ID: 1103564333

View in Genome Browser
Species Human (GRCh38)
Location 12:121807949-121807971
Sequence TTTGGGGGAGTCTCAGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103564332_1103564333 -9 Left 1103564332 12:121807935-121807957 CCTCTGGGTTTGGGTTTGGGGGA 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1103564333 12:121807949-121807971 TTTGGGGGAGTCTCAGCCCCAGG 0: 1
1: 1
2: 1
3: 18
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103564333 Original CRISPR TTTGGGGGAGTCTCAGCCCC AGG Intronic
900578384 1:3395398-3395420 CTTGGAGGAGCCTCAGCCCCAGG + Intronic
900660042 1:3777671-3777693 TCTTGGGGAGGCCCAGCCCCAGG - Intergenic
901496931 1:9627685-9627707 TGTGCAGGAGACTCAGCCCCTGG - Intergenic
902820145 1:18938682-18938704 GGTGGGGGAGTCTCAGTCCCTGG - Intronic
903036775 1:20498232-20498254 TATGGGACAGTCTCAGTCCCCGG + Intergenic
903815998 1:26064976-26064998 TTTGGGAGAGACACAGCTCCAGG - Intronic
905718825 1:40177947-40177969 TTTCAGGGAGTCTCAGGCCAAGG + Intronic
906572452 1:46855310-46855332 TTTGGGTGAGTCTCAACTCATGG + Intergenic
907038509 1:51236942-51236964 TTCGGGGCCGTCTCTGCCCCTGG + Intronic
913332802 1:117681514-117681536 TGAGGAGGAGTCTCAGACCCTGG + Intergenic
914262538 1:146011220-146011242 AGTGGGGCAATCTCAGCCCCAGG + Intergenic
915935357 1:160087444-160087466 TCAGGGGGAATCTCAGCTCCAGG - Intronic
919821009 1:201471972-201471994 TCTGGGAGAGGCTCAGGCCCAGG + Intergenic
921441554 1:215192343-215192365 TTTAGTGGAGTCTAAGCCCAGGG - Intronic
1068866859 10:61903483-61903505 TTTTGGGGAGTCTGTGCCCACGG + Intronic
1070785206 10:79158650-79158672 TCTGGGTCAGACTCAGCCCCGGG + Intronic
1073782635 10:106856369-106856391 TTTTTGGGAGTCTTTGCCCCTGG + Intronic
1075336079 10:121609646-121609668 TTTGGGGCAGCCTCCGCCTCTGG + Intergenic
1076128385 10:127993907-127993929 GTTGGGGGAGTCTCAGTTGCTGG + Intronic
1077395125 11:2316798-2316820 TTTGGGGGTGGCTGAGCACCAGG + Intronic
1077484716 11:2833431-2833453 TGTGAGGGAGTCTCAGCCTTAGG + Intronic
1077786563 11:5390382-5390404 CTAGGGGGAGTTTTAGCCCCAGG - Intronic
1078088727 11:8250851-8250873 ATTGGGGTACTCTCAGCCCTAGG + Intronic
1080223875 11:29937705-29937727 TTTGGGGCAGTGCCAGCCTCTGG + Intergenic
1083259433 11:61515207-61515229 CTGAGGGGAGGCTCAGCCCCGGG + Intergenic
1083303872 11:61752937-61752959 GCTGGGGGACTCCCAGCCCCGGG - Intronic
1084266550 11:68008190-68008212 TTGGGGGGAGCCTCACTCCCAGG + Intergenic
1084363593 11:68684342-68684364 TTTGGGGGAGTCTCTCCCGCGGG + Intronic
1084694467 11:70745419-70745441 TTTGAGGGACTGTGAGCCCCAGG - Intronic
1085237490 11:75026259-75026281 TTTGTGGGAGTGACAGGCCCTGG + Intergenic
1088079855 11:105898404-105898426 TTTGGAGGAGTCTCAGATCCTGG - Exonic
1091662650 12:2396119-2396141 TTTTGTACAGTCTCAGCCCCTGG + Intronic
1094817759 12:34204242-34204264 TTTGTGGGACCCTCTGCCCCTGG - Intergenic
1095671889 12:44871208-44871230 GTTAGGGGAGTCTCAGGCTCAGG - Intronic
1095947736 12:47763430-47763452 ATTGTGGGAGGCTCAGCCACAGG - Intronic
1096560632 12:52433656-52433678 CTTGGAAGGGTCTCAGCCCCTGG + Intronic
1100519267 12:95357733-95357755 CTCGAGGGAGTCTCAGCTCCTGG + Intergenic
1100572749 12:95858556-95858578 TTTGGGGGCGCCTCTGCCGCAGG - Intergenic
1103564333 12:121807949-121807971 TTTGGGGGAGTCTCAGCCCCAGG + Intronic
1104081723 12:125435405-125435427 TTGGGGGCCGTCCCAGCCCCGGG - Intronic
1106243290 13:27926857-27926879 TTTGGATGAGTCTCTGTCCCCGG + Intergenic
1113142912 13:107174772-107174794 GCTGGGGGAGTCTCAGCTTCAGG + Intronic
1113810314 13:113137651-113137673 TCTGGGAGAGTCTCTGTCCCAGG + Intronic
1114283042 14:21212242-21212264 TTAGGGGGAGGCTAAGACCCTGG - Intronic
1117260016 14:54022690-54022712 TTTGGGTGAGCCTCTGCCCCTGG + Intergenic
1118753206 14:68821202-68821224 CTTGGGGGAATTCCAGCCCCTGG + Intergenic
1120203502 14:81563340-81563362 TTTGGAGGATTTTCAGCCTCAGG + Intergenic
1121093871 14:91202348-91202370 TCTGGGTGGGTCTCAGGCCCTGG + Intronic
1123412549 15:20072646-20072668 TGTGGGGGAGCCTCAGGCCACGG - Intergenic
1123521891 15:21079759-21079781 TGTGGGGGAGCCTCAGGCCACGG - Intergenic
1125217020 15:37286785-37286807 TTTGGGGGATTCTCAGACAAAGG - Intergenic
1129879197 15:78995997-78996019 TCTGGGGCCCTCTCAGCCCCTGG + Intronic
1130904914 15:88233527-88233549 CTTGGGGGAGTCTCTGCAGCTGG - Intronic
1131265193 15:90911469-90911491 TTCGGAGGAGGGTCAGCCCCTGG + Exonic
1135233023 16:20727501-20727523 TTTGGGGGCCTTTCTGCCCCAGG + Intronic
1137735960 16:50723390-50723412 TTTGGGGGATTCTCTGCTCTGGG + Intronic
1138416840 16:56876490-56876512 TTGGGTGGAGTCTCCACCCCAGG - Intronic
1141657858 16:85425564-85425586 TTTGGCGGAGACTGAGCCGCAGG + Intergenic
1142341647 16:89526981-89527003 GATGGCGAAGTCTCAGCCCCTGG + Intronic
1142804976 17:2366744-2366766 CTTGGTGGAGTTTCAGCCTCTGG - Intronic
1143453242 17:7049359-7049381 TTTGGAGTAGTATCAGCCTCTGG - Intergenic
1143520002 17:7439594-7439616 TTTGGGGGTGTCTCCTCCCGGGG + Exonic
1145077419 17:19867521-19867543 TCTGGGGCAGCCGCAGCCCCGGG + Exonic
1146108236 17:30062678-30062700 TTTGGTGGTGGCTTAGCCCCAGG - Intronic
1147475092 17:40703443-40703465 TTTGGGGGAGCTTCAGGCTCTGG - Exonic
1147562693 17:41518769-41518791 TTTGGGGGTGGCTCAACCCGAGG - Exonic
1151670651 17:75570124-75570146 GTTGGTGCAGTGTCAGCCCCCGG + Exonic
1151952503 17:77362983-77363005 TGTGGGGAAGTGTGAGCCCCTGG + Intronic
1152604683 17:81283153-81283175 GGTGGGGGAGCCTCAGACCCGGG - Intronic
1152698535 17:81807881-81807903 GCTGTGGGAGTCACAGCCCCTGG - Intronic
1152912462 17:83013217-83013239 TTTGGGGGTGTGTCAGGTCCTGG - Intronic
1153900404 18:9613867-9613889 TTTGGGTGTGTTTCTGCCCCTGG - Intronic
1155933648 18:31731959-31731981 TTTGGGAGAGTCTTAGACTCCGG + Intergenic
1156778952 18:40826765-40826787 TTTGGAGGAGTCTGAAGCCCTGG + Intergenic
1157076896 18:44476347-44476369 TTTTGAGGACTCTGAGCCCCAGG - Intergenic
1158772182 18:60532459-60532481 TTTGGGTGAGCCTCAGCTCATGG - Intergenic
1160571215 18:79818806-79818828 TTTAGGGGAGACTCATTCCCAGG + Intergenic
1160575061 18:79848601-79848623 TGTGTGCGAGTCTCAGCCCCGGG - Intergenic
1160858050 19:1226249-1226271 TCTGCGGGAGGCTCAGCCCCGGG + Intronic
1161910833 19:7192629-7192651 TGTGAGGGAGTGACAGCCCCCGG - Intronic
1162924969 19:13926378-13926400 TTCGGGGGTGTCTCAGCTCCTGG - Intronic
1163091756 19:15024835-15024857 TATGTGGGAGTCTGAGCCCCAGG - Intergenic
1166307163 19:41941255-41941277 TTTGGGGGAATCTCAGTCTAGGG - Intergenic
1166447298 19:42869292-42869314 TCAGTGGGAGTCACAGCCCCTGG + Intronic
1166451765 19:42908108-42908130 TCAGTGGGAGTCACAGCCCCTGG + Intronic
1166464004 19:43016303-43016325 TCAGTGGGAGTCACAGCCCCTGG + Intronic
1166481288 19:43176406-43176428 TCAGTGGGAGTCACAGCCCCTGG + Intronic
1166490878 19:43259393-43259415 TCAGTGGGAGTCACAGCCCCTGG + Intronic
1167045003 19:47044681-47044703 TTTTGGGGTGTCACAGCCCTGGG - Intronic
1167055928 19:47111897-47111919 GTTGGGGGTCTCCCAGCCCCCGG - Intronic
1167334264 19:48874866-48874888 TTTAGGGGAGTCTCAGGGTCCGG - Exonic
1167468086 19:49660748-49660770 TGTGGGGGAGTCATGGCCCCAGG - Exonic
1167497882 19:49830087-49830109 GTTGGGGGTGGCTCAGCCCCAGG + Exonic
1167617374 19:50542919-50542941 TTTGGGGGACTCTAAGTCCACGG - Intronic
1167651905 19:50735953-50735975 AGTGGGGCACTCTCAGCCCCCGG - Intergenic
929544599 2:42847483-42847505 TTTGGGACAGGCTCAGGCCCTGG + Intergenic
930353764 2:50291531-50291553 TTTCAGGGAGTCTCAGTTCCAGG - Intronic
930891916 2:56400218-56400240 TTTTGGTGAGCCTGAGCCCCTGG + Intergenic
932135704 2:69226781-69226803 TTTGGGGGGATTTCAGCACCTGG - Intronic
932589840 2:73058760-73058782 TTTGGAAAACTCTCAGCCCCAGG - Intronic
932721296 2:74140625-74140647 TTTGGGGGAGTGTCACCTCACGG - Intronic
938305142 2:130248171-130248193 CATGGGGGAGTCTGAGCCCTAGG + Intergenic
938438241 2:131300267-131300289 TTCGGGGTGGCCTCAGCCCCAGG + Intronic
938448872 2:131399036-131399058 CATGGGGGAGTCTGAGCCCTAGG - Intergenic
940132027 2:150392648-150392670 TTTAGGGGTGTCTCAGCCAGAGG + Intergenic
940346615 2:152635704-152635726 TGTGGGGGAGTGCCTGCCCCGGG + Intronic
941619490 2:167760031-167760053 ATTGAGGGAGTCTCAACCCAAGG + Intergenic
943363007 2:186944355-186944377 TTTGGGGGAGTCTTGGGCACAGG - Intergenic
1171967706 20:31543045-31543067 TTTGGGGGAGTCTGAAGCCAGGG - Intronic
1172502669 20:35437913-35437935 GTTTGGGGAGTCTCATCCTCTGG + Exonic
1172759083 20:37309418-37309440 TCTGGGGGACTCTCAGTCACTGG - Intronic
1173334072 20:42098956-42098978 TTTGGGAGAATCTCGGCCTCAGG - Intronic
1176169526 20:63690653-63690675 TTGGGGGGAGTCTCAGCCTCGGG - Intronic
1179013123 21:37571963-37571985 TTTCGGGGAGTTTCACTCCCTGG + Intergenic
1179111293 21:38447792-38447814 CTTGGTCGAGTCTCAGGCCCAGG - Intronic
1179885687 21:44313371-44313393 TTTGGGGGCGTCACACCCCAGGG - Intronic
1180728118 22:17961390-17961412 ACTGGGGGAGCGTCAGCCCCGGG + Intronic
1181431523 22:22884626-22884648 TCTGGGGGAGTCTGAGGCACAGG - Intronic
1184743730 22:46444085-46444107 TCTGGGAGAGTCTGAGCCCCGGG - Intronic
952538111 3:34335509-34335531 TTTGGGGGTGCCTGAACCCCAGG - Intergenic
952902732 3:38120730-38120752 TCTAGGGGAGACTGAGCCCCAGG - Intronic
952927170 3:38328755-38328777 TCTAGGGGAGACTGAGCCCCAGG + Intergenic
952955137 3:38552186-38552208 TTTGAGGGCGTCACTGCCCCTGG + Intronic
953893920 3:46779288-46779310 TCTGGGGCACCCTCAGCCCCTGG - Intronic
954135096 3:48578783-48578805 TTTGGGAGGGTCTCAGTCCCTGG - Intronic
957532357 3:81456529-81456551 TTTTGGGGACTCTCAGGCCTTGG + Intergenic
959392295 3:105791268-105791290 TTTGGCGGAGTCTCAGCCCCTGG + Intronic
960056567 3:113280070-113280092 TTCGGGGGAGTCTAATCCCCAGG - Intronic
961645063 3:128388487-128388509 TTAGGTGGGGTCTGAGCCCCCGG + Intronic
962628293 3:137249441-137249463 TTTGTGGGAGTCTCAGATTCAGG + Intergenic
965748935 3:171956759-171956781 ATTTGGGGAGGCTCAGACCCTGG - Intergenic
967904720 3:194490325-194490347 TTTTGGGGAGGCCTAGCCCCTGG - Intronic
976246795 4:83012774-83012796 CTTTGGTGAGTGTCAGCCCCCGG - Intronic
980510135 4:133774231-133774253 TCTAGGTGAGTTTCAGCCCCAGG + Intergenic
981169017 4:141599484-141599506 TAGGTGGGAGTCTTAGCCCCTGG + Intergenic
981550015 4:145934573-145934595 CTGGGGTGAGCCTCAGCCCCTGG - Intronic
993661665 5:90645184-90645206 TGTGGTGCAGTCTCAGCACCGGG + Intronic
994821016 5:104651264-104651286 TTTGGGGGAGTCTGGGCACAGGG + Intergenic
997239370 5:132295303-132295325 GTTGGGGGAAGCGCAGCCCCAGG + Intronic
997517758 5:134503106-134503128 TTATGGGGAATCTGAGCCCCAGG - Intergenic
998160476 5:139810161-139810183 TTTGGGAGAGTCTCATTTCCAGG - Intronic
998924888 5:147112026-147112048 TTTGGGGAAGTCACACCCCTGGG + Intergenic
1004716335 6:18219819-18219841 TGTGGTGGAAGCTCAGCCCCTGG + Intronic
1006150184 6:31982915-31982937 GCGGGGTGAGTCTCAGCCCCAGG + Exonic
1006156485 6:32015653-32015675 GCGGGGTGAGTCTCAGCCCCAGG + Exonic
1010189181 6:73176910-73176932 TTTGTGGAAGTCTCACCCCAGGG + Intronic
1013864022 6:114673083-114673105 TTTTGGTGAGTCTTTGCCCCTGG + Intergenic
1016434510 6:144022055-144022077 TTTTGGTGATTCTCAGCCTCTGG - Intronic
1016801836 6:148176746-148176768 TTTGTGGGAGTTTCACCCTCAGG - Intergenic
1017260874 6:152385154-152385176 TCTGGGGGAGTTTCAGACTCTGG - Intronic
1017810683 6:157981675-157981697 CTGCGGGGAGCCTCAGCCCCGGG + Intergenic
1018719744 6:166563470-166563492 TCTGGGGGAGCCGCAGCCCCTGG - Intronic
1018831784 6:167448905-167448927 TCTGGGGGACTCTGAGCCCCCGG - Intergenic
1019895233 7:3977354-3977376 TGTGTGGCAGCCTCAGCCCCGGG - Intronic
1019895247 7:3977405-3977427 TGTGTGGCAGCCTCAGCCCCGGG - Intronic
1019933152 7:4236819-4236841 TTGGGGGGTGTCCCAGCACCAGG + Intronic
1021845970 7:24762895-24762917 GCTGGGGGAGGCTCAGCTCCAGG + Intergenic
1023177533 7:37448431-37448453 GTTGGGGAAGTCTGAGCTCCGGG - Intronic
1023515447 7:40997033-40997055 CTTGGGGCAGGCTCAGCCTCAGG - Intergenic
1025173932 7:56787398-56787420 TTTGGGGCGGGCTCAGACCCAGG - Intergenic
1029596040 7:101538081-101538103 TTTGGAGGAGCGTCAGGCCCTGG - Intronic
1032429929 7:131852383-131852405 TTTGGGGGAATCTCAGTCCAAGG - Intergenic
1034880966 7:154762286-154762308 CTTTGGGGAGTCTCACGCCCTGG + Intronic
1035378673 7:158424629-158424651 TCTGCGGGCGTCTCAGTCCCCGG - Intronic
1038186307 8:25278146-25278168 CTGGGTGGAGTCACAGCCCCAGG + Intronic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1042132725 8:65604497-65604519 TTTGTGGGACTCTCATCCTCAGG + Exonic
1042166109 8:65947752-65947774 TGTGGGGGAGTTTCAATCCCAGG - Intergenic
1048051403 8:130820470-130820492 TTGGGGAGATTCTCACCCCCTGG - Intronic
1048522463 8:135169490-135169512 TTGGAGGGAGGATCAGCCCCAGG + Intergenic
1049353013 8:142174350-142174372 ATTGTGGGAGTCGCAGCCACTGG - Intergenic
1049393016 8:142381708-142381730 TCAGTGGGAGTGTCAGCCCCAGG + Intronic
1049612254 8:143561115-143561137 GTTGGGGGTGTCTCGGGCCCAGG + Intronic
1050524234 9:6531588-6531610 TTTGGGGCAGTCACATGCCCAGG + Intergenic
1051244266 9:15093259-15093281 TGTGGGGGTGTCTCAGCCTATGG - Intergenic
1051331269 9:16027070-16027092 TTTGGTGGTTTCTCAGCCCAAGG + Intronic
1051750928 9:20340310-20340332 TTTGGGACAGGCTCAGCCCGTGG - Intergenic
1052128504 9:24809945-24809967 AATGTGGAAGTCTCAGCCCCTGG + Intergenic
1052766363 9:32645132-32645154 TTTTCTGGTGTCTCAGCCCCAGG - Intergenic
1058651345 9:107177907-107177929 TTCAGGGGAGTCTCGTCCCCAGG + Intergenic
1059852627 9:118361538-118361560 TTTGGGGGACTCTCAGCCTTCGG - Intergenic
1060659942 9:125399451-125399473 TCTGGGGCAGTCTCTGTCCCAGG + Intergenic
1061855660 9:133440700-133440722 TTTGTGGGACCCTAAGCCCCTGG - Intronic
1061872407 9:133527974-133527996 CTTGGGGGTGTCGCTGCCCCAGG + Intronic
1061895323 9:133643978-133644000 TTGGGGGAAGGCTCAGCCCTAGG + Intronic
1186676478 X:11822617-11822639 CCTGGTGGAGTCTCAGCCTCAGG - Intergenic
1186937872 X:14471056-14471078 TTTGGGGGGGTCTCAGCTGATGG - Intergenic
1188736027 X:33717487-33717509 TTTTGGGGGGTCTTAGGCCCAGG + Intergenic
1190249649 X:48712617-48712639 GTTGAGGGAGTCTCAGTCCCAGG - Intergenic
1196910764 X:120482248-120482270 TTTGGGGCAGTTTGAGGCCCTGG + Intergenic