCGGG - Intronic
1082581124 11:54870899-54870921 ATTGTGGGGTGGGGGGACGGGGG - Intergenic
1083324191 11:61865277-61865299 GGTGAGGGGTGGAGGTCCACAGG + Exonic
1083472194 11:62891431-62891453 AGGGAAGGGTGGGGAGCCTCAGG - Intergenic
1083619337 11:64041328-64041350 GTGGAGGGGTGGGGGGCAGCAGG - Intronic
1083694593 11:64434235-64434257 AGGGTGGGGTGGGGGGCAGGGGG - Intergenic
1083730313 11:64649143-64649165 AGTGGGGGCTGGGGGACAGCTGG + Intronic
1083744416 11:64727239-64727261 ACTGAGGGCTGGGGGGGAGCTGG - Intronic
1083782626 11:64925992-64926014 GGGGAGGGGTGGGAGGCAGCGGG + Intronic
1083815585 11:65130683-65130705 GGTGGGGGGTGGGGGGCAGGGGG + Exonic
1083897775 11:65628757-65628779 AGTGGGGGGTGGTGGGGGGCTGG + Intronic
1084423274 11:69071154-69071176 AGTGTGGGGTGGGGGATCCCTGG - Intronic
1084460919 11:69296167-69296189 AGTGAGGGGTGGGGTGCCGGTGG - Exonic
1084593817 11:70105457-70105479 TGTGGGGGGTGGGGGGCTGGAGG + Intronic
1085016634 11:73178204-73178226 AGTAAGGGTTGGGGAGCCCCAGG - Intergenic
1086252466 11:84833201-84833223 AGTGAAGGGTTGGGGGCAGAGGG - Intronic
1086505743 11:87502359-87502381 GGTGCGGGGTGGGGGGCTGTGGG - Intergenic
1086534918 11:87832892-87832914 AGTGGGGGGTGGGGGGACGGAGG + Intergenic
1087670683 11:101102854-101102876 AGTGAGGGGTGGGGGGGGTTGGG + Intronic
1088581166 11:111318181-111318203 AGTGAGGGGTGGGTGGCTCATGG + Intergenic
1088645404 11:111913037-111913059 AGTCTGGGGTGGGGGGTGGCTGG - Intronic
1089132865 11:116225641-116225663 AGTGGCGGGTGGGGGGGCACGGG + Intergenic
1089709730 11:120306319-120306341 AGTGAGGGGTGGTGGCCGGGAGG + Intronic
1090373819 11:126275242-126275264 AGAGAGGGGTTGGGGGGCACAGG + Intronic
1090673188 11:128965172-128965194 AGGGTGGGGTGGGGGGTGGCAGG - Exonic
1091228132 11:133970422-133970444 AGTGGAGGGTCGGGGGGCGCAGG - Intergenic
1091399160 12:172218-172240 TGTGGGGGGTGGGGGGCCATGGG - Intronic
1091916299 12:4273546-4273568 GGAGAGGGGTGGGGGGTGGCGGG + Intergenic
1092111432 12:5967633-5967655 AGTGGGGGGTTGGGGGATGCTGG - Intronic
1092159853 12:6310397-6310419 AGTAAGGGGCGGGGCGCCGCCGG - Intergenic
1092246910 12:6868768-6868790 GGTGAGGGCTGGGGGGCTCCAGG + Intronic
1092290729 12:7158255-7158277 AGTGAGGGATGGGGGGCCGGGGG - Exonic
1092539790 12:9413628-9413650 AGAGAGGGGCGGGGGGCGGGGGG + Intergenic
1092668358 12:10832786-10832808 AGTGGGGGGTGGGGAGCGGTGGG - Intronic
1094498786 12:31005635-31005657 AGGCAGGGGTGGGTGGGCGCAGG + Intergenic
1095953042 12:47791795-47791817 GGGGAGGGGTGGGGGGCCCTGGG - Intronic
1096509925 12:52122080-52122102 AGAGAGGGGTGGGGGGTCCTGGG - Intergenic
1096510139 12:52123245-52123267 AGTGGGTGGTGGGTGGCAGCTGG - Intergenic
1096627360 12:52903942-52903964 AGGGCGGGGTGAGGGGCTGCGGG - Intronic
1096675150 12:53222013-53222035 GGGGAGGGGCGGGGGGCTGCCGG + Intronic
1096676745 12:53230411-53230433 ACAGAGGGGAGGGGGGCAGCGGG - Intronic
1096678684 12:53240816-53240838 AGTGAGGGGTGGGGTGAGGTGGG - Intergenic
1096760774 12:53840276-53840298 AGTGAGGGGTGGGGGAAAGGAGG - Intergenic
1096783363 12:54003503-54003525 AGGGAGGGGTGGGGGGTCTCTGG + Intronic
1097185782 12:57195595-57195617 AGTGAGGGACGGTCGGCCGCTGG + Intronic
1100651834 12:96599153-96599175 ATTGGGGGGTGGGGGGCTGGGGG - Intronic
1100800013 12:98221303-98221325 ATTGGGGGGTGGGGGGCGGGCGG - Intergenic
1100830043 12:98509349-98509371 AGTGGGGGTTGGGGGGCTCCGGG - Intergenic
1102012327 12:109626388-109626410 AGGGAGGGGTGGGGGAGCACTGG - Intergenic
1102238006 12:111306866-111306888 GGTGAGGGATGGGGGTCCACAGG - Intronic
1102498152 12:113333650-113333672 AGGGTGGGGTGGGGGGCGGGGGG - Intronic
1102527101 12:113519990-113520012 AGGCAGGGGTGGGGGGGCGGAGG + Intergenic
1102543423 12:113638280-113638302 GGTGGGGGGTGGGGGGCTGGGGG + Intergenic
1102691999 12:114768604-114768626 AGTTTGGGGTGGGGGGACGGGGG + Intergenic
1102963915 12:117111884-117111906 AGGCAGGGCTGGGGGGCCTCAGG - Intergenic
1103241920 12:119420573-119420595 AGTGGGGGATGGGGGGCAGAAGG + Intronic
1103424724 12:120823213-120823235 GGTGGGGGGTGGGGGGGCGGCGG + Intronic
1103425472 12:120830318-120830340 AGGGAGGGGTGGGGGGGAGGTGG + Intronic
1103563336 12:121803848-121803870 AGTGAGGGGTGGGGGGCCGCTGG + Intergenic
1103627932 12:122234833-122234855 GGTAAGGGGTGAGGGGCCTCTGG - Intronic
1103914532 12:124369586-124369608 AGGGAGGGGTGGCGGGCTGCCGG + Intronic
1104114975 12:125740863-125740885 AGAGAGGGGCAGGGGGCAGCTGG - Intergenic
1104152129 12:126093937-126093959 AGGGAGCTGTGGGGGGCAGCAGG + Intergenic
1104624225 12:130338791-130338813 TGTGGGGGGTGCGGGGCCGGGGG + Intronic
1104691133 12:130827123-130827145 AGGGAGGGGTGGGGGGAGGGAGG + Intronic
1104949478 12:132432768-132432790 AGGGAGGGCTGCGGAGCCGCCGG - Intergenic
1106157253 13:27171080-27171102 CGGGAGGGGTGGGGGTCGGCGGG - Intronic
1107807122 13:44163829-44163851 TGTGAGGGATGGGGAGCCGGAGG + Intergenic
1108251403 13:48571543-48571565 AGTGGGCGGTGTGGGGCCTCAGG - Intergenic
1108357471 13:49640866-49640888 AGTGCGGGGGTGGGGGCCGAAGG + Intergenic
1108459744 13:50653165-50653187 AGTGTGGGGTGGGGGGCAGGGGG + Intronic
1108479292 13:50851919-50851941 AGTGAGGGGTTGGGGGTGGGGGG - Intergenic
1109329701 13:60913631-60913653 AGTGAGGAGTGGGGCGCATCTGG + Intergenic
1110499239 13:76207470-76207492 TGTGGGGGGTAGGGGGCGGCTGG - Intergenic
1110552989 13:76828230-76828252 AGGGAGGGGAGGGGGGAGGCAGG + Intergenic
1111604488 13:90519998-90520020 AGTGAGGGGTGGGGGCTCACAGG - Intergenic
1113518079 13:110918431-110918453 ATGGAGGGGTGGGGGGACCCGGG + Intergenic
1113562481 13:111293243-111293265 TGTCAGGGGTGGGGAGCCGGGGG - Exonic
1113632766 13:111899364-111899386 GGGGCGGGGTGGGGGGGCGCCGG - Intergenic
1113861783 13:113491334-113491356 AGAGAGGGGAGGGGAGCCCCAGG - Intronic
1113884962 13:113653663-113653685 GGTGGGGGGTGGGGGGTGGCTGG + Intronic
1114418118 14:22557419-22557441 AGGGAGGGCTGGGGGCCCGGAGG + Intronic
1115474356 14:33799710-33799732 TGTGTGGGGCGGGGGGCCGGCGG - Intronic
1115521453 14:34236713-34236735 AGTGTGTGCTGGGGGGGCGCAGG - Intronic
1116923539 14:50608310-50608332 AGGGAGGGGTGGGGGACAGTAGG + Intronic
1117001992 14:51379906-51379928 AGTCAGGGATGGGGGTCCTCAGG + Intergenic
1117378345 14:55136063-55136085 AGTGAGGGGAGGAGGGCAGCTGG - Intronic
1118387896 14:65271895-65271917 AGTGAGGGGTGGGAGGGAACAGG - Intergenic
1118801366 14:69192365-69192387 AGTGCGGGTTGGGGCGCAGCGGG + Intronic
1119004092 14:70908221-70908243 AGTGAGCGGGCGGGGGCGGCCGG - Intronic
1119314735 14:73683610-73683632 AGAGGGGGGTGGGGGGCTGAGGG - Intronic
1119435470 14:74595257-74595279 GGTCAGGGCTGGGGAGCCGCGGG + Intronic
1119767661 14:77200505-77200527 AGTGATGGGTGGGAGGCAGATGG - Intronic
1120090701 14:80329734-80329756 AGTGTGGGGTGGGGGGCTGGGGG + Intronic
1121516496 14:94555768-94555790 GGTGGGGGGTGGGGGGCGGGGGG + Intergenic
1122018649 14:98818643-98818665 ATTGAGGGGTGGGAGGGGGCAGG + Intergenic
1122075821 14:99233875-99233897 AGGCAGGGGAGGGGGGCAGCCGG + Intronic
1122156453 14:99753202-99753224 AGTGGGGGGTGGGGGGGCGGCGG - Intronic
1122311067 14:100794740-100794762 AGAGAGCGGTGGGGGGCGGCGGG + Intergenic
1122464055 14:101918471-101918493 GGGGAGGGGTGGGGGGCCAGAGG - Intronic
1122587325 14:102817994-102818016 GGAGAGGGGTGGGGAGCTGCGGG + Intronic
1122798762 14:104219552-104219574 AGTGAGGGGCTGGGGGCCTGGGG - Intergenic
1123587001 15:21769810-21769832 GGTGGGGGGTGGGGGGTGGCGGG + Intergenic
1123623639 15:22212375-22212397 GGTGGGGGGTGGGGGGTGGCGGG + Intergenic
1124667295 15:31604440-31604462 GTTGAGGGGTGGGGGGCCAAGGG + Intronic
1125057480 15:35378820-35378842 TGTCAGGGGTGGGGGGCTGGGGG + Intronic
1125193049 15:37015592-37015614 AGTGTGGGGTGGGTGGCAGGGGG + Intronic
1126200827 15:45984096-45984118 AGTTGGGGGTGGGGGGCGGGGGG - Intergenic
1126709920 15:51443884-51443906 AGTGAGGGGCCTGGGGCTGCAGG + Intergenic
1127991553 15:64122574-64122596 GGTGAGGGGTGAGGGGCCAAGGG - Intronic
1128263902 15:66252218-66252240 GGTGGGGGGTGGGGGGCGGGGGG - Intronic
1128416200 15:67448369-67448391 ATTGTGGGGTGGGGGGCGGGGGG - Intronic
1128534352 15:68479470-68479492 CGTGTGTGGTGGGGGGCCGAGGG - Intergenic
1128766643 15:70255136-70255158 AGGTAGGGGTCGGGGGCCGGGGG + Intergenic
1129644401 15:77417435-77417457 AGAGTGGGGTGGGGGGATGCGGG + Intronic
1129675313 15:77630171-77630193 AGGGAAGGGTGGGGGGCGGTGGG - Intronic
1129750368 15:78058713-78058735 TCTGAGGGGTGGGGGGCAGATGG - Intronic
1129874151 15:78961714-78961736 GGTGGGGGGTGGGGGGCGGCGGG - Exonic
1130402655 15:83571985-83572007 AGGGTGGGGTGGGGGTCTGCTGG - Intronic
1130656514 15:85795059-85795081 ACCGGGGGGTGGGGGGCCGGGGG + Intergenic
1131111420 15:89767320-89767342 GGTGGGGGGTGGGAGGCTGCAGG - Intronic
1131545494 15:93312646-93312668 AGTGGGTGGTGGGGGGCAGATGG + Intergenic
1131764479 15:95660451-95660473 ACTGAGTGGTGGGGGGCAGGAGG - Intergenic
1132516993 16:370463-370485 GGTGGGGTGTGGGGGGGCGCCGG - Intronic
1132606948 16:797534-797556 AGTGAGGGGTGAGGGGCAGCTGG + Intronic
1132702701 16:1228856-1228878 AGTGGGGGTTGGGGGGCGGGGGG + Intronic
1132705625 16:1242012-1242034 AGTGGGGGTTGGGGGGCGGGGGG - Intronic
1132720216 16:1312069-1312091 AGTGAGGGGGGGGGAGCCAGGGG - Intronic
1132732055 16:1367477-1367499 AGGGAGGGAGGGAGGGCCGCAGG - Intronic
1132761797 16:1512111-1512133 GGTGAGGGGTGGTGGGGGGCAGG + Intronic
1132761812 16:1512150-1512172 GGTGAGGGGTGGTGGGGGGCAGG + Intronic
1133041125 16:3060104-3060126 AGTGAGGGGTGGGTGGAACCTGG + Exonic
1133218509 16:4307810-4307832 AGCCAGGGGCGGGGCGCCGCCGG - Intergenic
1133229722 16:4360782-4360804 AGTGAGGAGAGGGGGGCCAGTGG - Intronic
1134059481 16:11190551-11190573 AGTGGAGGGAGGGGGGCCGCTGG - Intergenic
1135517222 16:23146230-23146252 AGTGTGGGGTGGGGGGCGGGGGG + Intronic
1135787031 16:25359357-25359379 GTTGTGGGGTGGGGGGCGGCGGG + Intergenic
1136230575 16:28883147-28883169 AGGGAGGGGTGGGGGCCGGGTGG + Intronic
1136297482 16:29311956-29311978 AGTGAGGTGTGAGGGGCTCCAGG + Intergenic
1136375756 16:29864086-29864108 GGTGAGGGGTAGGGGGTTGCGGG + Intergenic
1136573888 16:31112049-31112071 ATGGAGGGGTGGGGGACCCCAGG + Intronic
1137619739 16:49868403-49868425 AGCTAGGGGTGCGGGGCCGCCGG + Intergenic
1138207084 16:55133083-55133105 AGTGTGGGGCGGCGGGCCGGCGG + Intergenic
1138228800 16:55323543-55323565 ACTGATGGGTGGGCGGCGGCAGG - Intergenic
1138360579 16:56424879-56424901 GGGGAGGGGGAGGGGGCCGCGGG - Intronic
1138490735 16:57374849-57374871 AGAGAGGGGTGGCTGGGCGCAGG + Intronic
1138659392 16:58508627-58508649 AGTGAGGTGAGGGGTGCCGAGGG - Intronic
1139834933 16:69830622-69830644 TGTGAGTGTTGGGGGGCCGCGGG + Intronic
1139951990 16:70677034-70677056 AGAGAGTGGGGGGGGGCCTCTGG - Intronic
1140002584 16:71040122-71040144 TGTGAGGGGTGGAGTGCAGCAGG + Intronic
1140482962 16:75272377-75272399 AGTGGGGGGTGGGGGGCACTAGG + Intergenic
1141524772 16:84604242-84604264 AGTGTGGGGTGGGGAGCAGGGGG - Intronic
1141700284 16:85639194-85639216 AGGGAGGGCTGGGCGGCCCCGGG - Intronic
1141897544 16:86968067-86968089 GGTGGGGGGTGGGGGGGCCCAGG + Intergenic
1142059033 16:88018033-88018055 AGTGAGGTGTGAGGGACCCCGGG + Intronic
1142090431 16:88206918-88206940 ACGGAGGGGAGGGAGGCCGCGGG + Intergenic
1142090540 16:88207145-88207167 ACAGAGGGGAGGGAGGCCGCGGG + Intergenic
1142262990 16:89051250-89051272 AGGGAGGGCTGGGGGGGCGGGGG - Intergenic
1142286372 16:89173166-89173188 GCTGAGGGGTGGAGGGCCGGGGG - Intronic
1142359327 16:89619201-89619223 AGGGAGGGCAGGGGGGCTGCAGG - Intronic
1142638665 17:1272328-1272350 AGTGAGGGCAGAGGGGCCTCAGG + Intergenic
1142711107 17:1724602-1724624 AGGGAGGGCGGGGAGGCCGCCGG + Intronic
1142918023 17:3159366-3159388 GTTGAGGGGTGGGGGGCCAGGGG + Intergenic
1143031694 17:3971501-3971523 TGGGAGGGCTGGGGGGCAGCGGG + Intergenic
1143164300 17:4890188-4890210 GGTGTGGGGTGGGGGGCAGAGGG - Intronic
1143211832 17:5193669-5193691 GGTGGGGGGTGGGGGGCTGGGGG + Intergenic
1143382143 17:6503231-6503253 AGTGAGGGGTGGGAGGCTGGTGG - Intronic
1144004613 17:11088783-11088805 AGAGAGGGTTGTGGGGCCGAGGG - Intergenic
1144057777 17:11557811-11557833 ATTGAGGGGGAGGGTGCCGCGGG - Exonic
1144078127 17:11737315-11737337 AGGGGTGGGTGGGGGGCAGCTGG - Intronic
1144220169 17:13092587-13092609 AGAGTGGGGTGGGGTGCAGCTGG + Intergenic
1144572334 17:16407722-16407744 GGTGAGGGGTGGGGGGGTGAGGG + Intergenic
1145202697 17:20960919-20960941 GTGGAGGGGTGGGGGGCTGCAGG + Intergenic
1145280411 17:21463642-21463664 AGTGAGGGGGTGGGGGCCATGGG - Intergenic
1146208145 17:30922225-30922247 TGGGAGGGGTCGGGGCCCGCAGG - Intronic
1146507627 17:33418948-33418970 TGTCAGGGGTGGGGGGCTGGGGG + Intronic
1146625328 17:34430999-34431021 GGTGAGGGGTGGGGGGTGGGGGG - Intergenic
1146649144 17:34596005-34596027 AGAGAGGGGTTGGGGTCCGAGGG - Intronic
1147110260 17:38256774-38256796 AGTCGGGGCTGGGCGGCCGCAGG - Intergenic
1147215378 17:38896158-38896180 AGTGAAGGGTGGGGGGCCAGGGG - Intronic
1147407065 17:40219651-40219673 CCTGAGGGGCGGGGGGCCGGGGG + Intronic
1147598856 17:41733834-41733856 GGAGAGGGGCGGGGGGCTGCGGG - Intronic
1147660137 17:42112953-42112975 AGGGAGAGGTGGGGGGCTGCAGG + Intergenic
1147722275 17:42546679-42546701 AACAAGGGGTGGGGGCCCGCAGG + Intergenic
1147723460 17:42552849-42552871 AACAAGGGGTGGGGGCCCGCAGG + Exonic
1147769293 17:42856596-42856618 TGTGAGGGATGGGGAGCAGCTGG + Exonic
1147772027 17:42874415-42874437 TGTGAGGGATGGGGAGCAGCTGG + Intergenic
1147939891 17:44038957-44038979 AGTGTGGGGTGGGGGGAGGCGGG + Intronic
1147977584 17:44256632-44256654 AGTGAGAGCTGGGGGGACTCTGG - Intronic
1148456567 17:47814477-47814499 AGGGAGGGGTGGGAGGCGGGTGG - Intronic
1148700625 17:49584558-49584580 AGTGAGGGGTGGGGGAGTGGGGG + Intergenic
1148875010 17:50681897-50681919 AGTGAGGGGTGAGGGGCCAGAGG - Intronic
1149466605 17:56884703-56884725 AGTGAGGAGTGGCGGGTCGGGGG + Intergenic
1149768170 17:59297790-59297812 AGTGGGGTGTGGGGGGCGGGGGG + Intergenic
1150198299 17:63325056-63325078 TGTGTGGGGTGGGGGGCGGGGGG + Intronic
1150643490 17:66964687-66964709 AGTGCGGGCTGCGCGGCCGCCGG - Intergenic
1151426360 17:74033335-74033357 AGTGAGAGGCGGGAGGCCGAGGG - Intergenic
1151704344 17:75758699-75758721 GGTGAAGGGTGGAAGGCCGCGGG + Intronic
1151840073 17:76611275-76611297 AGAGCGGGGTGGGGGGAGGCGGG + Intergenic
1151966004 17:77432036-77432058 AGCTGGGGGTGGGGGGCAGCAGG + Intronic
1152098381 17:78286446-78286468 AGGCAGGGGTGGGGGGCAGGAGG - Intergenic
1152369605 17:79878162-79878184 AGTGAGGGGTGCTGGGCCTGGGG + Intergenic
1152476658 17:80522837-80522859 AGTGGGGGGTGGTGGGCTGGAGG + Intergenic
1152596905 17:81242219-81242241 AGGCAGGGGTGGGGGGCAGCCGG - Intergenic
1152718102 17:81909468-81909490 CAGGAGGGCTGGGGGGCCGCGGG + Intronic
1152745014 17:82034516-82034538 AGGGAGGGGTGGGGAGAGGCGGG + Intergenic
1152751881 17:82065967-82065989 AGAGAGGGGTCGGGGCTCGCCGG + Intergenic
1153075549 18:1157894-1157916 GTTGAGGGGTGGGGGGCTGGGGG - Intergenic
1154231409 18:12559179-12559201 GGGGTGGGGTGGGGGGGCGCCGG + Intronic
1154241515 18:12657794-12657816 AGTGGGCGGCGAGGGGCCGCGGG - Exonic
1154309174 18:13254266-13254288 GGTGAGGAGTGAGGGGCCCCAGG + Intronic
1155214321 18:23629784-23629806 AGGGAGGGCTGGGTGTCCGCTGG - Intronic
1155270740 18:24139227-24139249 AGTCGGGGGTGGGGGGCCTGTGG + Intronic
1156496045 18:37525604-37525626 AGGGAGGGGTGGGGAGGGGCGGG + Intronic
1157273602 18:46294745-46294767 AGTGGGGGGTGGGGGGCGGTTGG - Intergenic
1157284043 18:46365008-46365030 AGTGAGGGGTTGGGGGTCTCTGG + Intronic
1157562022 18:48654969-48654991 TGTGTGGGGTGGGGGGCAGGGGG + Intronic
1157614722 18:48979646-48979668 AGGGAGGGCTGGGGGTCCTCAGG - Intergenic
1157955702 18:52095193-52095215 TGTCAGGGGTGGGGGGCTGGGGG + Intergenic
1158179526 18:54698258-54698280 ATTGTGGGGTGGGGGGACGGGGG + Intergenic
1159359410 18:67381409-67381431 GGTGGGGGGTGAGGGGCCGCAGG + Intergenic
1159704828 18:71674287-71674309 AGTGAAGGGTGGGGAGCCTTCGG - Intergenic
1160481515 18:79245060-79245082 AGTGGGGGGTGGGAGGTCACTGG - Intronic
1160564528 18:79778815-79778837 AGTGAGGGGTGGGGCGGCCCCGG + Intergenic
1160592669 18:79952646-79952668 AGTGAAGGGTGAGGGGCGCCTGG + Intergenic
1160609250 18:80073179-80073201 GGTGGGGGGTGGGGGGCGGGGGG - Intronic
1160752560 19:741392-741414 AGTGAGGGGAGACGGGCTGCAGG + Intronic
1160757905 19:767297-767319 AGAGCGGGGTGGGGGGCAGCAGG + Intergenic
1160775278 19:852590-852612 GGGGAGGGGGGGGGGGTCGCAGG + Intronic
1160791939 19:927204-927226 AGGCAGGGGTGGGGGGCGGAGGG - Intronic
1160875403 19:1294317-1294339 AGTGAGGGAAGGGGAGCCGCCGG + Intronic
1160904338 19:1445437-1445459 AGTGAGGGCTGGGAGGCCCCGGG - Intergenic
1161001728 19:1914194-1914216 AGTGAGAGGTGGGAGGTGGCAGG + Intronic
1161083692 19:2324058-2324080 AGTGGGGTGAGGGGGGCAGCGGG - Intronic
1161101307 19:2423458-2423480 GGTGGGGGGTGGGGGGCGGGGGG + Intronic
1161208981 19:3056558-3056580 GGAGAGGGGCAGGGGGCCGCTGG + Intronic
1161241526 19:3225915-3225937 AGGGAGGCGTGGGCGGCCTCAGG + Intronic
1161249123 19:3270969-3270991 AGGGAGGGAGGGGCGGCCGCGGG - Intronic
1161573439 19:5042677-5042699 AGTGAGGGGGGGGGCGCCGTAGG + Intronic
1161912660 19:7206155-7206177 CCTGAGGGGTGGGGGACCCCTGG - Intronic
1161983580 19:7642716-7642738 AGTGAGGGGAGAGGAGCCACAGG - Intronic
1162032880 19:7925016-7925038 AGTCGGGGGTGGGGGCCAGCCGG + Exonic
1162779353 19:12998571-12998593 AGAGAGGGGTGGGGGGTGGATGG + Intronic
1162828679 19:13270406-13270428 GGTGGGGGGTGGGGGGCGGGTGG + Intronic
1163124599 19:15238155-15238177 TGTGAGGGGTGGTGGGTGGCGGG + Exonic
1163455468 19:17403654-17403676 AGTGAGGAGGGGGCGGCCCCGGG - Intronic
1163627855 19:18401131-18401153 AGTGAGAGGTGGGGGGAGGGGGG - Intergenic
1163673693 19:18644712-18644734 AGTGAGGCTTGTGGGGCTGCTGG + Intronic
1164381535 19:27740529-27740551 AGTGAAAGGTGGGTGGCCCCAGG - Intergenic
1164651946 19:29897101-29897123 GGTGGGGGGTGGGGGCACGCTGG - Intergenic
1164958613 19:32407259-32407281 AGTAATGGGTGGGGGGGAGCAGG - Intronic
1165255867 19:34576999-34577021 GGGGAGGGGTGGGAGGCCGAAGG + Intergenic
1165448552 19:35869623-35869645 AGTGAGGGCTCGGGGGGCGTTGG - Intronic
1165468191 19:35987403-35987425 AGCGCGGGGGCGGGGGCCGCAGG - Intergenic
1165795639 19:38517566-38517588 TGTGCAGGGTGGGGGGGCGCCGG - Exonic
1166094532 19:40530687-40530709 AGGGAGGGGCGGGGCGGCGCGGG + Intronic
1166324767 19:42042487-42042509 AGTGAGGGAGGGCGGGCAGCTGG - Intronic
1166365170 19:42274466-42274488 GGTGAGGGGTGGAAGGCCACAGG - Intronic
1166366608 19:42281222-42281244 AGAGCAGGGTGGGGAGCCGCAGG + Intronic
1166773405 19:45297981-45298003 AGGGCGGGGCGGGGGGCCGATGG + Intronic
1167072042 19:47227308-47227330 AGTGGGGGGGGGGGGGGGGCAGG - Intronic
1167128641 19:47569690-47569712 AGAGATGGGTGGGGGGCGGCGGG - Intergenic
1167557067 19:50203356-50203378 AGCGAGGCGCGGGGGGCGGCCGG - Intronic
1167618681 19:50549654-50549676 AGGGAGGGCTGGGAGGCAGCAGG + Intronic
1167648950 19:50719442-50719464 GGGGAGGGGGGAGGGGCCGCGGG - Intronic
1167789141 19:51661044-51661066 TGAGAGGGGTGGGGGGGCGGGGG - Intergenic
1168091401 19:54087716-54087738 AGAGTGGGGTGGGGGGCTGGGGG - Intergenic
1168097061 19:54121943-54121965 AGTGAGTGCTGGGGGGCAGGCGG + Exonic
1168155335 19:54471216-54471238 AGAGAGGGGTGGGCGGAGGCGGG - Intronic
1168172135 19:54596015-54596037 AATGAGGGGTGGGGGTCCCAAGG + Intronic
1168185793 19:54698587-54698609 AGTGAAGGGAGAGGGTCCGCAGG + Intronic
1168254230 19:55157217-55157239 AGTGAGGGGTCTGGGGCGGGAGG - Intronic
1168343744 19:55640849-55640871 TGGGAGGGGAGCGGGGCCGCCGG + Intronic
1168558321 19:57362274-57362296 GGTCAGGGGTGGGGGGCAGGGGG - Intergenic
1168676118 19:58279111-58279133 AGTGATGTCTGTGGGGCCGCCGG + Exonic
925362449 2:3288944-3288966 TGTGCGGGGTGGGGCTCCGCTGG - Intronic
925743370 2:7024990-7025012 AGTGGGGGCTGGGGGGCTGTTGG + Intronic
926055415 2:9771384-9771406 TGGGAGGGGTGGGGGTCCTCTGG - Intergenic
926300132 2:11596443-11596465 AGTGAGGGGGGTGGGGGCACAGG + Intronic
926486830 2:13472140-13472162 ATTGTGGGGTGGGGGGAGGCGGG - Intergenic
927557940 2:24049417-24049439 TGTGGGGGGTGGGGGGCAGAAGG - Intronic
927698376 2:25252322-25252344 TGGGAGGGGAGGGGGGCGGCGGG + Intronic
928242040 2:29594892-29594914 AATGGGGGGTGGGGGGCGGGGGG + Intronic
929804488 2:45132713-45132735 AGTGAGGGGTGGGGAGGTGGGGG + Intergenic
930096200 2:47569086-47569108 AGGGAGGGGTGGGGGCCTGAAGG + Intronic
931433122 2:62225577-62225599 AATGAGGTGTGGAGGGCCACTGG + Intergenic
931711061 2:64989323-64989345 AGTGAGCGGGCTGGGGCCGCTGG + Intronic
931834591 2:66085525-66085547 AGAGTGGGGTGGGGGGCGGGCGG + Intergenic
932437020 2:71707946-71707968 AGTGAGGGGTGGAGGGCAGGTGG - Intergenic
933926390 2:87094098-87094120 GCTGAGGAGTGGGGGGGCGCAGG + Intergenic
933988263 2:87612197-87612219 AGTGAGGTGAGAGGGGCAGCTGG + Intergenic
934588549 2:95526781-95526803 GGCGAGGGGTGGGGGGAGGCAGG + Intergenic
934616776 2:95776218-95776240 AGTGTGGGGATGGGGGCTGCGGG - Intergenic
934644114 2:96048342-96048364 AGTGTGGGGATGGGGGCTGCGGG + Intergenic
934837531 2:97604433-97604455 AGTGTGGGGATGGGGGCTGCGGG + Intergenic
936305577 2:111338611-111338633 AGTGAGGTGAGAGGGGCAGCTGG - Intergenic
937001804 2:118474503-118474525 AGTGTGGGGGAGGGGGCCTCAGG - Intergenic
937911026 2:127075749-127075771 AGAGGGTGGTGGGGGGCAGCTGG - Intronic
942278961 2:174342288-174342310 AGTGGGGCGCGGGGGGCGGCTGG + Intergenic
942538849 2:176994518-176994540 GTTGAGGGGTGGGGGGCTGGGGG + Intergenic
943639361 2:190342591-190342613 AGGGAAGGGTGGGGGGATGCGGG + Intronic
944060047 2:195563114-195563136 AGTGGGGGGAGGGGGGCGGGGGG - Intergenic
944556379 2:200891453-200891475 ACTGAGGGGTGGGGAGCCTTGGG + Intronic
944625659 2:201566351-201566373 TGTGAGGGGTGGGGGGAGGGGGG - Intronic
945254434 2:207791884-207791906 TGTGGGGGGTGGGGGGCGGGGGG + Intergenic
946162324 2:217842899-217842921 AGTGAGAGGTAGGGGGTGGCTGG - Intronic
946321289 2:218955900-218955922 AGGGTGGGGGGGGGGGCAGCAGG + Intergenic
947819102 2:233058538-233058560 TGTGAGAGGTGGGGGGCTGGGGG + Intergenic
947938215 2:234025660-234025682 AGGGGGGGGTGGGGGGCGGGTGG - Intergenic
948217154 2:236240266-236240288 AGTGAGGCGGTGGGGGCTGCAGG - Intronic
948585867 2:239019212-239019234 AGGGAGGGGTGGGGGCCTGTTGG + Intergenic
948684924 2:239664404-239664426 AGCGAGGGGTGGGGGTCTGGGGG + Intergenic
948765579 2:240217092-240217114 GGTGAGGGGTGGGGGGGTGGAGG + Intergenic
948908782 2:240992707-240992729 AGTCAGGGGTGGAGGACAGCAGG + Intronic
1168881596 20:1210949-1210971 AGTCAGGGGTGGGGGGCAAGGGG - Intergenic
1169172123 20:3473350-3473372 CGTGAGGGGTGGGGTGCTGAGGG + Intronic
1170771475 20:19336680-19336702 GGTGGGGGGTGGGGGGTGGCGGG - Intronic
1170774552 20:19364265-19364287 ACTCAGGGGAGGGGGGCGGCTGG - Intronic
1171171959 20:23023423-23023445 GGTGAGGGGTGGGGGACCGCAGG + Intergenic
1171484460 20:25477121-25477143 AGAGAGGGGCTGGGGGCGGCAGG - Intronic
1172274871 20:33673997-33674019 GCTGAGGGGTGGGAGGCAGCAGG + Intronic
1172310562 20:33915191-33915213 ACTGGGGGGTGGGGGGAAGCTGG - Intergenic
1172993398 20:39052246-39052268 AGTGAGGGGTGGGGGTGGGAGGG + Intergenic
1173672604 20:44809366-44809388 AGCGAGGGGTGGGGAGCTGTAGG - Intronic
1173900927 20:46588315-46588337 AGTGAGGGGAGGGGTGCCAATGG + Intronic
1174053875 20:47785317-47785339 AGTGGGGCGTGGGGGGCAGGTGG - Intronic
1174805103 20:53598498-53598520 AGTGAGGTCTGAGGGACCGCAGG + Intronic
1175221630 20:57420707-57420729 AGTGTGGGCTGGTGGGCAGCAGG + Intergenic
1175443900 20:59007522-59007544 GCTTCGGGGTGGGGGGCCGCAGG + Intergenic
1176143940 20:63557216-63557238 GGTGAGCGGTGGGGGGACGCAGG - Intergenic
1176144950 20:63561420-63561442 AGTAAGGGTTGGGGGCCTGCCGG + Exonic
1178420727 21:32441261-32441283 AGTTAGGGGTGTGGGGCAGGAGG + Intronic
1178443570 21:32618315-32618337 AGTGAGTGCTGAGGGACCGCTGG + Intergenic
1179087301 21:38228942-38228964 AGTGAAGTGTGTGGGGCCACAGG - Intronic
1179133728 21:38661181-38661203 AGTGTGGGAGGGGGAGCCGCGGG + Intronic
1179157057 21:38859751-38859773 AGTGAAGGGTGGGGGTTCTCAGG + Intergenic
1180106604 21:45622906-45622928 AGTGAGGGGTGTGGGGACTGCGG - Intergenic
1180118188 21:45725865-45725887 AGGAAGGGGTGGGGGGCAGCTGG + Intronic
1180145340 21:45915581-45915603 AGTGAGAGGTGTGTGGCCGGTGG - Intronic
1180157030 21:45982813-45982835 AGGGAGGGGTGGGGGCCCAGGGG + Intronic
1181162537 22:20966854-20966876 AGGGTGGGGTGGGAGGCCACAGG + Intronic
1181583393 22:23839928-23839950 AGTGAGGGGTGGGGCCACGTGGG + Intergenic
1181613517 22:24035884-24035906 GGCGGGGGGTGGGGGGCCGAGGG - Intronic
1181988641 22:26820089-26820111 AGTGACTGGTGGGGGGCGGGGGG - Intergenic
1182603937 22:31489389-31489411 ACTGAGGGGCGGCCGGCCGCAGG + Exonic
1182649186 22:31836903-31836925 AGTGTGGGATGGGGGGCCAGGGG - Intronic
1182786169 22:32909615-32909637 GGTAAGGGGTGGGGGGGCGGGGG - Intronic
1182988566 22:34744231-34744253 AGTGAGGGGTGGTGGGGGGCAGG - Intergenic
1183197946 22:36366377-36366399 AGTGAGAGGTGGGGGGTCGGGGG + Intronic
1183393945 22:37560992-37561014 AGTGGGGGGTGGGGGGCCCGGGG + Intronic
1183409848 22:37648428-37648450 AAAGAAGGGTGAGGGGCCGCGGG + Exonic
1183438667 22:37810164-37810186 AGTGAGTGGTGGGGGGTTGTGGG + Intronic
1183736667 22:39648379-39648401 AGAGGGGGCTGGGCGGCCGCAGG - Intronic
1183893758 22:40951295-40951317 AGTAAGGGGTGGGGTGCGGGAGG + Intergenic
1184151699 22:42643438-42643460 GGTGGGGGGTGGGGGGGCGGGGG - Intronic
1184545517 22:45164474-45164496 GGGGAGGGGTGCGGGGCCGGGGG + Intronic
1184601003 22:45543373-45543395 AGTGAGGGGTGGGCTGACTCAGG - Intronic
1184690491 22:46115177-46115199 ACTGAGGGGTGGGGGAGCGGTGG - Intergenic
1185300438 22:50077203-50077225 GGTGAGGGGTTGGCGGCCGCTGG - Intronic
1185398319 22:50603719-50603741 GGTGAGGGGTGGTGGGCCCGCGG + Exonic
1185416637 22:50714240-50714262 AGTGATGGGTGGGGTGCAGTGGG + Intergenic
949105477 3:197067-197089 TGTCAGGGGTGGGGGTCCGCTGG + Intronic
949514125 3:4792062-4792084 AGGGAGGGGCCGGGGGCCACAGG - Intronic
949544201 3:5058416-5058438 AGTGATGGGTGGAGGGGTGCAGG - Intergenic
949589173 3:5475362-5475384 AGGGAGGAGAGGGGGGCGGCAGG + Intergenic
950440521 3:13007715-13007737 AGTGAGGAGTGGGTGGCCTGCGG - Intronic
950584063 3:13880326-13880348 AGTGACGGGTGGGGGGCGAGCGG - Intergenic
950647265 3:14384576-14384598 GGTGGGGGGTGGGGGGAGGCAGG - Intergenic
951454275 3:22873196-22873218 AGAGAGGGGTTGGGGGACGAAGG - Intergenic
952079937 3:29745583-29745605 AGTGATGGGTGGGGGACAGGGGG + Intronic
952211251 3:31231279-31231301 AGTGGGGGGTGGGGGGGAGGCGG + Intergenic
953771388 3:45780687-45780709 AGAGAGGGGTGGGAGGCAGCAGG + Intronic
953902854 3:46853003-46853025 AGAGAGGGGTGGGAGGGGGCAGG - Intergenic
954766010 3:52917383-52917405 AGAGAGGGGTCGGGGGGTGCCGG + Intronic
954779083 3:53046097-53046119 AGCTGGGGGTGGGGGGGCGCGGG - Intronic
956074629 3:65491687-65491709 AGGGAAGGGAGGGGGGCTGCGGG - Intronic
956792624 3:72691990-72692012 ATTAAGGGGTGGGAGGGCGCAGG - Intergenic
959019763 3:101175789-101175811 TGTCAGGGGTGGGGGGCCAGGGG + Intergenic
961456691 3:127028117-127028139 ACTGGGGGGTGGGGGGCACCAGG - Intronic
962317575 3:134368367-134368389 AGTGGGGGGTGGGGGGTGGCAGG - Intronic
962634287 3:137314389-137314411 GTTGAGGGGTGGGGGGCTACGGG - Intergenic
964131958 3:153299258-153299280 AGTGTGCGGTGGGGGGCTGGTGG + Intergenic
964136122 3:153346661-153346683 ATTGTGGGGTGGGGGGCTGGAGG - Intergenic
967147464 3:186618193-186618215 AGTGAGGGCTGGGGGGAGGCAGG + Intronic
967290868 3:187918867-187918889 AGGGAGGAGTGGGGGGCAGTTGG + Intergenic
967850232 3:194077016-194077038 TGGGAGGGGTGGGGAGCAGCTGG - Intergenic
968518636 4:1025189-1025211 AGTAAGTGCTGGGGGGCTGCCGG - Exonic
968522399 4:1039901-1039923 AGTGAGGGGCTGGGGGCCTTGGG + Intergenic
968602844 4:1518486-1518508 GATGAGGGGTGAGGGGTCGCCGG + Intergenic
968628560 4:1638670-1638692 TCGGAGGGGTGGGGGGCGGCTGG + Intronic
968651521 4:1762040-1762062 GGTGAGGGGTGGAGGGTCGGGGG - Intergenic
968850308 4:3074066-3074088 AGGGAGGGGTGGGGCGCGGAGGG - Intergenic
969578665 4:8051156-8051178 AGGGCGGGGTGGGGGGTGGCTGG - Intronic
969660882 4:8526753-8526775 AGTGAGGGCAGAGGGGCCCCTGG - Intergenic
969675148 4:8610406-8610428 AGTGATGGGAGGGAGGCCCCAGG + Intronic
970109646 4:12623375-12623397 TGTCAGGGGTGGGGGGCAGTGGG + Intergenic
971770311 4:30886976-30886998 AGTGGGGGGTGGGGGGAGGGGGG + Intronic
972090039 4:35269995-35270017 GGTGTGGGGTGGGGGGCAGAAGG - Intergenic
972726089 4:41747278-41747300 GGTGTGGGGTGAGGGGCGGCTGG - Intronic
972959693 4:44437967-44437989 AGTGAGTGGTGGGAGGTAGCAGG - Intronic
973181776 4:47277371-47277393 AGTGAGGGGCTGGGGGAGGCGGG + Intronic
973608201 4:52608641-52608663 AGTGGGGGGTGGAGGGGTGCGGG - Intronic
976161118 4:82200807-82200829 ACTGAGGGGTGAGCGGCGGCGGG + Intergenic
976346192 4:84004389-84004411 ATTGAGGGGTGGGGGGAGGGGGG - Intergenic
977154201 4:93552778-93552800 ATTGGGGGGTGGGGGGCTGGGGG - Intronic
981033791 4:140151375-140151397 CGTGCGGGGTGGGGGGACGTGGG + Intronic
981519265 4:145644885-145644907 AGTGAGGGGTAGGGTGCTACTGG - Intronic
982770188 4:159390254-159390276 GGTGGGGGGTGGGGGGGCGGGGG - Intergenic
983533245 4:168832502-168832524 AGAGAGGGGCGGGGGGCCGTGGG - Intronic
983627227 4:169814250-169814272 AGTGAGGGCTGGTGGGGCACAGG - Intergenic
983646380 4:169996002-169996024 GGTGGGGGGTGGGGGGTGGCGGG - Intronic
983688393 4:170437646-170437668 ATTGGGGGGTGGGGGGCTGGGGG + Intergenic
983999527 4:174224208-174224230 AGTGAGGGTTGGGGGGAGGGTGG - Intergenic
984206453 4:176792743-176792765 AGTGAGAGGAGCCGGGCCGCGGG + Intergenic
985937406 5:3107481-3107503 AGTTGGGGGTGGGGGGCTGTCGG - Intergenic
986262496 5:6160561-6160583 AGGGAGGGATGGGGGTCTGCTGG - Intergenic
987391063 5:17375884-17375906 TGTCAGGGGTGGGGGGCTGGGGG - Intergenic
987771385 5:22309996-22310018 GTTGGGGGGTGGGGGGCTGCGGG + Intronic
988421869 5:31015559-31015581 AGTGGGGGGTGGGGGGGCGGGGG + Intergenic
988683213 5:33503206-33503228 AGGGAGGGGGAGGGGGCCCCAGG - Intergenic
989170898 5:38469622-38469644 GGAGAGGGGTATGGGGCCGCAGG + Intergenic
990277723 5:54215788-54215810 AGTCAGGGGTGGGGGGCTGGGGG + Intronic
990468869 5:56094887-56094909 GGTGCGGGGTGGGGGGGCGATGG + Intergenic
990499690 5:56383911-56383933 AGAGAGCGGGGCGGGGCCGCGGG - Intergenic
992603874 5:78435380-78435402 AATGAGGGGTTGGGGGCTGGAGG - Intronic
992910781 5:81394136-81394158 GGTGGGGTGTCGGGGGCCGCAGG - Exonic
993611288 5:90057606-90057628 AGTGAGTGGTGGGTGGCGGATGG - Intergenic
994778216 5:104062008-104062030 GGTGAGGGGTGGGGGGAGGCGGG - Intergenic
995696452 5:114883537-114883559 AGTGAGGGGGGGGGGGGGGAAGG + Intergenic
996373349 5:122775642-122775664 AGTGAGCGCTGAGGGGCCGAGGG + Intronic
996746067 5:126847011-126847033 AGTGAGGGGTAGGAGGACGTAGG - Intergenic
997069386 5:130602252-130602274 AATGAGGTGTGGGGGGCGGGGGG - Intergenic
997964497 5:138346778-138346800 AGAGAGGGGTGGGGGGCTACAGG - Exonic
999240529 5:150124887-150124909 AGTGGGGGGAGGGGGGCAGCTGG - Intronic
999360603 5:150982976-150982998 ACTGTGGGGTGGGGGGCGGCGGG + Intergenic
999444312 5:151627130-151627152 AGTGTGGGGTGGGGAGGTGCGGG - Intergenic
999644884 5:153707816-153707838 AGTGGGGGGTGGGGGGCGCGTGG + Intronic
999669781 5:153948578-153948600 ATTGTGGGGTGGGGGGAGGCGGG + Intergenic
999944061 5:156576069-156576091 ATTGTGGGGTGGGGGGCAGGGGG - Intronic
1000164950 5:158639303-158639325 AGTGAGGGGTGGGGGTGGGAAGG + Intergenic
1000531259 5:162423126-162423148 AGTGTGGGGTTGGGGGCGGGAGG - Intergenic
1001058403 5:168467979-168468001 AGAAAGGGATGGGGGGCTGCCGG - Intronic
1001097827 5:168789510-168789532 GGTGAGGGGAGGGGGGGCGCTGG - Intronic
1002082137 5:176743472-176743494 AGGGTCGGGTGGGGGGCGGCCGG + Intergenic
1002438633 5:179251476-179251498 TCTGTGGGGTGGGGGGCTGCTGG - Intronic
1003098263 6:3158104-3158126 GGAGAGGAGTGGGGGGCCGCGGG + Intergenic
1003513402 6:6800016-6800038 GGTGAGGGGTGGGGAGTCGGGGG + Intergenic
1003842365 6:10135094-10135116 ATTGTGGGGTGGGGGGCGGCGGG + Intronic
1005511767 6:26518004-26518026 AGTGGGGGGTGCGGGGTTGCGGG + Intergenic
1005912977 6:30326952-30326974 AGTGCGGGGCGCGGAGCCGCCGG - Exonic
1006122307 6:31814983-31815005 GGTGGGGGGTGGGGGGACCCCGG - Exonic
1006320683 6:33317667-33317689 AGTGAGGGGCGGGGGGGGCCCGG - Exonic
1006336035 6:33420860-33420882 AGTGGGGGGTGGGGGGATGGAGG + Intronic
1006516197 6:34546999-34547021 AAGGAGGGGTGGGGGGCTGCGGG - Intronic
1006670002 6:35724272-35724294 GGTGAAGGGTGAGGGGCAGCAGG + Intronic
1007737391 6:43990209-43990231 AGTGAGGGCATGGGGGCTGCAGG + Intergenic
1007772168 6:44200854-44200876 AGTGGGGGGTGGGGGGCAGTGGG + Intergenic
1007835666 6:44671833-44671855 GGGGAGGGGTGGGGGGCTGAGGG - Intergenic
1010203018 6:73299474-73299496 GGGGAGGGGTGGGGGGACGTTGG - Intronic
1011194045 6:84764191-84764213 AGAGAGGGGCGGGCGGGCGCGGG - Exonic
1011414761 6:87106572-87106594 AGTGAGTGGTGGAGGGCAGGTGG - Intergenic
1011421384 6:87176994-87177016 GGGGAGGAGTGGGGGGCCGGGGG - Intronic
1013860340 6:114628157-114628179 ATTGGGGGGTGGGGGGCTGCGGG - Intergenic
1015435180 6:133178068-133178090 GGTGAGGGGTGGGGGGCTAGAGG - Intergenic
1017544186 6:155433458-155433480 AGTGAGGGGTGGTGGCCCCAAGG - Intronic
1018312805 6:162528076-162528098 CGGGAGGGGTGCGGGGCGGCGGG + Intronic
1018978202 6:168581784-168581806 AGGGAGGGGAGGGGGGCTGCAGG - Intronic
1018990382 6:168669255-168669277 AGTGCGGGGGAGGGGGACGCAGG - Intronic
1019278202 7:187062-187084 AGCGAGTCGTGGGGGGCCCCTGG + Intergenic
1019324877 7:433127-433149 AGTGCGGGGTGGTGGGCTTCAGG - Intergenic
1019420451 7:948268-948290 AGGGAGGGGTGAGGGGCAGAGGG - Intronic
1019467314 7:1196624-1196646 AGGGGGGGGTGGGGGGACACAGG + Intergenic
1019481766 7:1270223-1270245 GCTGAGGGATGAGGGGCCGCTGG - Intergenic
1019529753 7:1497430-1497452 AGTGTGGGGTGCGGGGTGGCGGG + Intronic
1019641942 7:2107971-2107993 GGTGGGGGGTGGGGGGGTGCCGG - Intronic
1019775362 7:2909373-2909395 GCTGAGGGGTGAGGGGCAGCGGG - Intronic
1020097574 7:5377313-5377335 AGGGAGGGGTGGGAGGGGGCGGG - Intronic
1020428426 7:8095237-8095259 AGTGGGGGGTGGGGGGCTGGGGG + Intergenic
1021092775 7:16502440-16502462 AGCGAGGGGTGGAGAGCAGCGGG + Intronic
1021300471 7:18966413-18966435 AGTTAGGGGTCGGGAGCCGGTGG + Intronic
1022525378 7:31033801-31033823 AGTGAGGGATGGGGGCCAACTGG - Intergenic
1023461097 7:40398039-40398061 AGTGAGGTGTGGGGGTCAGAGGG + Intronic
1023990933 7:45127850-45127872 GGTGTGGGGTGGGGGGCAGGGGG - Intergenic
1024558898 7:50627469-50627491 TGTGAGGGGTGAGGTGCTGCGGG - Intronic
1025627186 7:63232998-63233020 AGGGAGGGCTGGGGGGCAGGTGG - Intergenic
1025654946 7:63510183-63510205 AGGGAGGGCTGGGGGGCAGGTGG + Intergenic
1026409071 7:70100573-70100595 ATTGTGGGGTGGGGGGCTGGGGG - Intronic
1027126411 7:75559710-75559732 AGTGAGCGGTGGGTGGGGGCGGG - Exonic
1027623539 7:80521556-80521578 CGTGGGGGGTGGGGGGCGGGGGG - Intronic
1029207074 7:98876094-98876116 TATGGGAGGTGGGGGGCCGCTGG + Intergenic
1029425069 7:100489696-100489718 CATCAGGGGTGGGGGGCAGCTGG + Intronic
1029650777 7:101890026-101890048 AGTGTGTGGTGGGGTGCCCCCGG + Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1030313570 7:108091993-108092015 AGTGGGGGGTTGGGGGCGGAGGG - Intronic
1030396083 7:108988502-108988524 AGGGAGGGGTGGGGGGAGGGGGG + Intergenic
1030504905 7:110408989-110409011 TGTGTGGGGTGGGGGGGCGGGGG + Intergenic
1032005364 7:128297983-128298005 ATTGAGGGGTGGGGGGAGGGGGG + Exonic
1032058047 7:128699254-128699276 GGTGGGGGGGGGGGGGCAGCAGG - Intergenic
1032446792 7:131991072-131991094 AGGGAGGGGTGGTGGGGAGCAGG + Intergenic
1034202463 7:149291013-149291035 AGTAAGGGGTGGGGTGTGGCAGG + Intronic
1034431479 7:151043388-151043410 AGTGTGGGGTGGGGGGTCAGAGG + Intronic
1034431554 7:151043699-151043721 AGTGCGGGGTGGGGGGTCAGAGG + Intronic
1034563478 7:151896104-151896126 AGTGGGGGGTGGGGGGGTGAGGG - Intergenic
1034676949 7:152898716-152898738 AGCCGGGGGTGGGGGGCAGCTGG + Intergenic
1035281174 7:157779436-157779458 AGTGTGTGGTGAGGGGCAGCGGG - Intronic
1035299655 7:157888541-157888563 GTTGGGGGGTGGGGGGGCGCAGG - Intronic
1035529869 8:342768-342790 GGTGAGGGGTGGGTGGGGGCGGG + Intergenic
1035683778 8:1508310-1508332 GGTGAGGGGTGGGGGGTGGTGGG - Intronic
1035683812 8:1508385-1508407 GGTGAGGGGTGGGGGGGTGGGGG - Intronic
1035683858 8:1508482-1508504 GGTGAGGGGTGGGGGGTGGTGGG - Intronic
1036139802 8:6196983-6197005 ATTGTGGGGTGGGGGGAGGCAGG + Intergenic
1036555523 8:9856393-9856415 AGTGGGGGGTGGGGGGAAGTGGG - Intergenic
1039266285 8:35827613-35827635 AGTCGGGGATGGGGGGCGGCGGG - Intergenic
1039456490 8:37710871-37710893 GGAGAGGGGTCGGGGGCGGCAGG - Intergenic
1039621122 8:38997413-38997435 GGCGAGGGATGGGGGGACGCTGG - Intronic
1039881943 8:41630595-41630617 AATGTGGGGTGGGGGGCCGGGGG - Intergenic
1040288232 8:46111238-46111260 TGTGAGGGGTGTGGGGACTCAGG - Intergenic
1040567797 8:48582655-48582677 AGCCAGGGGTGGGAGGCCGGTGG + Intergenic
1041245655 8:55885948-55885970 AGTGAGGGGTGGGGCGGGGTGGG + Intronic
1041792129 8:61708872-61708894 GTTGAGGGGTGGGGGGCTGGGGG - Intronic
1042039898 8:64579913-64579935 AGTGGGGGGTGGGGTGCGGTGGG + Intergenic
1042601972 8:70507680-70507702 ATTGTGGGGTGGGGGGCGGGGGG - Intergenic
1042662147 8:71166422-71166444 AGTGAGGAGTGGGGAGCCATGGG - Intergenic
1043752093 8:83950402-83950424 ATTGTGGGGTGGGGGGACGGGGG + Intergenic
1044325497 8:90853174-90853196 TGTGAGGGGTGGAGTGCAGCGGG + Intronic
1044616749 8:94150290-94150312 AGAGTGGGGTGGGGGACGGCAGG + Intronic
1044683805 8:94807980-94808002 AGTGAGGGGTGGGGGGAGGTGGG - Intergenic
1045296118 8:100872896-100872918 GGGGTGGGGTGGGAGGCCGCAGG + Intergenic
1048799951 8:138186157-138186179 AGCGAGAGGTGAGGGGCTGCAGG - Intronic
1048996293 8:139795554-139795576 AGGGAGGGGGTGGGGGCGGCGGG + Intronic
1049364914 8:142232474-142232496 AATGAGGGGAGGGCGGCCGCAGG + Intronic
1049473558 8:142786889-142786911 GGTGGGGGGTGGGGGGCGGGGGG - Intergenic
1049482921 8:142835277-142835299 TGTAAGGGGAGGGGGGCCCCAGG - Intronic
1049641650 8:143718730-143718752 AGTCGGGGGTGGGGGGCTGGGGG - Intronic
1049780335 8:144425922-144425944 ACTGAGGGGTGGGAGGACGCAGG - Intronic
1050371323 9:4924294-4924316 AGTGTGGGATGAGGGGCCGCAGG - Intergenic
1050590517 9:7155502-7155524 GTTGAGGGGTGGGGGGATGCGGG - Intergenic
1050952862 9:11618856-11618878 AATGAGGGCTGGGAGGCCGCAGG - Intergenic
1051621036 9:19049582-19049604 AGGGAGGGGTCGGGGGCTGCCGG - Exonic
1052806432 9:33017923-33017945 TGGGAGGGGGGGGGGGGCGCTGG - Intronic
1053000936 9:34577119-34577141 AGTGATGGGGGCGGGGCTGCAGG - Intronic
1054688907 9:68306866-68306888 AGTGTGGGGGGGGGGGGCGGGGG - Intergenic
1054906900 9:70420238-70420260 AGGGAGGCGGCGGGGGCCGCGGG - Intergenic
1055032550 9:71785076-71785098 AGTCAGGGGTGGGGGGCAAGGGG + Intronic
1055376038 9:75649007-75649029 AGTGAGGGGTGGAAGGCAGTGGG - Intergenic
1056190313 9:84178287-84178309 GTTGAGGGGTGGGGGGCTGGGGG - Intergenic
1056190962 9:84183309-84183331 GTTGAGGGGTGGGGGGCTGGGGG + Intergenic
1056489699 9:87093330-87093352 GGGGAGGGGTGGGTGGCAGCAGG + Intergenic
1056764390 9:89435983-89436005 ATTTGGGGGTGGGGGGCAGCGGG - Intronic
1057550517 9:96048438-96048460 AAGGAGGGGAGGGAGGCCGCTGG + Intergenic
1057914591 9:99046097-99046119 AGTTAGTGGTGGGGGTCAGCAGG + Intronic
1057966483 9:99508975-99508997 ATTGAGGGGTAGGGGGCTGGGGG - Intergenic
1059458603 9:114415377-114415399 AGTGAGGGGTAGAGGGGCGAGGG - Intronic
1059965127 9:119606251-119606273 TGTCAGGGGTGGGGGGCTGGGGG - Intergenic
1060104975 9:120868024-120868046 AGGCAGGGGTAGGGGGCCGGGGG - Intronic
1060882509 9:127128020-127128042 AGAGGGGGGTGGGGGGCTGGGGG - Intronic
1060936939 9:127521538-127521560 AGTGGGGGGTGGGGGGAAGGAGG - Intronic
1060970537 9:127735076-127735098 AGCGAGGGGCGGGCGGACGCGGG - Intronic
1061196982 9:129111791-129111813 GGTGGGTGGTGGGGCGCCGCTGG + Intronic
1061261337 9:129482487-129482509 CGTGGGGGGTCGGGGGCCGCGGG + Intergenic
1061274595 9:129562129-129562151 AGGCAGGGGTGAGGGGCAGCTGG + Intergenic
1061678568 9:132231598-132231620 AGAGAGGGTTGGGGGGTTGCCGG - Intronic
1061743165 9:132722107-132722129 TGTGATGAGTGGGGGGCTGCGGG + Intergenic
1061881685 9:133572169-133572191 GGTGGGGGGTGGGGGGTGGCGGG - Intronic
1061920831 9:133781482-133781504 GGTCAGGGGTGGGGGGCAGCTGG + Intronic
1061951161 9:133936628-133936650 AGCGACCGGTGGGGGGCGGCAGG + Intronic
1062049197 9:134438460-134438482 AGGCAGGGGTGGAGGGCGGCGGG - Intronic
1062131600 9:134897227-134897249 AGGGATGGGTGGGGGGCCTGGGG - Intergenic
1062279958 9:135747411-135747433 AGTGAGGGGAGGAGGGCCTTGGG + Intronic
1062678866 9:137765634-137765656 AGTGAGGGGAGTGGGGCTGGGGG - Intronic
1062728716 9:138096409-138096431 GGAGAGTGGTGGGGGGCGGCGGG + Intronic
1203794555 EBV:169690-169712 CGGGGGGGCTGGGGGGCCGCGGG - Intergenic
1203794756 EBV:170228-170250 CGGGGGGGCTGGGGGGCCGCGGG - Intergenic
1203794947 EBV:170751-170773 CGGGGGGGCTGGGGGGCCGCGGG - Intergenic
1203795148 EBV:171289-171311 CGGGGGGGCTGGGGGGCCGCGGG - Intergenic
1185504036 X:619182-619204 AGTGCGGGGGAGGGGGCCCCGGG - Intergenic
1186512678 X:10142309-10142331 AGGGCGGGGTGGGGGGAGGCGGG - Exonic
1186660888 X:11666108-11666130 AGGGCGGGGTGGGGGGGCGCGGG - Intergenic
1189407193 X:40735610-40735632 AGCGAGGGGCGGGGGGAGGCGGG + Intronic
1191129870 X:56995851-56995873 AATGGAGGGTGGGGGGACGCGGG - Intergenic
1192538047 X:71945474-71945496 GTTGCGGGGTGGGGGGACGCAGG - Intergenic
1193163171 X:78252358-78252380 AGTGGGGGGTGGGGAGCAGGGGG - Intergenic
1193321677 X:80130267-80130289 ACTGAGGGGTGGGGGGCTGGGGG - Intergenic
1194605758 X:95976071-95976093 GGTGAGGGGAGGGGTGCCACTGG - Intergenic
1194996951 X:100601672-100601694 ATGGTGGGGTGGGGGGCCGAGGG - Intergenic
1195322143 X:103728770-103728792 AGTGGGAGGTGGGGGGCGGGGGG - Intergenic
1196734795 X:118974258-118974280 TGGGAGGAGTGGGGGGCCGCTGG + Intergenic
1196871352 X:120116091-120116113 AGTGTGGGGTGGGGTGCAGGTGG + Intergenic
1197264072 X:124347352-124347374 AGTGGGGGGTGGGGAGGGGCAGG + Intronic
1198447200 X:136729059-136729081 TGTGGGGGGTGGGGGGCGGTGGG - Intronic
1198655742 X:138911461-138911483 AGAGAGTGGTGGGGGGAGGCAGG + Intronic
1198956584 X:142137924-142137946 AGGCAGGGGTGGGGGGCGGTGGG + Intergenic
1200092534 X:153642632-153642654 GGTGGGGGGTGGGGGTCCCCGGG - Intronic
1200326802 X:155249076-155249098 AGAGCGGGGTGGGGGGGGGCAGG - Intergenic