ID: 1103567501

View in Genome Browser
Species Human (GRCh38)
Location 12:121823826-121823848
Sequence CACCGCGGGCTGCTACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103567501_1103567507 21 Left 1103567501 12:121823826-121823848 CCAGTCTGTAGCAGCCCGCGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1103567507 12:121823870-121823892 ACCACCGTCACTTCCCAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 102
1103567501_1103567509 22 Left 1103567501 12:121823826-121823848 CCAGTCTGTAGCAGCCCGCGGTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1103567509 12:121823871-121823893 CCACCGTCACTTCCCAAGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103567501 Original CRISPR CACCGCGGGCTGCTACAGAC TGG (reversed) Intronic
904302224 1:29561671-29561693 CCCCAAGGGCTGCTACAGAGAGG - Intergenic
907463291 1:54618732-54618754 CACCGCGAGCTCCTGCAGATGGG - Intronic
911142731 1:94523624-94523646 CACAGGGGTCTGCTACAGAATGG + Intergenic
1063684600 10:8224781-8224803 CACTGCGGGCTGCTCCAGCAGGG - Intergenic
1069187607 10:65445038-65445060 CACAGCAAGCTGCTAAAGACTGG - Intergenic
1069856133 10:71442300-71442322 CAGCACTGGCTGCTTCAGACAGG - Intronic
1074904726 10:117851740-117851762 CACCCCGGGCAGGTACAGCCAGG - Intergenic
1078182469 11:9023910-9023932 CACATGAGGCTGCTACAGACGGG - Intronic
1078571112 11:12458685-12458707 CACCCTGGGCTGCCACAGAGGGG - Intronic
1081873902 11:46396170-46396192 CCCCAGGGCCTGCTACAGACTGG - Intergenic
1088249580 11:107850974-107850996 CACCGCGCCCAGCTAAAGACAGG - Intronic
1092055586 12:5505777-5505799 CACCAGGGGCTGGCACAGACTGG - Intronic
1102254043 12:111405979-111406001 CACCGCGGGCCGCGACAGTCCGG - Exonic
1103404285 12:120664273-120664295 CACAGGGGGCTGCTATAGAGGGG + Intronic
1103567501 12:121823826-121823848 CACCGCGGGCTGCTACAGACTGG - Intronic
1118141213 14:63085447-63085469 CACTCCTGGCTGCTACAGCCAGG + Intronic
1119989169 14:79175681-79175703 AACCGTGGGCTGCTTCAGAGTGG + Intronic
1125736755 15:41932437-41932459 CACCGCAGGGTGCTTCAGAAAGG + Intronic
1126825795 15:52546485-52546507 CACAGCTGGCTGCTACCTACAGG - Intergenic
1127743942 15:61944619-61944641 CACTGCGGACTACTACAGAGAGG + Intronic
1129592713 15:76931748-76931770 CTCCGCGGGCGGCTACAGAGAGG - Exonic
1136470190 16:30474420-30474442 CACCACAGGCTCCTCCAGACGGG - Intronic
1142809350 17:2387898-2387920 GACCGCGTGCTGCGGCAGACGGG - Exonic
1144849189 17:18235515-18235537 CAGCGAGGGCTGCTGCTGACGGG + Exonic
1147844793 17:43397465-43397487 CACTGCAGCCTGCTACAGTCTGG - Intergenic
1149551891 17:57546725-57546747 CACAGCGGGAGGCTACAGCCTGG - Intronic
1155114593 18:22751990-22752012 CACTGTGGGCTGCCACAGCCTGG + Intergenic
1155116928 18:22778064-22778086 CAGCATGGGCTGCTACAGGCTGG + Intergenic
1155807583 18:30191953-30191975 CACCACTGGCGGCTAAAGACTGG - Intergenic
1168380034 19:55912497-55912519 CACCTTCGGCTGCTTCAGACAGG + Exonic
928213761 2:29343811-29343833 CACAAAGGGCTGCTTCAGACTGG + Intronic
931269458 2:60688743-60688765 CACCGCGCCCAGCTGCAGACTGG - Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
935213286 2:100956370-100956392 CACCGGGGGCTGCTGGAGGCTGG - Intronic
939526191 2:143297386-143297408 CACTGTGGGCTGCTACAGGAAGG - Intronic
946419692 2:219557856-219557878 CTCCGGGGGCTGCTCCAGACTGG + Exonic
1168827982 20:826845-826867 CAACCCTGGCTGCTACACACTGG + Intergenic
1170106951 20:12762042-12762064 CACTGGGGGCTGCTACAGAGAGG - Intergenic
1175581242 20:60101691-60101713 CACCGCCGGCTCCTACAAGCAGG + Intergenic
1179921832 21:44511811-44511833 CACCCTGGGCTGCTACAGGGCGG - Intronic
1180036706 21:45253961-45253983 GACCGGGGGCTGCACCAGACCGG - Intergenic
1180706131 22:17811018-17811040 CACTGAGGGCTGCTGCAGGCTGG - Intronic
1181169833 22:21001872-21001894 CGCCGCCGGCTGCTGCACACGGG - Exonic
1183407314 22:37636677-37636699 CACCGAGGGATACTACAAACAGG + Intronic
971944553 4:33256306-33256328 CACGGCGGGCAGTTAAAGACAGG + Intergenic
975498167 4:75057397-75057419 CACAAGGGGCTGCTCCAGACAGG - Intergenic
980825101 4:138063469-138063491 CACAGCTGGCTGCTACTGCCAGG + Intergenic
1001592965 5:172878921-172878943 CACCGAGGGCTCCGACAGGCTGG + Intronic
1005696138 6:28354488-28354510 CACCCAGGGCTGATACACACAGG + Intronic
1007719371 6:43876205-43876227 CAGCGCCAGATGCTACAGACAGG - Intergenic
1027938372 7:84637658-84637680 CACTGCTGGCTGCTGCAAACAGG - Intergenic
1029990908 7:104961816-104961838 CACCGCGCCCGGCTCCAGACTGG + Intergenic
1030854305 7:114533295-114533317 CAGAGAGGGCTGCTACAGTCTGG - Intronic
1032097595 7:128947341-128947363 CACCACGGGCGGCTGCAGAGTGG - Exonic
1062268490 9:135698326-135698348 CACAGCGTGCTGCTCCTGACTGG + Exonic