ID: 1103566621

View in Genome Browser
Species Human (GRCh38)
Location 12:121819381-121819403
Sequence CTGGATGGGGGACACAGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103566621_1103566628 7 Left 1103566621 12:121819381-121819403 CCTCGTCTGTGTCCCCCATCCAG 0: 1
1: 0
2: 3
3: 27
4: 232
Right 1103566628 12:121819411-121819433 AGTGAGCATTGTAACCTCCAAGG 0: 1
1: 0
2: 1
3: 16
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103566621 Original CRISPR CTGGATGGGGGACACAGACG AGG (reversed) Intronic
900095022 1:936702-936724 ATGGATGGGGGACACAGATGGGG - Intronic
900125697 1:1068131-1068153 CTGGACAGGGGTCACTGACGTGG + Intergenic
900168957 1:1257061-1257083 CAGGATGGTGGAGACAGACCAGG + Exonic
900551749 1:3259877-3259899 CTGGATGAGGGACACACAGACGG - Intronic
900926602 1:5710015-5710037 CTGAAAAGGGGACACAGAGGGGG - Intergenic
901331219 1:8410216-8410238 CTGGCTGGGGGACACGGCTGGGG + Intronic
903288066 1:22289479-22289501 CTGGATGGGGGTGACGGAGGGGG - Intergenic
904401403 1:30259025-30259047 CTGGCAGGGGGACACAGACACGG + Intergenic
904603357 1:31685590-31685612 CTGGACGGGGGATGCAGGCGGGG - Intronic
904747074 1:32717935-32717957 CTGGGTTGGGGACACTGACGGGG - Intergenic
905008416 1:34729798-34729820 GTGGAAGGAGGACCCAGACGTGG - Intronic
908459713 1:64337666-64337688 CTGGAAGGTGGAAACAGATGGGG - Intergenic
910930551 1:92439067-92439089 CTGGATGGGAGTCACAGACTAGG + Intergenic
912718792 1:112002610-112002632 CTGATTGGGGGACACAAAGGGGG - Intergenic
915249042 1:154575739-154575761 CTGGATGGAGGAGACGGAGGAGG - Intronic
917254861 1:173103594-173103616 CTGGATGGGGAAGTCAGAAGGGG + Intergenic
918001505 1:180502003-180502025 GTGGATGGGGGAGAAAGACACGG - Intronic
919799982 1:201348167-201348189 TGGGGTGGGAGACACAGACGGGG + Intergenic
921110838 1:212035304-212035326 CTGAATGGGTGAAACAGGCGTGG - Intronic
922160429 1:223075666-223075688 CTGGGTGGGGGCCACAGAACTGG + Intergenic
922811081 1:228416171-228416193 CTGGACGTGGGACAGAGCCGGGG - Intronic
923017253 1:230136518-230136540 CTGGATGGGGGGCAGTGAGGGGG - Intronic
923140881 1:231161260-231161282 CTGGGTGGGGGAGGCAGAGGTGG - Intergenic
923250825 1:232178378-232178400 CTGGATGGGGGCCACAGAACTGG - Intergenic
1063058799 10:2529436-2529458 CTGAATGAGGGGCACAGAGGTGG - Intergenic
1067087370 10:43250029-43250051 CTCGGTGGGAGACACAGAGGTGG - Intronic
1068019761 10:51566730-51566752 CTGGATGGAGGACCCACAGGAGG + Intronic
1068962125 10:62877459-62877481 CTGGAGAGGGGAAACAGAAGGGG + Intronic
1069465677 10:68636712-68636734 CTGGATGGGAGCCACAGCAGAGG - Intronic
1069806495 10:71128490-71128512 CTGGATGGGGGCCACAGGACTGG - Intergenic
1070790895 10:79188678-79188700 CTGGAGGAGAGACACAGAAGAGG - Intronic
1070849924 10:79555401-79555423 CTGGAGGTGGGACACATACGTGG + Intergenic
1071292572 10:84198108-84198130 CTGGGTGGGGGAAGCAGATGGGG - Intronic
1072023070 10:91424134-91424156 CTGGATGGTTGCCACAGTCGAGG + Intronic
1072895139 10:99360080-99360102 CTGGATGGGGGCCTCAGGCAGGG - Intronic
1073893329 10:108124694-108124716 GTGGAGGGGGCACACAGAGGAGG + Intergenic
1074710742 10:116175524-116175546 CTGGATGGGGTTCCCAGGCGAGG - Intronic
1075344006 10:121668965-121668987 TTGGATGTGGGACCCAGATGGGG + Intergenic
1076859040 10:133131511-133131533 CAGGATCCAGGACACAGACGGGG - Exonic
1077555391 11:3223618-3223640 CTGGCTGGGGGCCACTGAAGAGG + Intergenic
1078210220 11:9264788-9264810 CTGGAGGGGGGAAACGGATGAGG - Intronic
1078525242 11:12095896-12095918 CTGGAAGGGGCACACAGTGGGGG - Intronic
1079401153 11:20107491-20107513 CTGGATGGTGGCCACAGAGAAGG - Intronic
1081994183 11:47352938-47352960 CTGTAAGAGGGACACACACGGGG - Intergenic
1083559082 11:63657489-63657511 CTGTATGGGTGGCACAGACCTGG - Intronic
1084019725 11:66410260-66410282 CGGGATGGGGGACCCAGAGGTGG + Intergenic
1084656974 11:70525418-70525440 CTGGCTGGGGTTCACAGACCCGG - Intronic
1084692023 11:70733048-70733070 CGGGGTGGGAGAGACAGACGCGG + Intronic
1085048206 11:73365482-73365504 CTGGATGGTAGAGACACACGTGG - Exonic
1085888156 11:80545533-80545555 CTGGAAGGGGCCCACAGACAAGG - Intergenic
1086052846 11:82614313-82614335 TTGTATGGGGGACACAGAATGGG - Intergenic
1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG + Intronic
1087407828 11:97752010-97752032 CTGGATGTGGGACAAAAACTTGG - Intergenic
1089628790 11:119770522-119770544 CAGGAGGGAGGACACAGAGGAGG + Intergenic
1089676951 11:120096647-120096669 CTGGGTGTGGGACACACATGTGG + Intergenic
1090242295 11:125192692-125192714 CTGGATGGGGAACCCAGGCCAGG + Intronic
1090270436 11:125382014-125382036 GTAGCTGGGGGACACAGTCGTGG + Intronic
1090444146 11:126748945-126748967 CTGGATGGAGGTCACATAAGAGG - Intronic
1090628578 11:128626867-128626889 CTGGGTAGGGGACACAGAGGAGG + Intergenic
1091068631 11:132542204-132542226 CTGGCTGGGGAAGGCAGACGTGG + Intronic
1091909750 12:4220073-4220095 CTGGCTGGGTGGCACAGAAGAGG - Intergenic
1092209256 12:6635814-6635836 TTGGGTGGGGGACAGAGAAGAGG - Intronic
1096624623 12:52886790-52886812 GTGGGTGAGGGACACAGAAGGGG + Intergenic
1098904826 12:76151072-76151094 CTGGATGGGGGTCAGAGGCTGGG + Intergenic
1102192865 12:111002131-111002153 CTGGGTGGGGGCCACAGAACTGG + Intergenic
1102709541 12:114914085-114914107 CTGGATGGGGGCCAGAGTCAGGG + Intergenic
1103566621 12:121819381-121819403 CTGGATGGGGGACACAGACGAGG - Intronic
1105871315 13:24507900-24507922 CTGGATGGGGGATACAGCATGGG - Intronic
1108692327 13:52870626-52870648 GTGGATGAGGGACACAGATCAGG + Intergenic
1109594383 13:64530785-64530807 CTGGGTGGGGGCCACAGAACTGG - Intergenic
1109624623 13:64958661-64958683 CTGGATGGAAGACTCGGACGTGG - Intergenic
1110181551 13:72623924-72623946 ATGGATGGTGGACACTGATGAGG - Intergenic
1112524247 13:100128836-100128858 CTGTAGAGGGGACACAGAGGAGG - Intronic
1113789781 13:113022200-113022222 GTGGATGGTGGACACAGAGGTGG - Intronic
1117605043 14:57420225-57420247 TTGGGTGGGGGAGACAGAAGTGG - Intergenic
1118260802 14:64244932-64244954 CAGGAGGAGGGACACAAACGAGG - Intronic
1119915474 14:78397413-78397435 CAGAATGGAGGACACAGAGGGGG - Intronic
1122266597 14:100549644-100549666 CTGGATGGTGCACCCAGACACGG + Intronic
1122291201 14:100681343-100681365 GGAGATGGGGGACACACACGTGG + Intergenic
1122461989 14:101903548-101903570 GTGCGTGGGGGACACAGACGAGG - Intronic
1122856087 14:104560922-104560944 CTGGACAGGGGACACAGATATGG - Intronic
1122986531 14:105214205-105214227 CTGGAAGGGGGACAAAGTGGGGG - Intronic
1123404227 15:20010701-20010723 CTGAGTGAGGGACAGAGACGGGG + Intergenic
1123513566 15:21017347-21017369 CTGAGTGAGGGACAGAGACGGGG + Intergenic
1124911807 15:33928579-33928601 CTGAATGGGGGAGGCAGAGGAGG + Intronic
1126973409 15:54146577-54146599 CTGGAAGAGGGACAGAGAAGAGG + Intronic
1128567369 15:68710277-68710299 CTGGGTGGGGGACACAGTGGGGG + Intronic
1128802674 15:70506815-70506837 CTGGGTGGGGGCCACAGAAGTGG - Intergenic
1129110354 15:73333589-73333611 CTTGATGGGGGCCACAGGTGGGG - Intronic
1129376823 15:75138737-75138759 CTGGAAGGGGGACACAGGGAAGG + Intergenic
1130225230 15:82052192-82052214 CTGCTTGGGGGAGACAGAGGAGG + Intergenic
1130449782 15:84039429-84039451 ATGGATGGGGGACAGTGAGGAGG + Exonic
1135753235 16:25073798-25073820 CTGGCTGGTGGCCACAGATGGGG + Intergenic
1137042471 16:35625839-35625861 CTGGGTGGGGGGCACAGATCAGG - Intergenic
1137085520 16:36117348-36117370 CTGGATGTGGGAGACAGCAGTGG - Intergenic
1138731627 16:59201606-59201628 CTGGGTGGGGGCCACAGAACTGG + Intergenic
1141745276 16:85921304-85921326 ATGGATGCAGGACGCAGACGGGG - Exonic
1142357448 16:89608716-89608738 CTGTACTGAGGACACAGACGAGG - Intergenic
1142478464 17:203926-203948 CGGGCTGGGGCACACAGACCAGG + Intergenic
1146739412 17:35268892-35268914 CAGGATGTGGGAAACAGATGAGG - Exonic
1148071605 17:44911798-44911820 CTAGGTGGGGGACACATATGGGG + Intronic
1148785599 17:50144767-50144789 ATGGATGGGGGAGGCAGACATGG - Intronic
1149205045 17:54234098-54234120 CTGGATGGTGGATACAGTTGAGG + Intergenic
1151518561 17:74612912-74612934 AGGGATGGGGGCCACAGAAGGGG - Intronic
1151883744 17:76911314-76911336 CTGCACTGGGGACACAGACAAGG - Intronic
1152104927 17:78323280-78323302 CTGGAGGGAGGAAACAGACCAGG + Intergenic
1152581231 17:81166340-81166362 CGGAGTGGGGGACACAGAAGGGG + Intergenic
1152892741 17:82891748-82891770 CGGCCTGGGGGACACAGAGGGGG + Intronic
1153342005 18:3984901-3984923 CTGAATGGAGGACACAGGCAGGG - Intronic
1155296068 18:24385554-24385576 GTGGAGAGGGGACACAGAAGAGG + Intronic
1157818827 18:50750685-50750707 CAGGTTGGGGGACACAGAATGGG + Intergenic
1157916640 18:51670096-51670118 CTGAATGGGGAACACAGAGTAGG + Intergenic
1159634208 18:70785482-70785504 CTGGATGATGGACACAGGTGAGG + Intergenic
1160754815 19:751623-751645 CTGGTTTGGGGACACGGAGGAGG + Intronic
1161040868 19:2110187-2110209 CTGGATGGTGAACACATACTGGG + Exonic
1161208924 19:3056357-3056379 CTGTATGGGGGAGAGAGAGGGGG + Intronic
1161588381 19:5117696-5117718 GTGGATGGGGGACACGGGAGTGG - Intronic
1161596572 19:5153901-5153923 CCGGATGGGGGACAGGGACAGGG - Intergenic
1162175169 19:8824865-8824887 TGGGATGGGGGATACAGACGGGG - Intronic
1162382507 19:10339778-10339800 CAGGGTGGGGGACCCAGACGGGG + Exonic
1162819208 19:13212523-13212545 CTGCATGGGGGACAGAGGCCGGG + Intronic
1162953388 19:14085213-14085235 CAGGATGGGTGACACACACCAGG - Intronic
1162968735 19:14167770-14167792 GGGGGTGGGGGACACAGACTGGG + Intronic
1163462238 19:17445983-17446005 ATGGATGGTGGACACTGACTTGG - Intronic
1163667107 19:18608302-18608324 CTGGATGGAGAAGACAGACAAGG + Intronic
1164595777 19:29530000-29530022 CTGGATGTGGGACACGGCCTCGG - Exonic
1165462003 19:35949444-35949466 CTGGAAGGGGGACACACACTTGG + Intergenic
1166347512 19:42175831-42175853 CGGGATGGGGCACTCAGAGGCGG - Intronic
1166944546 19:46388861-46388883 ATGGGTGGGTGACACATACGGGG - Intronic
1167292734 19:48633411-48633433 CTGGATGTGGGAGATAGACTTGG - Intronic
924959247 2:19028-19050 CTTGATAGGGGACACAGCAGAGG + Intergenic
925038186 2:708524-708546 CTGCGTGGGGGACCCAGACGAGG - Intergenic
925725597 2:6867597-6867619 CTTGGTGGGGGACACAGGAGAGG - Intronic
928671823 2:33610616-33610638 CTGGGTGGGGGCCACAGAACTGG - Intergenic
928820464 2:35355507-35355529 CTGGATGTGGGACAAAGACTTGG - Intergenic
929795936 2:45058392-45058414 GTGGATGGGGGACAAGGATGAGG + Intergenic
930312416 2:49757886-49757908 CTAGATGGGGGAGAGAGAGGAGG + Intergenic
931516565 2:63053684-63053706 CTGGATGGGGGACAGGGAGTGGG - Intronic
932321683 2:70827125-70827147 GTGGGATGGGGACACAGACGAGG - Intergenic
939189764 2:138902404-138902426 CTGGAAGGGCGAAACAGACGAGG - Intergenic
939579246 2:143928811-143928833 CTAGATGGGGGAGGCAGAGGGGG - Intergenic
943607057 2:189988101-189988123 CTGGGTGGGGGCCACAGAACTGG + Intronic
944062456 2:195583707-195583729 CTGGAAGGGAGAAACAGACGAGG - Intronic
946034656 2:216732156-216732178 CTGGAATGGGAACACAGAAGCGG + Intergenic
947577861 2:231291212-231291234 TTGGGTGGGGGACAGAGAAGAGG - Intronic
948106599 2:235419600-235419622 GTGGCTGGGGGGCCCAGACGCGG - Intergenic
948387649 2:237591509-237591531 CTGGAGGGGGGACACTGGCCTGG + Intronic
948868933 2:240788702-240788724 CTGGATGGGGAAGGCAGAAGCGG + Intronic
1170128695 20:12994887-12994909 CTAGATGGAGGAGACACACGAGG - Intergenic
1170509107 20:17058647-17058669 CTGGGTGGGGGCCACAGATCTGG + Intergenic
1172062531 20:32196373-32196395 CTTCATGGGGGACACAGACGGGG + Exonic
1172190838 20:33061027-33061049 CTGGAAGGTGGACACAGAACGGG - Intronic
1172261621 20:33571168-33571190 CTGGAGGGGGGACAGAGAATTGG + Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1172621367 20:36320279-36320301 GGGGAAGGGGGACACAGAGGAGG - Intronic
1173110315 20:40181345-40181367 CTCCATGGGGGATACAGAAGGGG + Intergenic
1173632884 20:44529904-44529926 CTGGATGAGGGCCACAGAACTGG + Intergenic
1174207823 20:48853931-48853953 CTGGATGGGTGAGCCAGATGGGG + Intergenic
1174782325 20:53401217-53401239 CTGGAGGGGAGACACAGGCTAGG + Intronic
1175183680 20:57165812-57165834 CTGGATGGGGGACTCTGGCCTGG + Intergenic
1175332600 20:58175672-58175694 CTACAGGGAGGACACAGACGAGG - Intergenic
1175387341 20:58605675-58605697 CTGGATGGAGGCCACAGCTGGGG + Intergenic
1175529151 20:59662311-59662333 TGGGGTGGGGGACACAGAGGCGG + Intronic
1175818761 20:61897272-61897294 CGGGATGGGGACCAGAGACGAGG - Intronic
1176045864 20:63092272-63092294 CTGCGTGGGAGACACAGAAGTGG + Intergenic
1176050734 20:63118180-63118202 CAGGGTGGGGGTCAGAGACGTGG - Intergenic
1178125237 21:29508719-29508741 CTGGATGCAGGACAAAGATGAGG - Intronic
1179947347 21:44687190-44687212 CTGGATTGGGGCCACTGAGGCGG + Intronic
1180105642 21:45616576-45616598 CTGGGTGGGTGAGGCAGACGCGG - Intergenic
1181026604 22:20131097-20131119 CTGGGGGGGGGACCCACACGAGG + Intronic
1181105921 22:20575171-20575193 CGGGATGGCGGACACAGCGGTGG - Exonic
1181513732 22:23400218-23400240 CTGGATGGGCGAGGCAGGCGTGG + Intergenic
1181619451 22:24078714-24078736 CTGGGTGTGGTACACAGAAGGGG - Intronic
1182112416 22:27732926-27732948 CTGCATGCGGGACACAGAACAGG + Intergenic
1183693767 22:39407132-39407154 TTGGCTGGGGGAGACAGACATGG + Intronic
1183832200 22:40424206-40424228 CTGGGTGGGGGATGCAGAGGTGG + Exonic
1185009702 22:48306148-48306170 GGGGATGGGGTACACAGAGGAGG + Intergenic
1185352686 22:50346287-50346309 CTGACTGGGGGACACTGAAGGGG - Intronic
1185352808 22:50346771-50346793 CTGACTGGGGGACACTGATGGGG - Intronic
950481453 3:13246849-13246871 CTGGATGGGGGACACAGCTGGGG + Intergenic
950626496 3:14251259-14251281 CTGGGTGGGGGCCACAGAACTGG + Intergenic
955429610 3:58828942-58828964 CTGGATGTGGGATAAAGAAGCGG + Intronic
955828401 3:62974432-62974454 CTGGATGGTGAACACAGAAAAGG + Intergenic
957904974 3:86542632-86542654 CTGCATTGGGGACAGAGACTAGG + Intergenic
961508529 3:127387565-127387587 CTGGATGGGTGACACTGGTGGGG - Intergenic
962419008 3:135210939-135210961 TTGGATGAGGCACAGAGACGCGG + Intronic
963123877 3:141797741-141797763 CTGGATTAGCGACGCAGACGGGG - Intronic
966975240 3:185077144-185077166 CTGTATGGAGGACAGAGAAGGGG + Intergenic
967537624 3:190625079-190625101 CTGGATGTGGAACATAGATGTGG + Intronic
968639348 4:1703890-1703912 TTGGGTGGGGGACAGAGATGAGG - Intronic
969285551 4:6200079-6200101 GTGGAAGGGGGACCCAGAGGGGG + Intronic
971240840 4:24887557-24887579 CTGGATGGGGGATGGAGAAGAGG - Intronic
971500826 4:27316324-27316346 CAGGGTGGGGGACACAGGCCTGG + Intergenic
975265200 4:72355618-72355640 ATGGATGGGGGAAACCCACGAGG - Intronic
975393511 4:73848124-73848146 TTGGAGGGGGCACACAGAGGGGG + Intronic
975919387 4:79366220-79366242 CTGGATTAGGGACACAGTGGGGG - Intergenic
975969118 4:80012642-80012664 GGGGGTGGGGGAGACAGACGTGG + Intronic
976327779 4:83792650-83792672 CTGGATCTGGGTCACAGAGGTGG - Intergenic
976367289 4:84245548-84245570 CTTCATGGGGGACACGGACGGGG - Intergenic
978825911 4:113023359-113023381 GTGGGAGGTGGACACAGACGGGG - Intronic
981536917 4:145809725-145809747 CTGGATGGGGGCCACAGGACTGG - Intronic
985869364 5:2542159-2542181 CTGGAAGGGGGACACATCCAGGG - Intergenic
990594709 5:57301126-57301148 CTGGGTGGGGGCCACAGAGGAGG + Intergenic
997613683 5:135232029-135232051 CTGGCTTGGGGAGACAGAGGGGG + Intronic
998039365 5:138942876-138942898 CTGGGTGGGGGATACTGACCAGG - Intergenic
1000373323 5:160557562-160557584 TTGGATGGGAGAGGCAGACGGGG - Intergenic
1001446697 5:171790772-171790794 CTGGAAGGCAGACACAGAAGTGG - Intronic
1003312378 6:4980822-4980844 CTGGATGGGGGCCACAGAACTGG + Intergenic
1004115660 6:12764925-12764947 GTGGATTGGAGGCACAGACGTGG + Intronic
1005963646 6:30711373-30711395 CAGAATTGGGGACACAGAGGAGG + Intronic
1006055361 6:31379898-31379920 GTAGATGGGGGACACAGGGGAGG + Intergenic
1007634868 6:43293290-43293312 CTAGATGGGAGCCACAGACCAGG + Intergenic
1015197121 6:130536489-130536511 TTGGCTGGGGAACACAGGCGAGG - Intergenic
1017238295 6:152140024-152140046 CTGGCTGGGGGACACGGAGGAGG - Exonic
1017457596 6:154615890-154615912 CTGGATGGGGGCCACGTATGGGG + Intergenic
1019299209 7:295172-295194 CTGGCTGGGCGACACTGAGGAGG - Intergenic
1019521168 7:1461104-1461126 GGGGATGGGGGACACAGGGGTGG + Intergenic
1019525448 7:1478549-1478571 CTGGATGGGATACACCGATGGGG - Intronic
1019648051 7:2141491-2141513 CGGGTTGGGGGACATAGACCCGG - Intronic
1021779715 7:24091325-24091347 AAGGATGGGGGACACAGATGAGG + Intergenic
1021963774 7:25897558-25897580 CTGGGTGGGGGAGAAAGACGTGG - Intergenic
1025258806 7:57403717-57403739 CTGGATCGGGGGCAGAGAAGCGG + Intergenic
1025639750 7:63354852-63354874 CTGGGTGGGGGACAAAGAAGTGG - Intergenic
1025642949 7:63393240-63393262 CTGGGTGGGGGACAAAGAAGTGG + Intergenic
1027187376 7:75980443-75980465 CTGGCTGCAGGAGACAGACGTGG + Exonic
1029366065 7:100117236-100117258 CTAGATGGTGGACGGAGACGGGG - Intronic
1029559655 7:101294162-101294184 CTGGGTGGGGGCCACAGATCTGG + Intergenic
1032122880 7:129169378-129169400 CGGGTTGGGGGACGCAGGCGCGG - Intronic
1033064631 7:138142582-138142604 TAGGGTGGGGGACACAGAGGTGG + Intergenic
1033602698 7:142899650-142899672 AGGGATGGGGGAGACAGAGGGGG + Intergenic
1034155647 7:148954434-148954456 CTGGAGAGGGAACACACACGGGG - Intergenic
1034419580 7:150982127-150982149 CTGCAAGGGGGACACAGTAGTGG + Intergenic
1034437570 7:151070438-151070460 CACGCTGGGGGACACAGACAGGG - Exonic
1034543391 7:151774375-151774397 CAGGAGGGGGAACACAGATGGGG - Intronic
1035237600 7:157508946-157508968 CAGGCTGGGGGACACACAGGAGG + Intergenic
1035718998 8:1776916-1776938 CTGGATGGTTTACACAGACACGG + Intronic
1040509769 8:48083915-48083937 CTGGATGTGGGACCCTGACCAGG + Intergenic
1040697540 8:50020333-50020355 TTAGATGGGAGACACAGACAAGG + Intronic
1041956434 8:63561644-63561666 CTGGATGGGGGACAAGAACTTGG + Intergenic
1042129247 8:65570828-65570850 CTGCATGGGCGACACAGCCTGGG - Intergenic
1042306925 8:67342975-67342997 CTGGATGTGGGGCAGAGGCGGGG - Intronic
1043442020 8:80284641-80284663 CTGGATGAGAGACAGAGACTAGG + Intergenic
1044987770 8:97770034-97770056 CTGGGTGGGGGGCACAGAACTGG + Intergenic
1049404240 8:142444581-142444603 CAAGATGGGGGACAGAGACAAGG - Intergenic
1049568996 8:143359670-143359692 ACGGAGGGGGGACACAGAGGAGG + Intronic
1052739088 9:32376119-32376141 CTGGAAGGGGGATGCAGATGAGG + Intergenic
1053463384 9:38287882-38287904 CTGGTTGGGGGGGACAGACGTGG + Intergenic
1055869313 9:80855231-80855253 CTGGATGCTGGACAAAGACCTGG - Intergenic
1057226086 9:93293988-93294010 CTGGATGAGGGAAAGAGACATGG - Intronic
1058416365 9:104793118-104793140 CTGGTTGAGGGTCACAGAGGAGG - Intronic
1060107084 9:120879293-120879315 GTGGATGGGAGACACACAGGTGG + Intronic
1060188591 9:121578410-121578432 CAGAATGGGGAACACAGACTTGG + Intronic
1186346770 X:8702132-8702154 CTCTATGGGGGACATAGATGTGG - Intronic
1186606810 X:11100818-11100840 CTGGATGAGGAACACAGTCCTGG - Intergenic
1187230826 X:17421273-17421295 CTGGATTGTGGAGACAGACCTGG + Intronic
1189360252 X:40344413-40344435 CTGGATGCAGGACAAGGACGTGG + Intergenic
1190480784 X:50874750-50874772 CTGGATGGAGGATGCAGAAGAGG + Intergenic
1190688323 X:52893401-52893423 CTGGATCTGGGACTCACACGCGG - Intronic
1190697660 X:52962391-52962413 CTGGATCTGGGACTCACACGCGG + Intronic
1192225391 X:69223826-69223848 CTGGCTTGGGGAGACAGAGGAGG + Intergenic
1195862958 X:109400659-109400681 CTGGTTGGGGGACAAAGCCTGGG - Intronic
1200084280 X:153595744-153595766 CTGGATGGAGGGCAGAGGCGGGG - Intronic
1202053488 Y:20805047-20805069 CTGCATGAGGGTCACAAACGTGG - Intergenic